Application of soybean GmSPCH gene in negative regulation of drought resistance and salt tolerance and breeding method

Abstract

This invention belongs to the fields of plant genetic engineering and crop stress resistance breeding technology, specifically involving the application and breeding methods of negative regulation of drought resistance and salt tolerance by the soybean GmSPCH gene. This invention reveals for the first time that the soybean GmSPCH family genes negatively regulate salt tolerance, and that loss-of-function mutations in the GmSPCH gene using CRISPR-Cas9 technology can significantly improve soybean salt tolerance. The soybean gmspch3;4 double mutant provided by this invention exhibits significantly enhanced salt tolerance under salt stress, with no significant difference in stomatal density and net photosynthetic rate compared to the wild type, breaking the bottleneck of traditional stress resistance breeding where stress resistance is often accompanied by growth inhibition. This invention also provides a salt tolerance breeding method using GmSPCH as the negative regulatory target, and the application of the aforementioned double mutant in salt tolerance breeding.

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and crop stress resistance breeding technology, specifically involving the application and breeding methods of the negative regulation of drought resistance and salt tolerance by the soybean GmSPCH gene. Background Technology

[0002] Soybean (Glycine max) is a globally important oilseed crop and protein source, and a key crop for ensuring national food security. However, soybean growth and development are highly susceptible to abiotic stresses such as drought and high salinity, leading to significant declines in yield and quality. Statistics show that approximately 20% of irrigated land globally is threatened by salinization, and drought stress causes the largest agricultural losses among all abiotic stresses. my country has long relied on soybean imports, resulting in a significant supply-demand imbalance. Therefore, identifying key genes for drought and salt tolerance in soybeans and cultivating stress-resistant new varieties is of great importance for increasing soybean yield and ensuring food security.

[0003] Plants have developed complex stress response mechanisms through long-term evolution. When plants sense drought or high salt stress, they rapidly activate a series of signal transduction pathways, including the abscisic acid (ABA) signaling pathway, the reactive oxygen species (ROS) scavenging system, and the mitogen-activated protein kinase (MAPK) cascade, thereby regulating the expression of downstream stress-resistance genes to maintain cellular homeostasis and water balance. Transcription factors, as the hubs of the signal transduction network, play a central role in regulating plant responses to abiotic stress. Several transcription factor families have been reported to participate in the regulation of plant drought and salt tolerance, such as WRKY, NAC, DREB, MYB, and bHLH.

[0004] Stomata are crucial channels for gas exchange and water transpiration between plants and their external environment. Their density and aperture directly affect the efficiency of photosynthesis and water use. Therefore, stomatal development regulation has become an important target for improving crop drought and salt tolerance. In Arabidopsis, stomatal development initiation is controlled by the bHLH family transcription factor SPEECHLESS (SPCH). As a key regulator of stomatal lineage establishment, SPCH determines the frequency of asymmetric stomatal initiation, thus affecting the final stomatal density in leaves. Studies have shown that loss of SPCH function leads to complete stomatal absence, while overexpression produces a large number of stomata. In recent years, SPCH has been found to not only respond to the ABA signaling pathway but also regulate its own stability through MAPK phosphorylation modification, thereby directly coupling external stress signals with stomatal development. Existing research shows that under water-deficient conditions, Arabidopsis SnRK2 kinase directly phosphorylates SPCH and restricts stomatal formation, with the SPCH-S240D mutant exhibiting stronger drought resistance; under osmotic stress, the MAPK signaling pathway reduces AtSPCH protein levels post-transcriptionally. The above studies indicate that SPCH is a potential molecular hub for integrating stomatal development and stress response.

[0005] However, current research on SPCH regulation of abiotic stress responses mainly focuses on model plants such as Arabidopsis thaliana, with extremely limited functional studies in important crops, especially soybean. Existing studies have preliminarily discovered through gene silencing that soybean SPCH homologs may be involved in stomatal lineage initiation, but have not systematically studied the specific functions and application value of SPCH family members in drought and salt tolerance. Existing research on soybean stress resistance largely focuses on other gene families: such as GmWRKY54, which activates ABA and Ca2+. 2+ Signaling pathways enhance drought resistance, and GmMYB118 has been identified as a transcription factor responding to drought and salt stress. Among the published patents, CN121249688A reports that the soybean ARF family gene Gm12g076200 positively regulates drought stress tolerance; however, while overexpression improves drought resistance, gene deletion mutants exhibit significant decreases in fresh weight and chlorophyll content, with growth defects that are irreversible after rehydration. CN118389570A reports that the rice OsDRS1 gene negatively regulates drought resistance; and CN113214371A reports that the loquat EjWRKY17 gene positively regulates drought resistance. None of these existing technologies involve the soybean SPCH family genes, nor do they reveal the function of SPCH in negatively regulating salt tolerance or its potential application in breeding. Summary of the Invention

[0006] In response to the problems mentioned in the background art, such as the lack of understanding of the negative regulation of salt tolerance function of the SPCH gene in existing soybean stress resistance breeding technology, the lack of technical solutions to improve salt tolerance without affecting stomatal density and photosynthetic efficiency, and the lack of application of soybean gmspch3;4 double mutant breeding, this invention provides the application and breeding method of negative regulation of drought resistance and salt tolerance of soybean GmSPCH gene.

[0007] This invention includes the following technical solutions:

[0008] This invention provides an application of the soybean GmSPCH gene in negatively regulating drought resistance and salt tolerance. The application is as follows: using the soybean GmSPCH gene as a negative regulatory target, by reducing its expression level or causing loss-of-function mutations, the drought resistance and salt tolerance of soybean can be improved.

[0009] Preferably, the GmSPCH gene includes at least one of GmSPCH1, GmSPCH2, GmSPCH3, and GmSPCH4; the corresponding gene locus numbers of the GmSPCH1, GmSPCH2, GmSPCH3, and GmSPCH4 genes in the soybean Williams 82 reference genome are GLYMA04g238400, GLYMA06G125500, GLYMA13g040100, and GLYMA14G160700, respectively.

[0010] Preferably, the loss-of-function mutation is achieved through gene editing technology, including CRISPR-Cas9 gene editing; the sgRNA target sequences for editing GmSPCH1 and GmSPCH2 are shown in SEQ ID NO:1 and SEQ ID NO:2; and the sgRNA target sequences for editing GmSPCH3 and GmSPCH4 are shown in SEQ ID NO:3 and SEQ ID NO:4.

[0011] Furthermore, the loss-of-function mutation is a double gene mutation of GmSPCH3 and GmSPCH4.

[0012] This invention provides a soybean gmspch3;4 double mutant, which is a soybean plant with loss-of-function mutations in both the GmSPCH3 and GmSPCH4 genes. The corresponding gene loci numbers in the soybean Williams 82 reference genome are GLYMA13g040100 and GLYMA14G160700, respectively. The mutant exhibits significantly higher salt tolerance under salt stress than wild-type soybean, while its stomatal density and net photosynthetic rate are not significantly different from those of wild-type soybean.

[0013] This invention provides the application of the soybean gmspch3;4 double mutant in salt-tolerant breeding.

[0014] This invention provides a breeding method for improving the salt tolerance of soybeans, comprising the following steps: causing a loss-of-function mutation in the GmSPCH gene in soybean plants to obtain mutant plants; screening mutant plants with improved salt tolerance under salt stress; wherein the GmSPCH gene includes at least one of GmSPCH1, GmSPCH2, GmSPCH3 and GmSPCH4, and their corresponding soybean Williams 82 reference genome loci numbers are GLYMA04g238400, GLYMA06G125500, GLYMA13g040100 and GLYMA14G160700, respectively.

[0015] Preferably, the loss-of-function mutation is a double mutation of GmSPCH3 and GmSPCH4. The resulting soybean gmspch3;4 double mutant exhibits significantly higher salt tolerance under salt stress than the wild type, while its stomatal density and net photosynthetic rate are not significantly different from the wild type.

[0016] This invention provides the application of the soybean GmSPCH gene in the breeding of salt-tolerant soybean varieties. Using the GmSPCH gene as a negative regulatory target, the GmSPCH gene is mutated by loss of function through CRISPR-Cas9 gene editing technology to obtain soybean varieties with improved salt tolerance.

[0017] Specifically, the method for constructing the soybean gmspch3;4 double mutant of the present invention includes the following steps:

[0018] S1: sgRNA target sequences were designed and synthesized for the soybean GmSPCH3 and GmSPCH4 genes, respectively, as shown in SEQ ID NO:3 and SEQ ID NO:4.

[0019] S2: The CRISPR-Cas9 gene editing vector carrying the sgRNA target sequence was transferred into soybean plants. The GmSPCH3 and GmSPCH4 genes were mutated by gene editing to obtain homozygous double mutant plants.

[0020] Preferably, the CRISPR-Cas9 gene editing vector contains a reporter gene and / or a selection marker.

[0021] Preferably, the screening marker includes an resistance marker gene or a fluorescent protein marker gene.

[0022] S3: Sequencing and identification of the plants obtained in S2 confirmed that frameshift mutations occurred in the GmSPCH3 and GmSPCH4 genes, resulting in loss of protein function.

[0023] S4: Salt tolerance and photosynthetic parameters of the identified homozygous double mutants were evaluated, and lines with significantly higher salt tolerance than wild type under salt stress and no significant difference in stomatal density and net photosynthetic rate from wild type were screened.

[0024] Preferably, the salt tolerance assessment includes: treating the plants to be tested with 250 mM NaCl for 7 days, observing phenotypic changes, and statistically analyzing the degree of leaf damage.

[0025] Preferably, the determination of photosynthetic parameters includes: measuring net photosynthetic rate, transpiration rate, stomatal conductance, and intercellular CO2 concentration using a plant photosynthesis measuring instrument.

[0026] Preferably, the salt tolerance assessment further includes determining at least one of the following physiological and biochemical indicators: superoxide dismutase activity, peroxidase activity, catalase activity, malondialdehyde content, hydrogen peroxide content, and superoxide anion content.

[0027] Furthermore, the present invention also provides the application of the soybean gmspch3;4 double mutant in hybridization breeding, using the double mutant as parent material to hybridize with other soybean varieties, thereby introducing salt tolerance traits into the target variety.

[0028] The present invention also provides the application of the soybean gmspch3;4 double mutant in soybean cultivation in saline-alkali land.

[0029] This invention also provides the application of the soybean GmSPCH gene as a negative regulatory target in screening salt-tolerant soybean germplasm resources, including detecting the expression level or sequence variation of the GmSPCH gene in the soybean germplasm to be tested.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) This invention reveals for the first time the negative regulatory function of soybean GmSPCH family genes on salt tolerance. By inducing loss-of-function mutations in the GmSPCH gene, the salt tolerance of soybean plants can be significantly improved; while overexpression reduces salt tolerance, indicating that the GmSPCH gene is a key target for the negative regulation of soybean salt tolerance.

[0032] (2) The gmspch3;4 double mutant provided by this invention exhibits significantly higher salt tolerance under salt stress than the wild type, while its stomatal density and net photosynthetic rate show no significant difference from the wild type. This characteristic breaks through the technical bottleneck of "stress resistance and growth inhibition coexisting" in traditional stress-resistant breeding, and solves the defect in existing technologies where soybean ARF family gene mutants, while improving stress resistance, lead to a significant decrease in fresh weight and chlorophyll content, which is irreversible after rehydration.

[0033] (3) This invention clarifies the target editing sites of soybean GmSPCH3 and GmSPCH4 genes and their corresponding gene locus numbers (GLYMA13g040100 and GLYMA14G160700), providing clear target information for the precise creation of salt-tolerant germplasm using gene editing technologies such as CRISPR-Cas9.

[0034] (4) This invention verified that the gmspch3;4 double mutant has higher SOD, POD and CAT antioxidant enzyme activities under salt stress, while the accumulation of malondialdehyde, hydrogen peroxide and superoxide anion in the leaves is significantly lower than that of the wild type. From a physiological perspective, the mechanism of the improved salt tolerance of this mutant is clarified - that is, it is achieved by enhancing the ability to scavenge reactive oxygen species and reducing the level of membrane lipid peroxidation.

[0035] (5) The breeding method provided by the present invention uses the GmSPCH gene as a negative regulatory target and knocks out the target gene in a targeted manner through gene editing technology. The operation is precise and the cycle is short, which overcomes the shortcomings of the traditional hybridization breeding cycle and the trait linkage burden. It provides an efficient technical solution for soybean salt tolerance molecular breeding.

[0036] (6) The present invention can use gmspch3;4 double mutant as excellent parent material to introduce salt tolerance traits into soybean varieties with different genetic backgrounds through hybridization. It has a wide range of applications and can meet the needs of soybean salt tolerance breeding in different ecological zones and for different purposes. Attached Figure Description

[0037] Figure 1 Expression analysis of GmSPCH1, GmSPCH2, GmSPCH3 and GmSPCH4 under salt stress (treatment with 250 mM NaCl for 2 h, 4 h, 12 h and 24 h) showed that the expression levels of the four genes first decreased and then increased, with the most significant decrease at 4 h of treatment.

[0038] Figure 2 Sequence alignment of the GmSPCH gene family between homozygous double mutant plants of gmspch1;2 and gmspch3;4 and wild-type (WT) plants; blue text indicates the sgRNA design sequence; "-" indicates a missing base; in the gmspch1;2 double mutant, GmSPCH1 has a 7 bp deletion at the sgRNA1 target site, and GmSPCH2 has a 14 bp deletion at the sgRNA1 target site; in the gmspch3;4 double mutant, GmSPCH3 has a 6 bp deletion at the sgRNA3 target site and a 4 bp deletion at the sgRNA4 target site, and GmSPCH4 has a 1 bp addition at the sgRNA3 target site and a 6 bp addition at the sgRNA4 target site;

[0039] Figure 3 Stomatal parameters were determined in wild-type (WT) and gmspch double mutant plants; (A) net photosynthetic rate (Pn); (B) transpiration rate (Tr); (C) stomatal conductance (Gs); (D) intercellular CO2 concentration (Ci); The net photosynthetic rate, transpiration rate and stomatal conductance of gmspch1;2 plants were all lower than those of WT and gmspch3;4 mutants;

[0040] Figure 4 Phenotypic analysis of wild-type (WT) and GmSPCH mutant plants under normal growth conditions and drought stress; AB: Phenotypic characteristics of plants and leaves under normal conditions; CD: Phenotypic characteristics of plants and leaves after 5 days of drought stress; The gmspch1;2 mutant showed better drought tolerance, while WT and gmspch3;4 showed severe leaf water loss. Scale bar = 10 cm;

[0041] Figure 5 : 3,3′-Diaminobenzidine (DAB) and nitrocyanin tetrazolium (NBT) staining of soybean leaves; (A) DAB staining of leaves of WT and gmspch double mutants under normal and drought conditions; (B) NBT staining of leaves of WT and gmspch double mutants under normal and drought conditions; After drought treatment, the leaves of WT and gmspch3;4 stained more deeply; Scale bar = 5 cm;

[0042] Figure 6Determination of physiological and biochemical indicators in leaves of different plants after drought stress; SOD, POD, CAT activities and MDA, H2O2, O2· in leaves of (AF)WT and GmSPCH mutants. - content;

[0043] Figure 7 Phenotypes of WT and GmSPCH mutant plants under normal growth conditions and salt treatment conditions; AB: Phenotypes of plants and leaves under normal conditions; CD: Phenotypes of plants and leaves after 7 days of treatment with 250 mM NaCl; The gmspch1;2 and gmspch3;4 mutants showed stronger salt tolerance; Scale bar = 10 cm;

[0044] Figure 8 Analysis of soybean plant phenotype and SPCH gene expression under normal growth conditions and salt stress; AB: Phenotype of EV control and SPCH overexpressing plants under normal conditions; CD: Phenotype under salt stress; E: SPCH gene expression in empty vector (EV) and overexpressing plants; Overexpressing plants are more severely affected by salt stress; Scale bar = 10 cm;

[0045] Figure 9 : Staining of soybean leaves with 3,3′-diaminobenzidine (DAB) and nitrocyanamide (NBT) under salt stress; (A) NBT staining of WT and gmspch double mutants; (B) NBT staining of EV and GmSPCH overexpressing plants; (C) DAB staining of WT and gmspch double mutants; (D) DAB staining of EV and GmSPCH overexpressing plants; mutant leaves stained lighter, overexpressing plants stained darker; scale bar = 5 cm;

[0046] Figure 10 Determination of physiological and biochemical indicators in leaves of different plants after salt stress; SOD, POD, CAT activities and MDA, H2O2, O2· in leaves of (AF)WT and GmSPCH mutants. - Content; SOD, POD, CAT activities and MDA, H2O2, O2· in leaves of (GL)EV and GmSPCH overexpressing plants - content.

[0047] In the above figures, Pn, Tr, Gs, Ci, SOD, POD, CAT, MDA, DAB, NBT, H2O2, and O2· - WT, EV, OE, CK, etc. are all well-known abbreviations in the field, where Pn is net photosynthetic rate, Tr is transpiration rate, Gs is stomatal conductance, Ci is intercellular CO2 concentration; SOD is superoxide dismutase, POD is peroxidase, CAT is catalase, MDA is malondialdehyde, H2O2 is hydrogen peroxide, and O2· -Superoxide anion; DAB is 3,3′-diaminobenzidine; NBT is nitrocyanocyanate tetrazolium; WT is wild-type; EV is empty vector control; OE is overexpression; CK is control group; sgRNA is single guide RNA; bp is base pair; CDS is coding sequence; qRT-PCR is real-time quantitative PCR; see attached figure. P<0.05, P<0.01, P<0.005, and P<0.001, respectively, represent statistically significant differences. The gene names and mutant names of the GmSPCH series (such as gmspch1;2, SPCH1-OE, etc.) are retained according to internationally accepted gene nomenclature rules, and their meanings are clearly understood by those skilled in the art; therefore, they are not directly translated into Chinese. All abbreviations mentioned above are well-known abbreviations in the field and are not directly translated into Chinese. Detailed Implementation

[0048] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the embodiments were carried out under conventional experimental conditions or according to the conditions recommended in the manufacturer's instructions.

[0049] 1. Experimental Materials and Methods

[0050] 1.1 Experimental Materials

[0051] 1.1.1 Plant materials

[0052] The Arabidopsis thaliana material is of ecotype Col-0.

[0053] The soybean (Glycine max) variety is Williams 82, and the seeds were sourced from Wuhan Boyuan Biotechnology Co., Ltd.

[0054] 1.1.2 Strains and Vectors

[0055] The Agrobacterium rhizogenes strain was K599, purchased from the Coolaber reagent website, catalog number CC410.

[0056] The overexpression vectors were 35S::GmSPCH1-sGFP, 35S::GmSPCH2-sGFP, 35S::GmSPCH3-sGFP, and 35S::GmSPCH4-sGFP, constructed based on the pGWB605 series vectors, and contained the Basta resistance marker gene.

[0057] The CRISPR-Cas9 gene editing vector is PEG401, and the selection marker is Basta.

[0058] 1.1.3 Main Reagents and Kits

[0059] Table 1: Main Reagents and Kits

[0060] Reagent / Reagent Kit Name brand Item number use RNA extraction kit Magen R4151 Plant total RNA extraction Reverse transcription kit Novizan R312-01 RNA is reverse transcribed into cDNA Real-time quantitative PCR premix Novizan Q321-02 qRT-PCR Plant genomic DNA extraction kit Tiangen DP305 Plant genomic DNA extraction NBT staining solution Solarborg G4816 Superoxide anion detection DAB staining solution Solarborg DA1010 Hydrogen peroxide detection SOD Activity Assay Kit Solarborg BC5250 Superoxide dismutase activity assay POD Activity Assay Kit Solarborg BC0095 Peroxidase activity assay CAT Activity Assay Kit Solarborg BC0200 catalase activity assay MDA content assay kit Solarborg BC6410 Malondialdehyde content determination <![CDATA[H2O2 Content Assay Kit]]> Solarborg BC3595 Hydrogen peroxide content determination <![CDATA[O2· - Content Assay Kit Solarborg BC1290 Determination of superoxide anion content

[0061] 1.1.4 Sequence

[0062] The sequences involved in this application are as follows:

[0063] Table 2: Sequence List

[0064] SEQ ID NO sequence name sequence type Source / Use Sequence (5′→3′) 1 sgRNA1 DNA Used for editing GmSPCH1 and GmSPCH2 TAACGAGGATGTCTCAAGAT 2 sgRNA2 DNA Used for editing GmSPCH1 and GmSPCH2 AGAGGTTTCAAGCTCAGTTT 3 sgRNA3 DNA Used for editing GmSPCH3 and GmSPCH4 GGGACACACACTTTGGTGGA 4 sgRNA4 DNA Used for editing GmSPCH3 and GmSPCH4 CTCAGTTTCAGAATCTTGTG 5 GmSPCH1 CDS DNA GLYMA04g238400, CDS Cloning (See table below) 6 GmSPCH2 CDS DNA GLYMA06G125500, CDS Cloning (See table below) 7 GmSPCH3 CDS DNA GLYMA13g040100, CDS clone (See table below) 8 GmSPCH4 CDS DNA GLYMA14G160700, CDS Cloning (See table below) 9 GmSPCH1 CDS-F DNA CDS cloning, forward primers ATGGACGATAGCTTATGCGAT 10 GmSPCH1 CDS-R DNA CDS cloning, reverse primers GCAGAATGTTTGCTGGATTTG 11 GmSPCH2 CDS-F DNA CDS cloning, forward primers ATGGACGATAATAGCTTATGCG 12 GmSPCH2 CDS-R DNA CDS cloning, reverse primers GTAGAATGTTTGCTGGATTTGTTGAGC 13 GmSPCH3 CDS-F DNA CDS cloning, forward primers ATGGAACCCCGAGAAAGTCTAT 14 GmSPCH3 CDS-R DNA CDS cloning, reverse primers GCAGAATGTTTGTTGGATTTGTTGAGC 15 GmSPCH4 CDS-F DNA CDS cloning, forward primers ATGGAACCACAGAAAAGTCCAT 16 GmSPCH4 CDS-R DNA CDS cloning, reverse primers GCAGAATGTTTGCTGGATTTGTTG

[0065] Table 3: Sequence List (Continued)

[0066] SEQ ID NO sequence name sequence type Source / Use Sequence (5′→3′) 17 GmSPCH1 crispr-F DNA CRISPR mutant identification, forward primer ATCGAATTAGCTAGAAATTCCTA 18 GmSPCH1 crispr-R DNA CRISPR mutant identification, reverse primers CATAAGCGACCTCAACACGG 19 GmSPCH2 crispr-F DNA CRISPR mutant identification, forward primer GCCAACAAACTCCTAATTAAG 20 GmSPCH2 crispr-R DNA CRISPR mutant identification, reverse primers CAAGGCATAAGCGACCTCAAC 21 GmSPCH3 crisper-F DNA CRISPR mutant identification, forward primer CGTGTTTCCAAACACTCTTTGTGTAG 22 GmSPCH3 crispr-R DNA CRISPR mutant identification, reverse primers CCCTCCGATATTCTTTAACCACC 23 GmSPCH4 crispr-F DNA CRISPR mutant identification, forward primer CTGCACTGCCTTGAGATAAC 24 GmSPCH4 crispr-R DNA CRISPR mutant identification, reverse primers GATAATTAAGGCATACGTACCC 25 qGmSPCH1-F DNA qRT-PCR, forward primer AGAGTTTGGGAGCGAACACTTTGG 26 qGmSPCH1-R DNA qRT-PCR, reverse primers TGGAGACAGCAGCAACAACAGC 27 qGmSPCH2-F DNA qRT-PCR, forward primer CACCACCGATTTCCCTCC 28 qGmSPCH2-R DNA qRT-PCR, reverse primers AGTTTCGGAATCTAGTGGAGC 29 qGmSPCH3-F DNA qRT-PCR, forward primer GCTTCGTTCCACATCGCCAGAG 30 qGmSPCH3-R DNA qRT-PCR, reverse primers ATTGATGCTTGGTCTCCCCGTTTG 31 qGmSPCH4-F DNA qRT-PCR, forward primer CTGTTATTGGCCCAACTTTC 32 qGmSPCH4-R DNA qRT-PCR, reverse primers CCTCAACCAATGTGGGACTA

[0067] Table 4: Sequence List (Continued)

[0068] SEQ ID NO sequence name sequence type Source / Use Sequence (5′→3′) 33 35S DNA Identification of transgenic plants, forward primers GAAGTTCATTTCATTTGGAGAG 34 Actin-F DNA Internal reference gene qRT-PCR, forward primer CAGCATGAAAATCAAGGTGGT 35 Actin-R DNA Internal reference gene qRT-PCR, reverse primer AGGGGACCTAACGGAGAAACT 36 M13-F DNA Universal sequencing primers, forward primers GTAAAACGACGGCCAGT 37 M13-R DNA Universal primers for sequencing, reverse primers CCAGGAAACAGCTATGACCATG 38 GLYMA_19G069200-F DNA Locus identification, forward primer ACCAGTGGAGTCTGATTCCGGCGAG 39 GLYMA_19G069200-R DNA Locus identification, reverse primers TGTCCATTTTCCGAAAACACCCTTC 40 GLYMA_18G035000-F DNA Locus identification, forward primer TGATGGGTTGTGGGATGTGG 41 GLYMA_18G035000-R DNA Locus identification, reverse primers TGGTCAACAGAATCGACGCA 42 GLYMA_14G162100-F DNA Locus identification, forward primer TCGGTGATAGGGAGCAGGAA 43 GLYMA_14G162100-R DNA Locus identification, reverse primers ACTCGCACTCCTCTCCATCT 44 GLYMA_10G001700-F DNA Locus identification, forward primer GTGGAAGCGAAGGTGAAGGA 45 GLYMA_10G001700-R DNA Locus identification, reverse primers CCACAAGCAACAAGTCAGCC 46 GLYMA_20G138800-F DNA Locus identification, forward primer ACAATGTCCCCGGTTCCTTC 47 GLYMA_20G138800-R DNA Locus identification, reverse primers AGGGTATTCAGGTTGCTGCC 48 GLYMA_01G129400-F DNA Locus identification, forward primer GATGAGGTTCAGGCTGGCTT 49 GLYMA_01G129400-R DNA Locus identification, reverse primers ACCTCTGCGATCTCAGGAGT

[0069] Sequence list description:

[0070] SEQ ID NO: 1-4 are the sgRNA target sequences used in CRISPR-Cas9 gene editing.

[0071] SEQ ID NO: 5-8 are the CDS sequences of the GmSPCH1, GmSPCH2, GmSPCH3 and GmSPCH4 genes.

[0072]

[0073]

[0074]

[0075]

[0076] SEQ ID NO: 9-16 are CDS cloning primers for four GmSPCH genes.

[0077] SEQ ID NO: 17-24 are primers for identifying CRISPR mutants.

[0078] SEQ ID NO: 25-32 are primers for qRT-PCR detection.

[0079] SEQ ID NO: 33 is the primer for identifying the 35S promoter.

[0080] SEQ ID NO: 34-35 are qRT-PCR primers for the internal reference gene Actin.

[0081] SEQ ID NO: 36-37 is the universal sequencing primer M13.

[0082] SEQ ID NO: 38-49 are primers for soybean locus-specific identification.

[0083] The GLYMA series gene loci numbers mentioned above are from the Phytozome soybean genome database (https: / / phytozome-next.jgi.doe.gov / ), and the reference genome is soybean Williams 82 (version Wm82.a4.v1).

[0084] 1.2 Experimental Methods

[0085] 1.2.1 Plant Culture Conditions

[0086] Aseptic culture of Arabidopsis thaliana: Arabidopsis thaliana seeds were surface-sterilized by immersing them in 75% ethanol for 10 min in a laminar flow hood, with the centrifuge tubes continuously inverted to ensure thorough sterilization. The seeds were then washed twice with sterile double-distilled water (ddH2O), 1 min each time, with the last rinse leaving a small amount of ddH2O to completely submerge the seeds. The seeds were then vernalized at 4 ℃ for 2 days. The vernalized Arabidopsis thaliana seeds were then sown onto the surface of 1 / 2 MS solid medium and placed in a tissue culture incubator. The culture conditions were: light intensity 12000 lx, 16 h light / 8 h dark, 25 ℃, and 55% humidity.

[0087] Soybean soil culture: Select soybean seeds with intact and plump seed coats, and dry them in a 37 ℃ oven for 3 days to prevent mold growth in the soil. Press the dried seeds, with the hilum facing down, into moist soil, cover with a thin layer of soil, and place in a plant growth chamber. Culture conditions are: light intensity 12000 lx, 16 h light / 8 h dark, 25 ℃, and 55% humidity.

[0088] 1.2.2 Extraction of soybean genomic DNA

[0089] Take 0.1 g of plant material and extract genomic DNA using the Tiangen Plant Genomic DNA Extraction Kit (DP305), following the kit's instructions. Store the extracted DNA at -20 ℃ for later use.

[0090] 1.2.3 Total RNA extraction and reverse transcription from soybeans

[0091] Soybean samples were ground into powder using liquid nitrogen, and total RNA was extracted using the Magen R4151 RNA extraction kit, following the kit's instructions. The extracted RNA was stored at -80 °C for later use.

[0092] The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit from Yisheng Biotechnology (Shanghai) Co., Ltd., following the kit's instructions. The reverse transcription product was stored at -20 ℃ for later use.

[0093] 1.2.4 Real-time quantitative PCR (qRT-PCR)

[0094] qRT-PCR analysis was performed using Novizan Q321-02 real-time quantitative PCR premix. The reaction system and amplification program are as follows:

[0095] Table 5: qRT-PCR reaction system (10 μL)

[0096] Components Dosage 2×SYBR Green Master Mix 5 μL Forward primer (10 μM) 0.3 μL Reverse primer (10 μM) 0.3 μL cDNA template 2 μL RNase-free water Make up to 10 μL

[0097] Each sample was replicated 3 times biologically and 3 times technically.

[0098] Table 6: qRT-PCR amplification program

[0099] step temperature time Cycle number Pre-variation 95 ℃ 3 min 1 transsexual 95 ℃ 10 sec 40 annealing 55-60 ℃ 30 sec 40 extend 72 ℃ 30 sec 40 Melting curve analysis 60-95 ℃ Increase the temperature by 0.5 °C and hold for 5 seconds. —

[0100] The soybean Actin11 gene was used as an internal reference gene; primer sequences are shown in Appendix Table 1. Relative gene expression levels were calculated using a 22... - Calculated using the ΔΔCt method.

[0101] 1.2.5 PCR Amplification

[0102] Mutant identification was performed using Takara polymerase R045Q. The reaction system and amplification procedure are as follows:

[0103] Table 7: PCR reaction system (50 μL)

[0104] PCR reaction system (50 μL): Component dosage 10×PCR buffer 5 μL dNTP (2.5 mM) 4 μL Forward primer (10 μM) 2 μL 2 μL of reverse primer (10 μM) Template DNA 1 μL Polymerase 1 μL <![CDATA[ddH2O to make up to 50 μL]]>

[0105] Table 8: PCR amplification procedure:

[0106] step temperature time Cycle number Pre-variation 94 ℃ 5 min 1 transsexual 94 ℃ 30 sec 35 annealing 56 ℃ 30 sec 35 extend 72 ℃ 30 sec 35 Final extension 72 ℃ 10 min 1 save 16 ℃ ∞ —

[0107] The PCR products were sent to a sequencing company for sequencing, and the sequencing results were analyzed using DNAMAN software for sequence alignment.

[0108] 1.2.6 Soybean Root Transformation

[0109] (1) Cultivate soybean seeds for about 7 days according to the method in section 1.2.1. When the two cotyledons of the soybean seedlings are slightly unfolded and the true leaves emerge, they can be used for soybean rooting transformation experiments.

[0110] (2) The target vector was transferred into K599 Agrobacterium rhizogenes using the freeze-thaw method.

[0111] (3) Take out the constructed Agrobacterium rhizogenes culture, add 3 mL of LB liquid culture medium containing the corresponding antibiotic in a clean bench, and activate overnight at 28 ℃ and 200 rpm.

[0112] (4) Take 1-1.5 mL of the activated bacterial solution and add it to 50 mL of LB liquid medium containing the corresponding antibiotic. Incubate at 28°C with shaking for 6-8 h until the bacterial cells turn orange.

[0113] (5) Transfer the bacterial culture in the shake flask to a 50 mL centrifuge tube, centrifuge at 4000 rpm for 10 min to enrich the bacterial cells, and discard the supernatant.

[0114] (6) Take 100 mL of soybean root infection solution (Kulaibo SL0915) and add 25 μL of acetylsuccinone (storage solution concentration 100 mM, final concentration 25 μM).

[0115] (7) Resuspend the bacterial cells from step (5) in the infection solution prepared in step (6) and make up to 30 mL.

[0116] (8) Take soybean seedlings that have germinated for 7 days, cut them about 2-3 cm below the cotyledons, immerse the cut end in the infection solution containing bacteria for 30 minutes, and then transfer them to nutrient soil for growth.

[0117] (9) In vitro rooting soybeans will grow new hairy roots at the wound site in about 15 days. After the soybean plants grow to a suitable size, identification and stress treatment will be carried out.

[0118] 1.2.7 Screening for transgenic positive roots

[0119] After root transformation, transgenic positive roots were identified and screened by qPCR.

[0120] 1.2.8 Handling Adversity and Stress

[0121] Drought stress: Soybean plants with uniform growth status and 4 weeks of culture were selected and subjected to 7 days of drought treatment (natural water cut-off). The morphological changes of the plants during the stress process were observed and recorded, and phenotypic photographs were taken periodically. Plants that were normally watered served as controls.

[0122] Salt stress: Select soybean plants with uniform growth status, withhold water for two days, and then pour 250 mM NaCl solution into the bottom of the pot (adjust the amount of water per pot according to the size of the pot, ensuring the soil is fully moistened). Treat for 7 days, observe the changes in soybean plants during the salt stress process, and record phenotypic changes by taking photos. Plants watered with the same amount of ddH2O serve as a control.

[0123] 1.2.9 Measurement of Gas Exchange Parameters

[0124] Gas exchange parameters of uniformly growing wild-type (WT) plants and gmspch1;2 and gmspch3;4 mutant plants were measured on a sunny morning using a plant photosynthesis measuring instrument (Hengmei, HMGH80). Fully extended leaves from the same location on each plant were selected for measurement, with three leaves measured per plant. After the data for each leaf stabilized, three replicates were recorded, and the average value was used for statistical analysis. The measured parameters included: net photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), and intercellular CO2 concentration (Ci).

[0125] 1.2.10 Leaf staining

[0126] (1) Select 3 leaves from the same position in the treatment group and the control group.

[0127] (2) Place the leaf into a 50 mL centrifuge tube and add NBT staining solution (Solepro, G4816) or DAB staining solution (Solepro, DA1010) to ensure that the leaf is completely submerged in the staining solution.

[0128] (3) Loosen the cap of the centrifuge tube, put it into the vacuum drying oven and evacuate it. When the pressure reaches -0.1 MPa, close the valve and maintain the negative pressure for 20-30 minutes to allow the staining solution to penetrate the leaf tissue.

[0129] (4) Slowly release the vacuum, take out the centrifuge tube, tighten the cap, wrap the centrifuge tube with aluminum foil to protect it from light, and let it stand at room temperature for 1-4 hours.

[0130] (5) Remove the staining solution and rinse the leaves with clean water 2-3 times.

[0131] (6) Add 95% ethanol to the centrifuge tube to completely submerge the leaves, place it in a 60 ℃ water bath to heat and decolorize, and replace the 95% ethanol every 1 hour until the leaves turn completely white or transparent.

[0132] (7) Gently remove the decolorized leaf with tweezers, place it on a white board or a flat transparent film, and observe and photograph it under natural light or a stereomicroscope.

[0133] 1.2.11 Measurement of physiological and biochemical indicators

[0134] Leaf samples were collected after stress treatment, and the following physiological and biochemical indicators were measured:

[0135] Superoxide dismutase (SOD) activity: determined using Solarbio BC5250 kit.

[0136] Peroxidase (POD) activity: determined using Solarbio BC0095 kit.

[0137] Catalase (CAT) activity: determined using Solarbio BC0200 kit.

[0138] Malondialdehyde (MDA) content: determined using Solarbio BC6410 kit.

[0139] Hydrogen peroxide (H2O2) content: determined using Solarbio BC3595 kit.

[0140] Superoxide anion (O2· - Content: determined using Solarbio BC1290 reagent kit.

[0141] All experimental procedures were performed in accordance with the instructions of the corresponding reagent kits, and three technical replicates were set up for each sample.

[0142] Example 1:

[0143] Expression analysis of soybean GmSPCH gene under salt stress.

[0144] To clarify the changes in GmSPCH gene expression under salt stress, this embodiment used real-time quantitative PCR to analyze the expression levels of GmSPCH1, GmSPCH2, GmSPCH3 and GmSPCH4 under salt stress.

[0145] William 82 soybean seedlings, 10 days after sowing and with their first pair of true leaves not yet fully unfolded, were used as experimental materials. The experimental groups were treated with 250 mM NaCl for 2 h, 4 h, 12 h, and 24 h, while the control group was irrigated with the same amount of ddH2O. Total RNA (Magen R4151) was extracted from each treatment group and the control group, and reverse transcribed into cDNA (Novozymes, R312-01). Using soybean Actin11 as an internal reference gene, qRT-PCR analysis was performed using Novozymes Q321-02 premixed solution. Primer sequences are shown in Appendix Table 1.

[0146] The results are as follows Figure 1 As shown, under 250 mM NaCl salt stress treatment, the expression levels of all four genes in the GmSPCH family exhibited a trend of initial downregulation followed by an increase. Among them, the expression levels of GmSPCH1, GmSPCH2, GmSPCH3, and GmSPCH4 genes decreased most significantly after 4 h of treatment, with the expression levels in the treatment group decreasing to approximately one-third of those in the control group. These results indicate that the expression of soybean GmSPCH family genes is significantly inhibited by salt stress, suggesting that they may play an important role in the salt stress response.

[0147] Example 2:

[0148] Obtaining and identifying gmspch double mutant plants.

[0149] In this embodiment, CRISPR-Cas9 gene editing technology was used to construct homozygous mutants of soybean gmspch1;2 and gmspch3;4.

[0150] sgRNA1 (SEQ ID NO: 1) and sgRNA2 (SEQ ID NO: 2) were designed for GmSPCH1 and GmSPCH2, and sgRNA3 (SEQ ID NO: 3) and sgRNA4 (SEQ ID NO: 4) were designed for GmSPCH3 and GmSPCH4, respectively. CRISPR-Cas9 gene editing vectors were constructed accordingly. The editing vectors were introduced into William 82 soybeans via Agrobacterium-mediated transformation, and T2 homozygous mutants were obtained after multiple generations of self-crossing and selection.

[0151] Take 0.1 g of leaves from T2 generation homozygous plants, extract genomic DNA using the Tiangen DP305 kit, perform PCR amplification using identification primers (sequences see 1.1.4), send the PCR products to a sequencing company for sequencing, and perform sequence alignment analysis using DNAMAN software.

[0152] Sequencing results as follows Figure 2 As shown, in the gmspch1;2 double mutant, GmSPCH1 has a 7 bp deletion at the sgRNA1 target site, and GmSPCH2 has a 14 bp deletion at the sgRNA1 target site. In the gmspch3;4 double mutant, GmSPCH3 has a 6 bp deletion at the sgRNA3 target site and a 4 bp deletion at the sgRNA4 target site, while GmSPCH4 has a 1 bp addition at the sgRNA3 target site and a 6 bp addition at the sgRNA4 target site. These deletions or additions all result in frameshift mutations in the protein encoding the protein, leading to loss of SPCH protein function.

[0153] Example 3:

[0154] Analysis of gas exchange parameters in gmspch mutant plants.

[0155] To investigate the effect of GmSPCH gene mutation on soybean photosynthesis, this example measured the gas exchange parameters of wild-type (WT) and gmspch1;2 and gmspch3;4 mutant plants.

[0156] Fully extended leaves from the same location on WT, gmspch1;2, and gmspch3;4 plants with uniform growth were selected and measured using a plant photosynthesis measuring instrument (Hengmei, HMGH80) on a sunny morning. The measured parameters included net photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), and intercellular CO2 concentration (Ci). Three leaves were measured from each plant, and three stable readings were recorded for each leaf. The average value was then used for statistical analysis.

[0157] The results are as follows Figure 3 As shown, the net photosynthetic rate of gmspch1;2 plants ( Figure 3 (A) transpiration rate ( Figure 3 (B) and porosity ( Figure 3 The intercellular CO2 concentrations in both gmspch1;2 and gmspch3;4 plants were significantly lower than those in the WT and gmspch3;4 mutants. Figure 3 (D). The results indicate that the GmSPCH1;2 double mutation leads to a decrease in stomatal density, which in turn reduces net photosynthetic rate, transpiration rate, and stomatal conductance; while the GmSPCH3;4 double mutation has no significant effect on stomatal density and photosynthetic parameters, suggesting that different GmSPCH family members may exhibit functional differentiation in soybean.

[0158] Example 4:

[0159] GmSPCH regulates the response of soybean plants to drought stress.

[0160] 4.1 Phenotypic analysis of gmspch mutants under drought stress

[0161] Using wild-type soybean (WT) as a control, double mutant plants of gmspch1;2 and gmspch3;4 were subjected to drought stress. Soybean plants with consistent growth status and cultured for 4 weeks were selected, and watering was stopped for 7 days for natural drought treatment. Morphological changes during the stress process were observed and recorded.

[0162] The results are as follows Figure 4 As shown, before drought treatment, there were no significant phenotypic differences between WT and gmspch3;4 mutant plants. Figure 4(AB). After 5 days of drought stress, the leaves of WT and gmspch3;4 mutants showed severe water loss. The first to third pairs of true leaves of WT plants completely wilted and died, and the first to third pairs of true leaves of gmspch3;4 plants also showed varying degrees of wilting, curling, and even death; while the leaves of gmspch1;2 mutant plants remained relatively plump. Figure 4 (CD). This result indicates that the GmSPCH1;2 mutation enhances water retention capacity by reducing stomatal density, thereby improving drought resistance.

[0163] 4.2 Determination of physiological indicators of SPCH mutants under drought stress

[0164] To further clarify the physiological mechanism by which the SPCH gene regulates the drought response in soybean, DAB and NBT staining and various physiological indicators were performed on the leaves of WT, gmspch1;2 and gmspch3;4 plants after 5 days of drought treatment.

[0165] DAB staining is used to detect the accumulation of H2O2, and NBT staining is used to detect O2· - The accumulation. The result is as follows: Figure 5 As shown, under normal growth conditions, no obvious staining was observed in the leaves of any of the strains; after drought treatment, the leaves of WT and gmspch3;4 showed deeper staining, indicating the accumulation of more H2O2 and O2· - The leaves of gmspch1;2 showed lighter staining ( Figure 5 (AB).

[0166] Quantitative measurement results as follows Figure 6 As shown, H2O2 and O2· in the leaves of the gmspch1;2 mutant - The content was significantly lower than that of WT and gmspch3;4 ( Figure 6 The activities of SOD, POD and CAT in the gmspch1;2 mutant were significantly lower than those in the WT and gmspch3;4 plants (EF). Figure 6 (AC). MDA content determination showed that after drought treatment, the MDA content in the leaves of WT and gmspch3;4 plants was significantly higher than that of the gmspch1;2 mutant. Figure 6 (D).

[0167] The above results indicate that under drought stress, the gmspch1;2 mutant exhibits stronger drought resistance due to reduced water transpiration loss caused by decreased stomatal density, which in turn reduces ROS accumulation and membrane lipid peroxidation levels. In contrast, the gmspch3;4 mutant, with no significant difference in stomatal density compared to the WT mutant, shows the same behavior under drought stress as the WT mutant. Based on this, it is speculated that the GmSPCH gene primarily influences plant water use efficiency and drought resistance by regulating stomatal number in response to drought stress.

[0168] Example 5:

[0169] Verification of the regulatory function of the soybean GmSPCH gene on salt stress.

[0170] 5.1 Phenotypic analysis of gmspch mutants and overexpressing plants under salt stress

[0171] To verify the function of the soybean SPCH gene under salt stress, this example conducted salt stress experiments on WT, gmspch1;2, gmspch3;4 mutants and GmSPCH overexpressing plants.

[0172] Obtaining overexpression plants: Overexpression vectors 35S::GmSPCH1-sGFP, 35S::GmSPCH2-sGFP, 35S::GmSPCH3-sGFP, and 35S::GmSPCH4-sGFP (containing Basta resistance) were transformed into soybean plants using K599 Agrobacterium rhizogenes-mediated transformation (details in Section 1.2.6), respectively, to obtain hairy-rooted composite plants. Plants transformed with the empty vector (EV) served as controls. Positive lines were verified by qRT-PCR; primer sequences are provided in Section 1.1.4.

[0173] Salt stress treatment: WT, mutant and overexpression plants with the same growth status were selected. After two days of water control, 250 mM NaCl solution was poured into the bottom of the pot. WT and mutant plants were treated for 7 days, and overexpression plants were treated for 5 days (because overexpression plants are more sensitive to salt). Phenotypic changes were observed.

[0174] The results are as follows Figure 7 As shown, there were no significant phenotypic differences among the strains before salt treatment. Figure 7 (AB). After 7 days of treatment with 250 mM NaCl, the first pair of true leaves of WT plants completely wilted, and the second and third pairs of true leaves showed obvious stress phenotypes; while the gmspch1;2 and gmspch3;4 mutants only showed slight curling of the first pair of true leaves, and the plants as a whole did not show significant damage. Figure 7 The presence of CD indicates that the mutant has stronger salt tolerance.

[0175] Overexpression results in plants such as Figure 8 As shown, under normal conditions, there was no significant difference in growth status between overexpressing plants and EVs. Figure 8 (AB). After 5 days of treatment with 250 mM NaCl, the lower leaves of all hairy-rooted plants turned yellow due to stress. GmSPCH1-OE, GmSPCH2-OE, GmSPCH3-OE, and GmSPCH4-OE were more severely affected by salt stress than EV, with more pronounced leaf wilting and curling. Figure 8(CD). qRT-PCR validation results showed that the expression level of SPCH gene in each overexpression line was significantly higher than that in EV (CD). Figure 8 (E).

[0176] 5.2 Determination of physiological indicators of SPCH mutants and overexpressing plants under salt stress

[0177] DAB / NBT staining and physiological and biochemical index determination were performed on the leaves of each strain after salt stress treatment.

[0178] Staining results as follows Figure 9 As shown, under normal growth conditions, the leaves of all strains showed no obvious staining. Figure 9 After treatment with 250 mM NaCl, the leaves of the gmspch1;2 and gmspch3;4 mutants showed significantly lighter staining than those of the WT mutant (AD). Figure 9 (A, C), while SPCH-overexpressing leaves stained significantly darker than EV (A, C). Figure 9 (B and D) indicate that the mutant accumulated less H2O2 and O2· - Overexpression leads to the accumulation of more reactive oxygen species in plants.

[0179] Quantitative measurement results as follows Figure 10 As shown. In the comparison between the mutant and WT ( Figure 10 In the AF mutants, SOD and CAT activities were significantly higher than in the gmspch1;2 and gmspch3;4 mutants than in the WT mutants. Figure 10 In the middle (A, C), the POD activity is lower than that of WT ( Figure 10 (B); MDA, H2O2 and O2· - The content in mutants was significantly lower than that in WT ( Figure 10 DF). In the comparison between overexpressing plants and EV ( Figure 10 In GL: SOD and CAT activities were significantly lower in overexpressing plants than in EV ( GL). Figure 10 In G and I), POD activity was also lower than that of EV ( Figure 10 (H); MDA, H2O2 and O2· - The content in overexpressed plants was significantly higher than that in EV ( Figure 10 JL (Chinese).

[0180] The results indicate that mutations in the GmSPCH gene resulted in soybean plants maintaining stronger reactive oxygen species scavenging capacity (higher SOD and CAT activities) and lower membrane lipid peroxidation levels (lower MDA content), thereby improving salt tolerance; while overexpression had the opposite effect. Therefore, the GmSPCH family of genes negatively regulates soybean's tolerance to salt stress.

[0181] Example 6:

[0182] Verification of salt tolerance breeding application of soybean gmspch3;4 double mutant.

[0183] This embodiment verifies the salt tolerance breeding application value of the gmspch3;4 double mutant.

[0184] The gmspch3;4 double mutant was compared with wild-type William 82 soybean under the same salt stress conditions (treatment with 250 mM NaCl for 7 days). The results showed that ( Figure 7 The salt tolerance of the gmspch3;4 double mutant was significantly better than that of the wild type, and the stomatal density and net photosynthetic rate of the mutant were not significantly different from those of the wild type. Figure 3 This indicates that its growth and photosynthesis were not significantly affected.

[0185] The above results indicate that the gmspch3;4 double mutant can serve as an excellent candidate line for salt-tolerant soybean breeding and has good prospects for breeding applications.

[0186] As can be seen from the above embodiments, the present invention has the following innovative features.

[0187] (1) This invention reveals for the first time the negative regulatory function of soybean GmSPCH family genes on salt tolerance. By inducing loss-of-function mutations in the GmSPCH gene, the salt tolerance of soybean plants can be significantly improved; while overexpression reduces salt tolerance (Example 5), indicating that the GmSPCH gene is a key target for the negative regulation of soybean salt tolerance.

[0188] (2) This invention provides a soybean gmspch3;4 double mutant (Example 2), which exhibits significantly higher salt tolerance under salt stress than the wild type (Example 5.1), while its stomatal density and net photosynthetic rate are not significantly different from the wild type (Example 3). This characteristic breaks through the technical bottleneck of "stress resistance and growth inhibition going hand in hand" in traditional stress-resistant breeding.

[0189] (3) This invention clarifies the mechanism of action of the GmSPCH gene in drought stress response (Example 4). The gmspch1;2 mutant reduces water transpiration loss by decreasing stomatal density, thereby enhancing drought resistance, indicating that the GmSPCH gene has an important function in regulating stomatal development and water use efficiency.

[0190] (4) This invention verified that the gmspch3;4 double mutant exhibits higher SOD and CAT antioxidant enzyme activities under salt stress, while MDA, H2O2, and O2· in the leaves are also higher. - The accumulation of [acids] was significantly lower than that of the wild type (Example 5.2), clarifying the physiological mechanism of the improved salt tolerance of this mutant—that is, through enhanced reactive oxygen species scavenging capacity and reduced membrane lipid peroxidation level.

[0191] It should be noted that the above embodiments are merely preferred embodiments of the present invention, used to explain the technical principles and application effects of the present invention, and are not intended to limit the scope of protection of the present invention. Any equivalent substitutions, modifications, or improvements made based on the technical concept of the present invention within the spirit and principles of the present invention should be included within the scope of protection of the present invention. In practical applications, those skilled in the art can make adaptive adjustments to the relevant parameters according to the specific test materials, working conditions, and accuracy requirements, all of which fall within the scope of protection of the present invention.

Claims

1. The application of the soybean GmSPCH dual gene in the negative regulation of soybean salt tolerance, characterized in that, The GmSPCH double gene is GmSPCH1 and GmSPCH2, and their CDS are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; or the GmSPCH double gene is GmSPCH3 and GmSPCH4, and their CDS are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the application is: using the GmSPCH double gene as a negative regulatory target, by inducing loss-of-function mutations in the GmSPCH double gene, to improve the salt tolerance of soybean.

2. The application according to claim 1, characterized in that, When the GmSPCH double gene is GmSPCH1 and GmSPCH2, the application is also used to improve the drought resistance of soybeans.

3. The application according to claim 1, characterized in that, The loss-of-function mutations were achieved using CRISPR-Cas9 gene editing technology; the sgRNA target sequences for editing GmSPCH1 and GmSPCH2 are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively; and the sgRNA target sequences for editing GmSPCH3 and GmSPCH4 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

4. A soybean gmspch3;4 double mutant, characterized in that, The double mutant is a soybean plant in which both the GmSPCH3 and GmSPCH4 genes have loss-of-function mutations; the CDS of GmSPCH3 is shown in SEQ ID NO:7, and the CDS of GmSPCH4 is shown in SEQ ID NO:8; the double mutant exhibits significantly higher salt tolerance under salt stress than wild-type soybean, and its stomatal density and net photosynthetic rate are not significantly different from those of wild-type soybean.

5. The application of the soybean gmspch3;4 double mutant as described in claim 4 in soybean salt tolerance breeding.

6. A breeding method for improving the salt tolerance of soybeans, characterized in that, Includes the following steps: Mutant plants were obtained by causing loss-of-function mutations in the GmSPCH double genes in soybean plants; the GmSPCH double genes are GmSPCH1 and GmSPCH2, and their CDS are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; or the GmSPCH double genes are GmSPCH3 and GmSPCH4, and their CDS are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively.

7. The application of the soybean GmSPCH dual gene in the breeding of salt-tolerant soybean varieties, characterized in that, The GmSPCH double gene is GmSPCH1 and GmSPCH2, and their CDS are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; or the GmSPCH double gene is GmSPCH3 and GmSPCH4, and their CDS are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. Using the GmSPCH double gene as a negative regulatory target, loss-of-function mutations in the GmSPCH double gene are induced by CRISPR-Cas9 gene editing technology to obtain soybean varieties with improved salt tolerance.

Images