Molecular markers related to regeneration ability of rose callus and their application

Abstract

The present application belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the regeneration capacity of Rosa hybrida callus and application thereof. The present application aims to develop a molecular marker significantly related to the induction capacity and regeneration potential of Rosa hybrida callus, so as to improve the tissue culture efficiency of Rosa hybrida, accelerate the screening of high-regeneration-potential materials, and improve the selection of genetic transformation receptor materials. The technical scheme of the present application is a molecular marker related to the regeneration capacity of Rosa hybrida callus. The molecular marker is an SNP molecular marker, the genome of which is the modern Rosa hybrida 'Samantha' genome v2 version, and the specific information of the molecular marker is as follows: the 15380033th position of the 2nd chromosome of Rosa hybrida, the genotyping of the molecular marker is G / A, and the sequence is shown as SEQ ID NO. 4 and SEQ ID NO. 5. The molecular marker of the present application can be used for pre-screening of Rosa hybrida materials before transformation experiment, and the materials with high regeneration potential are preferentially selected as receptors, so as to improve the construction efficiency of genetic transformation system and reduce the experimental cost.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to molecular markers related to the callus regeneration ability of roses and their applications. Background Technology

[0002] The rose (Rosa hybrida) is a woody flowering plant belonging to the genus Rosa in the family Rosaceae. It is characterized by its diverse flower colors, rich fragrance, and varied flower shapes, making it one of the most valuable and economically significant flowers internationally. Most modern roses are tetraploid. As a beloved ornamental plant, the rose boasts abundant species resources and significant application potential in landscape design, being widely used in garden beautification, park construction, and urban roadside barriers. Furthermore, the rose is an important economic crop, forming a corresponding industrial system. It is not only an important medicinal plant, but its flowers, leaves, and fruits can all be used medicinally, possessing effects such as promoting blood circulation, regulating menstruation, reducing swelling, and detoxifying. In addition, rose petals can be used to extract essential oils, which are widely used in the perfume and skincare industries. With increasing demands for rose quality, single varieties are no longer sufficient to meet market needs. Therefore, researching the differences between different rose varieties is of great significance for improving yield and quality, as well as promoting their cultivation.

[0003] Traditional breeding methods for roses suffer from low propagation coefficients and long iteration cycles, severely impacting planting speed and yield, failing to meet market supply and demand. Establishing a stable and efficient regeneration system is a prerequisite and key step for the application of molecular biology techniques in rose research. In recent years, with the rapid development of bioengineering, tissue culture propagation has attracted considerable attention and exploration from scholars both domestically and internationally as an emerging biotechnology tool. However, roses have complex genetic backgrounds, high heterozygosity, and widespread polyploidy. Different genotypes exhibit significant differences in callus induction, bud differentiation, and regeneration, severely affecting the efficiency of genetic transformation and rapid propagation system construction. Establishing a rapid propagation system for rose tissue culture helps obtain a large number of seedlings in a short time, thus solving the problems of low propagation coefficients, long cycles, slow speed, and high costs in traditional rose breeding and propagation processes. In recent years, research on rose tissue culture has become increasingly widespread both domestically and internationally. As a plant of the genus Rosa in the Rosaceae family, rose stem segments are the most commonly used explant type in rapid tissue propagation experiments.

[0004] The process of inducing new plantlets from isolated plant organs (such as embryos, anthers, ovaries, roots, stems, and leaves) is called plant regeneration. In an ideal plant regeneration system, leaf mesophyll cells first dedifferentiate to form callus tissue, which then redifferentiates to produce adventitious buds. The ability of a plant to regenerate depends on the totipotency or pluripotency of its cells, demonstrating the highly plastic nature of cell fate. Establishing an efficient and stable regeneration system is a necessary prerequisite for conducting genetic transformation research. Studies have found significant differences in callus induction rates and quantities among different rose varieties; and significant differences in callus induction efficiency among different genotypes in tomato, melon, and lily filaments.

[0005] In existing technologies, the evaluation of callus induction ability and regeneration potential in roses mainly relies on phenotypic indicators such as callus formation rate, callus growth status, callus induction index, bud differentiation rate, and regenerated plant yield. This type of evaluation method typically suffers from problems such as long detection cycles, susceptibility to the influence of culture medium composition and culture conditions, and difficulty in screening large quantities of materials in the early stages. Therefore, establishing molecular markers significantly associated with callus induction ability and regeneration potential in roses is of great significance for improving rose tissue culture efficiency, accelerating the screening of high-regeneration-potential materials, and enhancing the selection efficiency of genetic transformation recipient materials.

[0006] Genome-wide association analysis (GWAS) can identify genetic loci significantly associated with target traits at the natural population level, making it an important tool for developing molecular markers for complex quantitative traits in plants. If stable SNP molecular markers related to callus induction ability and / or regeneration potential in roses can be developed based on GWAS results, and corresponding typing detection methods can be established, then rapid molecular identification of materials can be performed before or in the early stages of tissue culture, thereby improving the efficiency of screening superior regenerated rose materials and molecular-assisted breeding.

[0007] Therefore, providing a molecular marker that is significantly associated with the callus induction ability and / or regeneration potential of roses and its application is of great practical value. Summary of the Invention

[0008] The technical problem to be solved by this invention is to improve the efficiency of rose tissue culture, accelerate the screening of high regeneration potential materials, and enhance the selection of genetic transformation receptor materials by developing molecular markers that are significantly associated with the callus induction ability and regeneration potential of roses.

[0009] The technical solution of the present invention is a molecular marker related to the callus regeneration ability of roses. The molecular marker is an SNP molecular marker, whose genome is the v2 version of the modern rose 'Samantha' genome. The specific information of the molecular marker is: position 15380033 on the rose chromosome 2. The molecular marker genotype is G / A, and its sequence is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0010] Specifically, among tetraploid roses, roses with the genotype G / G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability. Alternatively, among diploid roses, roses with the G / G genotype are roses with strong callus regeneration ability, while roses with the G / A or A / A genotypes are roses with weak callus regeneration ability. Alternatively, among triploid roses, roses with the genotype G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / A, G / A / A, or A / A / A ​​have weak callus regeneration ability.

[0011] The present invention also provides the application of the molecular marker in screening roses with different callus regeneration abilities.

[0012] The present invention also provides the application of the aforementioned molecular markers in predicting the callus regeneration capacity of roses.

[0013] Specifically, in the above applications, among tetraploid roses, roses with the genotype G / G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability. Alternatively, among diploid roses, roses with the G / G genotype are roses with strong callus regeneration ability, while roses with the G / A or A / A genotypes are roses with weak callus regeneration ability. Alternatively, among triploid roses, roses with the genotype G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / A, G / A / A, or A / A / A ​​have weak callus regeneration ability.

[0014] The present invention also provides a primer set for detecting molecular markers related to the callus regeneration ability of the rose, the specific information of which is: position 15380033 on the rose chromosome 2, the molecular marker type is G / A, and its sequence is shown in SEQ ID NO.4 and SEQ ID NO.5; the primer set includes a first forward primer, a second forward primer and a reverse primer, having nucleotide sequences as shown in SEQ ID NO.1~3.

[0015] More preferably, different fluorescent groups are attached to the 5' ends of the first and second forward primers.

[0016] Specifically, the fluorescent group is FAM or VIC.

[0017] This invention also provides the application of the primer set in screening roses with different callus regeneration abilities.

[0018] The present invention also provides the application of the primer set in predicting the callus regeneration ability of roses.

[0019] Specifically, in the above applications, among tetraploid roses, roses with the genotype G / G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability. Alternatively, among diploid roses, roses with the G / G genotype are roses with strong callus regeneration ability, while roses with the G / A or A / A genotypes are roses with weak callus regeneration ability. Alternatively, among triploid roses, roses with the genotype G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / A, G / A / A, or A / A / A ​​have weak callus regeneration ability.

[0020] This invention also provides a method for screening roses with different callus regeneration abilities, comprising the following steps: extracting DNA from the rose to be tested, detecting the molecular marker using a primer set, and determining the genotype; the molecular marker is an SNP molecular marker, whose genome is the v2 version of the modern rose 'Samantha' genome, and the specific information of the molecular marker is: position 15380033 on chromosome 2 of the rose, the genotype of the molecular marker is G / A, and its sequence is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0021] Preferably, the primer set includes a first forward primer, a second forward primer, and a reverse primer, having nucleotide sequences as shown in SEQ ID NO. 1~3.

[0022] More preferably, different fluorescent groups are attached to the 5' ends of the first and second forward primers.

[0023] Specifically, the fluorescent group is FAM or VIC.

[0024] Specifically, the classification criteria are as follows: among tetraploid roses, roses with genotype G / G / G / G have strong callus regeneration ability, while roses with genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability. Alternatively, among diploid roses, roses with the G / G genotype are roses with strong callus regeneration ability, while roses with the G / A or A / A genotypes are roses with weak callus regeneration ability. Alternatively, among triploid roses, roses with the genotype G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / A, G / A / A, or A / A / A ​​have weak callus regeneration ability.

[0025] This invention also provides a method for predicting the callus regeneration ability of roses, comprising the following steps: extracting DNA from the rose to be tested, detecting the molecular marker using a primer set, and determining the genotype; the molecular marker is an SNP molecular marker, whose genome is the v2 version of the modern rose 'Samantha' genome, and the specific information of the molecular marker is: position 15380033 on chromosome 2 of the rose, the genotype of the molecular marker is G / A, and its sequence is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0026] Preferably, the primer set includes a first forward primer, a second forward primer, and a reverse primer, having nucleotide sequences as shown in SEQ ID NO. 1~3.

[0027] More preferably, different fluorescent groups are attached to the 5' ends of the first and second forward primers.

[0028] Specifically, the fluorescent group is FAM or VIC.

[0029] Specifically, the classification criteria are as follows: among tetraploid roses, roses with genotype G / G / G / G have strong callus regeneration ability, while roses with genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability. Alternatively, among diploid roses, roses with the G / G genotype are roses with strong callus regeneration ability, while roses with the G / A or A / A genotypes are roses with weak callus regeneration ability. Alternatively, among triploid roses, roses with the genotype G / G / G have strong callus regeneration ability, while roses with the genotypes G / G / A, G / A / A, or A / A / A ​​have weak callus regeneration ability.

[0030] The beneficial effects of this invention: This invention provides a molecular marker located at position 15380033 on chromosome 2 of the rose variety, with a genotype of G / A. This marker can be used to identify the strength of callus regeneration potential in rose varieties. Most modern roses are tetraploid, with a small number being diploid and triploid. Based on the dose-response principle (the more G bases at this locus, the stronger the callus regeneration ability of the rose), this molecular marker is also applicable to diploid and triploid roses. This lays the foundation for further establishing an efficient rose genetic transformation system and provides technical support for rose germplasm resource utilization and molecular breeding. Further analysis revealed that this molecular marker locus is located upstream of the corresponding VRN1-like gene. Traditional methods typically require a series of tissue culture experiments, including callus induction, differentiation, and regeneration culture, to evaluate the regeneration ability of materials. This process is lengthy, labor-intensive, and highly dependent on culture conditions. This invention, based on significant association loci and VRN1-like genes obtained through GWAS screening, can predict and evaluate the callus regeneration potential of rose materials at the molecular level, thereby improving screening efficiency and shortening the material evaluation cycle. This invention utilizes genetic loci and candidate genes significantly associated with callus regeneration potential for analysis. The results are primarily based on the genetic differences inherent in the materials themselves, exhibiting better stability and reproducibility, and are less affected by environmental and human factors, thus improving the reliability of identification results. The molecular markers of this invention can be used for pre-screening of rose materials before transformation experiments, preferentially selecting materials with strong regeneration potential as recipients, thereby improving the efficiency of genetic transformation system construction and reducing experimental costs. This invention can not only be used for evaluating rose callus regeneration potential and screening genetic transformation recipients, but also for evaluating the regeneration capacity of rose germplasm resources, identifying superior regenerated germplasm, and conducting subsequent molecular-assisted breeding research, showing promising application prospects. Attached Figure Description

[0031] Figure 1 Different grades for different sizes of hemorrhage.

[0032] Figure 2 To illustrate the differences in callus induction among different rose genotypes.

[0033] Figure 3 Manhattan plot of SNPs associated with callus regeneration in roses, located on the promoter of a RhVRN1-like gene, for genome-wide association analysis.

[0034] Figure 4 This is a GWAS QQ plot showing the traits related to callus induction ability in roses under a dominant model. The horizontal axis (X-axis) represents the theoretically expected P-value after negative logarithmic transformation; the vertical axis represents the actual observed P-value after negative logarithmic transformation. The two colors represent the analysis results obtained using different alleles as dominant alleles or reference directions under the same dominant inheritance model.

[0035] Figure 5 Genotypic analysis results for SNP loci associated with traits. Different letters on the bar chart indicate whether there are significant differences (P<0.05) calculated using one-way ANOVA and Tukey's multiple range test. For comparisons between different groups, the same letter indicates no significant difference (P>0.05), while different letters indicate significant differences.

[0036] Figure 6 This figure shows the expression of RhVRN1-like genes in the leaves of the rose 'Samantha' variety after callus induction at 0 h, 1 h, 12 h, 3 d, 7 d, and 30 d. The data in this figure are calculated FPKM values, which have been normalized to account for gene length and sequencing depth, allowing for comparison of gene expression levels across different samples. Different letters on the bars indicate whether there are significant differences (P < 0.05) calculated using one-way ANOVA and Tukey's multiple range test. For comparisons between different groups, the same letter indicates no significant difference (P > 0.05), while different letters indicate significant differences.

[0037] Figure 7 Results of genotyping analysis using the KASP technique.

[0038] Figure 8 The results are for callus induction on the leaves of the tested rose varieties. Detailed Implementation

[0039] A genome-wide association study (GWAS) identified a genetic locus significantly associated with the callus regeneration potential of roses, located at position 15380033 on rose chromosome 2. The study found that genotypic differences at this locus are closely related to the strength of callus regeneration in rose materials. Therefore, this locus and its corresponding gene VRN1-like can serve as important molecular criteria for evaluating the callus regeneration potential of roses, and can be used for identifying the regeneration capacity of rose materials, screening genetic transformation receptors, and molecular breeding.

[0040] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0041] Example 1: Obtaining Molecular Markers 1. Explant disinfection and subculture The experimental materials were obtained from the rose germplasm resource nursery of the College of Horticulture, China Agricultural University, totaling 158 varieties (see Table 2 for details). During the rose growing season, current-year shoots with plump but unsprouted buds were selected. After removing petioles and leaves, the shoots were rinsed overnight under running water to remove dust and dirt. Subsequently, they were cut into 3-5cm stem segments with single axillary buds, and the stem segments were disinfected in a clean bench. First, disinfect the rose stem segments with 75% alcohol solution for 1 minute, then rinse once with sterile water. Next, disinfect with 0.1% mercuric chloride solution for 10-15 minutes, and then rinse four times with sterile water (121 ℃, sterilized for 20 minutes) for 1 minute each time to reduce residual disinfectant on the explants. Finally, place the rinsed rose stem segments on sterilized dry filter paper (121 ℃, sterilized for 20 minutes). After the surface moisture of the rose stem segments is absorbed by the filter paper, cut off the browned parts at both ends of the stem segments in a sterile petri dish. Use single axillary bud stem segments as explants and inoculate them morphologically downwards into BPM medium (4.74 g / L MS + 30 g / L sucrose + 1.0 mg / L 6-BA + 0.05 mg / L NAA + 6.8 g / L agar). After four weeks, the axillary buds on the rose stem segments elongated to 2 cm. When the new leaves are about 1 cm long and fully expanded, under sterile conditions, cut off the axillary buds that are in good condition and uncontaminated, and inoculate them onto BPM medium to continue growing.

[0042] 2. Induction of callus tissue in 158 rose varieties Leaves sprouting from axillary buds after rose explants were placed in bottles were used as material. The veins of the leaves were incised using a sterilized scalpel (121℃, sterilization for 20 min), and the leaves were laid flat on callus induction medium (4.74 g / L MS + 3.0 mg / L 2,4-D + 0.05 mg / L KT + 30 g / L glucose + 3.0 g / L plant gel) with the underside of the leaves close to the culture medium. Sixty leaves of each variety were treated per cycle, with three replicates. After culturing in the dark for 20 days, the callus formation of each variety was observed, and the callus size was statistically analyzed according to Table 1. Figure 1 ), and calculate the callus induction index.

[0043] Table 1 Callus Grades .

[0044] 3. Data Statistics and Analysis Callus induction index = (0×n1 + 1×n2 + 2×n3 + 3×n4 + 4×n5 + 5×n6) / N; Note: 0-5 level evaluation reference Figure 1See Table 2; n1 is the number of leaves with a callus induction level of 0; n2 is the number of leaves with a callus induction level of 1; n3 is the number of leaves with a callus induction level of 2; n4 is the number of leaves with a callus induction level of 3; n5 is the number of leaves with a callus induction level of 4; n6 is the number of leaves with a callus induction level of 5; N is 60, which is the total number of leaves for inducing callus in each variety.

[0045] From Table 2 and Figure 2 The results showed that there were significant differences in callus induction efficiency among different rose varieties.

[0046] Previously, resequencing of 358 core rose germplasms was completed. The obtained fq.gz format next-generation sequencing data was compared with the modern rose 'Samantha' genome v2 version (https: / / figshare.com / articles / dataset / _i_R_hybrida_i_Samantha_genome_v2_ / 28738781?file=53454104) genome using BWA software. SNPs were screened according to criteria of minor allele frequency (maf) less than 0.05 and genotype deletion rate exceeding 10%, resulting in 27,206,170 high-quality SNP loci that can be used for GWAS analysis. Genome-wide association analysis was performed using mixed linear model analysis (MLM) in Gemma software. First, PLINK software (https: / / www.cog-genomics.org / plink2) was used to convert VCF files containing variant loci generated from population variation detection into BED files, aiming to convert files containing variant loci information for subsequent analysis. The previously obtained bottle aging phenotype data were then organized into a fam format file, followed by kinship analysis. Finally, the association between the variant sites and the target trait was analyzed using an MLM model, with the calculation formula being: Y = Xβ + Zu + e phenotypic value, where X is the fixed-effects design matrix, Z is the random-effects design matrix, β is the estimated coefficient of the fixed effects, u is the coefficient of the random effects, and e is the error term.

[0047] Genome-wide association analysis identified a molecular marker associated with callus regeneration: Chr2B:15380033, located at the promoter of the SAM2A149400 gene, which contains a G-base mutation to an A-base. Further analysis confirmed that the gene highly associated with rose callus regeneration is SAM2A149400, which corresponds to VRN1-like (… Figure 3 The results showed that the SNP site was adjacent to a candidate gene homologous to VRN1 (VERNALIZATION1). Figure 4As shown in the QQ graph, the red dots deviate more significantly above the reference line than the blue dots, especially in the high quantile region. This indicates that the variant allele model obtained more smaller P-values ​​and stronger association signals. The blue reference allele model, with most points closer to the reference line and only showing a slight upward tilt at the tail, indicates that the overall association signal of this model is weaker. In other words, the GWAS results of this invention show a good overall fit, with the observed values ​​at most loci largely consistent with the theoretical expectations. However, chromosome 2 shows a significant deviation in the high significance region, suggesting the existence of a true association signal on this chromosome that is significantly related to the callus induction ability and / or regeneration potential of roses. This provides statistical evidence for VRN1-like candidate genes located in or near this region as relevant functional genes.

[0048] Among them (Table 2, Figure 2 and Figure 5 The SNP genotypes of the following rose varieties are G / G / G / G, indicating high callus regeneration potential, with callus induction indices of 4.2, 4.4, 4.8, and 4.8, respectively. The SNP genotypes of Claire Renaissance, Sweet Lyonnais, Holiday Princess, and Claudia are G / G / G / A, indicating slightly stronger callus regeneration potential, with callus induction indices of 2.4, 2.5, 2.6, and 2.3, respectively. The SNP genotypes of Woland, Titanic, Smurf, and Friendship are G / G / A / A, indicating weaker callus regeneration potential, with callus induction indices of 0.5, 0.5, 0.5, and 0.5, respectively.

[0049] This invention utilizes mixture linear model analysis (MLM) in Gemma software for genome-wide association analysis. First, PLINK software (https: / / www.cog-genomics.org / plink2) is used to convert VCF files containing variant sites generated from population variation detection into BED files. This conversion aims to transform files containing variant site information for subsequent analysis. Next, the previously obtained bottled aging phenotype data is organized into a FAM format file, followed by kinship analysis. Finally, the association between variant sites and the target trait is analyzed using an MLM model, calculated as: Y = Xβ + Zu + e (phenotypic value), where X is the fixed-effects design matrix, Z is the random-effects design matrix, β is the estimated coefficient of the fixed effects, u is the coefficient of the random effects, and e is the error term.

[0050] Table 2 Genotypes of 158 Rose Varieties .

[0051] Genome-wide association analysis identified a molecular marker associated with callus regeneration: Chr2B:15380033, located at the promoter of the SAM2A149400 gene, which contains a G-base mutation to an A-base. Further analysis confirmed that the gene highly associated with rose callus regeneration is SAM2A149400, which corresponds to VRN1-like (… Figure 3 The results showed that the SNP site was adjacent to a candidate gene homologous to VRN1 (VERNALIZATION1).

[0052] QQ graph analysis shows that ( Figure 4 The GWAS results of this invention show good overall fit, with the observed values ​​at most sites being basically consistent with the theoretical expected values. However, chromosome 2 shows a significant deviation in the high significance region, suggesting that there is a real association signal on this chromosome that is significantly related to the callus induction ability and / or regeneration potential of roses. This provides statistical basis for VRN1-like candidate genes located in or near this region as relevant functional genes.

[0053] Given that the process of callus induction and regeneration in roses involves cell dedifferentiation, redifferentiation, developmental reprogramming, and response to external culture conditions, this invention hypothesizes that the VRN1-like candidate gene adjacent to the Chr2:15380033 site may affect the callus induction ability and / or regeneration potential of rose materials by influencing cell fate transition, low temperature response, or developmental regulation under in vitro culture conditions.

[0054] RNA was extracted from leaf samples of 'Samantha' rose at 0 h, 1 h, 12 h, 3 d, 7 d, and 30 d after callus induction and used to construct libraries. Further transcriptome sequencing analysis showed that the expression of RhVRN1-like genes first decreased rapidly and then increased at different time points after injury, and the expression began to decrease after 3 d of callus induction, proving that it is a gene that responds to injury induction and may affect callus formation in roses (Figure 6).

[0055] Example 2: Obtaining Molecular Markers This invention provides a primer set for identifying the genotype of a molecular marker associated with callus regeneration in roses, wherein the molecular marker associated with callus regeneration in roses is located at position 15380033 on chromosome 2 of roses and has the bases G / A.

[0056] The primer set includes a first forward primer, a second forward primer, and a reverse primer. The 5' ends of the first and second forward primers are respectively connected to fluorescent adapters displaying different colors. Details are as follows: First forward primer: GAGGTGACCAAGTTCATGCTTCTTTATCCAAAAGCATTACAGAGGG (SEQ ID NO. 1), with FAM labeled at positions 1-21; Second forward primer: GAAGGTCGGAGTCAACGGATTTCTTTATCCAAAAGCATTACAGAGGA (SEQ ID NO. 2); VIC is marked at positions 1-21; Reverse primer (com): TCAAAATGTCAATCTCAGCAGGCTA (SEQ ID NO.3).

[0057] The molecular markers described in SEQ ID NO.4 and SEQ ID NO.5 can be amplified using the primers described above.

[0058] SEQ ID NO.4: Molecular marker with strong callus regeneration ability, where the lowercase letters are SNP sites, TCTTTATCCAAAAGCATTACAGAGGgGATTATTTTTAAATAGCCTGCTGAGATTGACATTTTGA.

[0059] SEQ ID NO.5: Molecular marker of weak callus regeneration ability, where the lowercase letters are SNP sites, TCTTTATCCAAAAGCATTACAGAGGaGATTATTTTTAAATAGCCTGCTGAGATTGACATTTTGA.

[0060] When the genotype of the molecular marker in the rose variety to be tested is G / G / G / G, the rose variety to be tested has strong callus regeneration ability; when the genotype is G / G / G / A or G / G / A / A, the rose variety to be tested has weak callus regeneration ability.

[0061] This invention provides a method for identifying whether a rose variety has callus regeneration ability, comprising the following steps: (i) Extract genomic DNA from the rose varieties to be tested, including Pink Ronsard Gem, Rose Lady, Seashell, Multi-headed Bicolor Pink, Mia, and Ingrid Bergman; and conduct callus regeneration experiments on the aforementioned rose varieties to calculate the callus induction index. (ii) Using the genomic DNA obtained in step (i) as a template, perform PCR amplification using the primer set described above; (iii) Identify the PCR product obtained in step (ii) to determine the genotype of the molecular markers mentioned in the first aspect above, and then determine the strength of callus regeneration ability of the rose variety to be tested based on the genotype; wherein: When the genotype of the molecular marker in the rose variety to be tested is G / G / G / G, the rose variety to be tested has strong callus regeneration ability; when the genotype is G / G / G / A or G / G / A / A, the rose variety to be tested has weak callus regeneration ability.

[0062] In the above method for identifying the callus regeneration ability of the rose variety to be tested, as a preferred embodiment, the identification in step (iii) is a fluorescence identification. When the fluorescence signal is the same as the 5' end fluorescent adapter sequence of the first forward primer, the genotype of the molecular marker is G / G / G / G; when the fluorescence signal is the same as the 5' end fluorescent adapter sequence of the second forward primer, the genotype of the molecular marker is A / A / A / A; when the fluorescence signal shows the 5' end fluorescent adapter sequence of the first and second forward primers, the genotype of the molecular marker is G / G / G / A or G / G / A / A.

[0063] In embodiments of this invention, fluorescence identification is performed using qRT-PCR labeled with FAM and VIC probes. This process is based on KASP (Kompetitive Allele-Specific PCR) technology, a genotyping method based on competitive amplification using allele-specific primers. In the reaction system, two allele-specific primers, each carrying a tail sequence, are paired with corresponding fluorescent probes (FAM and VIC). When the template is a specific allele, the corresponding primer takes effect preferentially and introduces the corresponding fluorescent signal. During result detection, if the sample is homozygous for G / G / G / G, only the FAM signal appears; if it is homozygous for A / A / A / A, only the VIC signal appears; if it is heterozygous for G / G / G / A or G / G / A / A, both signals are present, with the point located in the middle of the scatter plot. The three genotypes can be visually distinguished by the clustering distribution of different fluorescent signals in the scatter plot. Figure 7 In the test results, the pink 'Princess Dragon's Gem' and 'Lady Rose' roses only showed FAM signals. After callus induction, the callus induction indices were 3.8 and 3.9, respectively. Figure 8 The callus regeneration ability is strong. In the test results for *Rosa laevis*, *Rosa multi-headed bicolor*, *Miya*, and *Ingrid Bergman*, both signals were present, with the point located in the middle of the scatter plot; after callus induction, the callus induction indices were 1.1, 1.2, 0.5, and 0.8, respectively. Figure 8 ), with weak callus regeneration ability.

[0064] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. The application of reagents for detecting molecular markers related to rose callus regeneration ability in screening roses with different callus regeneration abilities or predicting rose callus regeneration ability, characterized in that: The molecular marker is an SNP molecular marker, and the SNP molecular marker site is located at position 15380033 on chromosome 2 of the modern rose 'Samantha' genome v2 version. The molecular marker genotype is G / A, and its sequence is shown in SEQ ID NO.4 and SEQ ID NO.

5. The rose is a tetraploid modern rose. Roses with genotype G / G / G / G have strong callus regeneration ability, while roses with genotypes G / G / G / A or G / G / A / A have weak callus regeneration ability.

2. The application according to claim 1, characterized in that: The reagent is a primer set, which includes a first forward primer, a second forward primer, and a reverse primer, having nucleotide sequences as shown in SEQ ID NO. 1~3; different fluorescent groups are attached to the 5' ends of the first and second forward primers.

3. A method for screening roses with different callus regeneration abilities or predicting the callus regeneration ability of roses, characterized in that: The procedure includes the following steps: extracting DNA from the rose to be tested, detecting molecular markers using primer sets, and determining the genotype; the rose is a tetraploid modern rose; the molecular marker is an SNP molecular marker, the SNP molecular marker is located at position 15380033 on chromosome 2 of the modern rose 'Samantha' genome v2 version, and the molecular marker genotype is G / A, with its sequence shown in SEQ ID NO.4 and SEQ ID NO.5; The primer set includes a first forward primer, a second forward primer, and a reverse primer, having nucleotide sequences as shown in SEQ ID NO. 1~3; different fluorescent groups are attached to the 5' ends of the first and second forward primers; The criteria for classification are as follows: roses with genotype G / G / G / G have strong callus regeneration ability, while roses with genotype G / G / G / A or G / G / A / A have weak callus regeneration ability.

Images