KASP molecular markers, primers and applications related to YrCen gene

Abstract

The application belongs to the technical field of molecular markers, and discloses KASP molecular markers, primers and application related to a gene. YrCen The KASP molecular marker is XK7B-CA119 , located at the 729877598th position of the 7BL chromosome of wheat, and the version of the wheat genome is the Chinese spring reference genome 2.0. The KASP molecular marker is closely linked to the wheat stripe rust resistance gene YrCen , and the polymorphism at the KASP molecular marker is A / G. The KASP molecular marker can accurately track the wheat stripe rust resistance gene YrCen , can replace phenotype identification, and is used for genotype selection of a wheat individual containing the stripe rust resistance gene YrCen YrCen , screening of germplasm resources, molecular marker assisted selection, improvement of wheat disease resistance breeding efficiency, and has a wide application prospect in cultivation of wheat varieties resistant to stripe rust.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology and relates to... YrCen Gene-related KASP molecular markers, primers, and applications. Background Technology

[0002] Wheat stripe rust is caused by the wheat-specific strain of *Striga styracifolium* (Striga styracifolium). Puccinia striiformis f. sp. Tritici This low-temperature airborne fungal disease (Pst.) threatens high and stable wheat yields. It can infect wheat throughout its entire growth cycle, primarily affecting the leaves, but in severe cases, it can spread to the leaf sheath and ears. When infected, the uredinia are arranged longitudinally along the leaf veins in a dotted line pattern, sometimes covering the entire leaf. This leads to a significant decrease in photosynthesis and insufficient grain filling, resulting in yield reduction. The pathogen can spread over long distances via high-altitude air currents, resulting in widespread outbreaks and high frequency of disease outbreaks. Chemical control is difficult; therefore, breeding and planting resistant varieties are fundamental measures for disease control.

[0003] Breeding and planting stripe rust-resistant varieties has economic, efficient, and environmentally friendly advantages. Traditional disease resistance breeding relies on field inoculation and phenotypic selection, which is not only time-consuming and costly but also easily affected by environmental conditions, disease severity, and the experience of the identification personnel, resulting in low selection efficiency and poor accuracy. Molecular marker-assisted selection (MAS) technology can directly detect the genotype of disease resistance genes at the seedling stage or even the seed stage, without being limited by environmental and disease conditions. It can achieve precise aggregation of multiple genes, significantly shortening the breeding cycle and improving selection efficiency. Among various molecular marker technologies, competitive allele-specific PCR (KASP) technology, based on single nucleotide polymorphism (SNP) site design, has advantages such as high throughput, low cost, good accuracy, and simple operation, and has become the mainstream genotyping technology in wheat molecular breeding. Therefore, developing molecular markers that can assist in the detection of stripe rust resistance gene genotypes is of great significance.

[0004] To date, wheat stripe rust resistance genes have been officially named both domestically and internationally. Yr There are over 80 resistance genes, which can be divided into two main categories based on the stage of resistance expression: all-growth-period resistance (ASR) genes and adult-stage resistance (APR) genes. ASR genes include... Yr5 , Yr15 , Yr26 , Yr69 These genes can express resistance as early as the seedling stage, but usually have a narrow resistance spectrum and are easily lost due to variations in pathogen races; APR genes, such as... Yr18 , Yr29 , Yr30 , YrCenThese genes, such as APR, are expressed only at the adult stage, exhibiting mild but persistent resistance. The aggregation of multiple genes can provide high levels of broad-spectrum resistance. However, the number of officially named APR genes is currently limited, and functional or tightly linked markers suitable for breeding practice remain scarce. Simultaneously, many mapped adult-stage resistance QTL loci are still in the early stages of mapping, with large mapping intervals and unstable genetic effects, making them difficult to use directly for assisted selection. Therefore, further exploration and utilization of stable and reliable APR-related molecular markers are of urgent practical significance for accelerating the molecular breeding process for wheat disease resistance. Summary of the Invention

[0005] To solve the above-mentioned technical problems, the present invention provides a method that... YrCen Gene-related KASP molecular markers, primers, and applications. The KASP molecular markers are... XK7B-CA119 Located at position 729,877,598 on the wheat 7BL chromosome, in the Chinese Spring Reference Genome 2.0 version of the wheat genome, this KASP molecular marker is associated with the wheat stripe rust resistance gene. YrCen The genes are tightly linked, and the polymorphism at the KASP molecular marker is A / G. This invention's KASP molecular marker can accurately track wheat stripe rust resistance genes. YrCen It can replace phenotypic identification for samples containing stripe rust resistance genes. YrCen Genotypic selection and germplasm resource screening of individual wheat plants can be used for marker-assisted selection, which can improve the efficiency of wheat disease resistance breeding and has broad application prospects in the breeding of wheat varieties resistant to stripe rust.

[0006] On the one hand, the present invention provides a method with YrCen The gene-related KASP molecular marker is located at position 729,877,598 on wheat chromosome 7BL.

[0007] The wheat genome version mentioned is the Chinese Spring Reference Genome 2.0; The polymorphism at the KASP molecular marker is A / G.

[0008] Furthermore, the KASP molecular marker and YrCen Genes are tightly linked, the stated YrCen The gene is a wheat stripe rust resistance gene.

[0009] Furthermore, when the genotype at the KASP molecular marker is AA, the wheat material does not contain the stripe rust resistance gene. YrCen ; When the genotype at the KASP molecular marker is GG, the wheat material contains a homozygous stripe rust resistance gene. YrCen ; When the genotype at the KASP molecular marker is AG / GA, the wheat material contains a heterozygous stripe rust resistance gene. YrCen .

[0010] The KASP molecular marker is located at position 101 of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

[0011] On the other hand, the present invention claims protection for a KASP primer set for detecting KASP molecular markers, the KASP primer set consisting of a forward primer and a reverse primer; The forward primer consists of a first forward primer and a second forward primer; The nucleotide sequence of the first forward primer is shown in SEQ ID NO:3; The nucleotide sequence of the second forward primer is shown in SEQ ID NO:4; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:5.

[0012] Furthermore, the first forward primer and reverse primer are used to identify wheat with an allele of A at the KASP molecular marker; The second forward and reverse primers were used to identify wheat with the G allele at the KASP molecular marker.

[0013] On the other hand, this invention seeks to protect the above-mentioned KASP primer set in identifying whether wheat contains a stripe rust resistance gene. YrCen In this application, using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the aforementioned KASP primer set. When the fluorescence of the amplification products was all FAM, the wheat material did not contain the stripe rust resistance gene. YrCen ; When the fluorescence of the amplification products is all HEX, the wheat material contains a homozygous stripe rust resistance gene. YrCen ; When the amplified product exhibits both FAM and HEX fluorescence, the wheat material contains a heterozygous stripe rust resistance gene. YrCen .

[0014] Furthermore, the PCR amplification reaction system is as follows: 0.2 μg of wheat genomic DNA to be tested, 2 μL of 2×KASP V4.0Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O.

[0015] The mixed primer consists of 12 μL of the first forward primer (100 μM), 12 μL of the second forward primer (100 μM), 30 μL of the reverse primer (100 μM), and 46 μL of ddH2O.

[0016] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

[0017] On the other hand, this invention claims protection for a method for identifying whether wheat contains a stripe rust resistance gene. YrCen The kit contains the above-mentioned KASP primer set.

[0018] Furthermore, this invention seeks protection for the application of the aforementioned KASP primer set in wheat breeding, wherein the wheat breeding includes determining whether wheat contains a stripe rust resistance gene. YrCen Early identification, germplasm screening, or molecular marker-assisted breeding are used to improve the breeding efficiency of wheat germplasm resistant to stripe rust.

[0019] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: This invention provides a method with YrCen Gene-related KASP molecular markers YrCen The gene is a wheat stripe rust resistance gene, and the KASP molecular marker is related to... YrCen The genes are tightly linked. The KASP molecular marker is located at position 729,877,598 on the wheat 7BL chromosome, and the wheat genome version is the Chinese Spring Reference Genome 2.0. The polymorphism at the KASP molecular marker is A / G. This invention's KASP molecular marker is used to identify whether wheat contains a stripe rust resistance gene. YrCen The wheat material exhibits high specificity; when the genotype at the KASP molecular marker is AA, the wheat material does not contain the stripe rust resistance gene. YrCen When the genotype at the KASP molecular marker is GG, the wheat material contains a homozygous stripe rust resistance gene. YrCen When the genotype at the KASP molecular marker is AG / GA, the wheat material contains a heterozygous stripe rust resistance gene. YrCen The KASP molecular marker of this invention can replace phenotypic identification for genes containing resistance to stripe rust. YrCen Genotypic selection and germplasm resource screening of individual wheat individuals can be applied to... YrCen Molecular-assisted selection breeding can accelerate the breeding process. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 for YrCen Genes and KASP molecular markers XK7B-CA119 Map showing the localization results on chromosome 7BL.

[0022] Figure 2 KASP molecular marker XK7B-CA119 Genotyping results of a natural population.

[0023] Figure 3 KASP molecular marker XK7B-CA119 A graph showing the association between genotype and phenotype in a natural population.

[0024] Figure 4 KASP molecular marker XK7B-CA119 Genotyping results of the validation population. Detailed Implementation

[0025] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially. Unless otherwise specified, the percentages in the following embodiments refer to mass percentages.

[0026] Example 1 This embodiment provides a wheat stripe rust resistance gene. YrCen The fine localization of KASP molecules and the development of co-separated KASP molecular markers.

[0027] A recombinant inbred line (RIL) population was constructed by crossing 229-19 (a cross between the German wheat variety Centrum and the Chinese wheat variety Xinong 979) with the Australian wheat variety Avocet S and then continuously self-pollinating for five generations. From the F4-RIL population, families exhibiting phenotypic and genotypic segregation were selected as residual heterozygous lines to construct a fine-mapping population. The entire experiment was conducted in the field in Yangling District, Shaanxi Province. The specific steps were as follows: the RIL population was row-sown with 20 seeds per row, and the fine-mapping population was sown at individual points. The fine-mapping population was then tagged for sampling, phenotypic identification, and genotyping to screen for recombinants, thereby narrowing the positioning interval. Phenotypic identification used two evaluation indicators: infection type (IT) and disease severity (DS). IT was assessed using a 0-9 rating scale, and DS was assessed using 0, 1%, 5%, 10%, 20%, 30%, 40%, 60%, 80%, and 100% ratings.

[0028] Genomic DNA was extracted from leaves of parental 229-19, Avocet S, F2 secondary segregating populations, and RIL populations using the CTAB (Cetyltrimethylammonium bromide) method. DNA quality control was performed using agarose gel electrophoresis, and DNA quantification was conducted using Thermo Fisher Scientific's NanoDrop assay. TM Measurements were taken using a One / OneC ultra-micro UV spectrophotometer. YrCen Polymorphic KASP markers were developed within the mapping interval. Flanking markers were selected for genotyping of a large population to screen key recombinants. The newly developed KASP markers were then used to genotype the key recombinants, constructing high-density genetic and physical maps. The genetic map was constructed using IciMapping V4.2. All key recombinants were harvested individually, and then double-row planted during the 2024-2025 growing season for progeny testing. Finally, the genetic distance of the fine mapping interval of the target gene was determined by combining the large population phenotype and the progeny test phenotype. Preliminary linkage analysis was performed using the RIL population and the F2 secondary segregating population (population size 822), combined with field phenotypes. YrCen Located within the 0.12 cM region, corresponding to a physical location of 728.05–730.26 Mb in the Chinese Spring reference genome 2.0, and associated with the KASP molecular marker. XK7B-CA119 Co-separation ( Figure 1 ).

[0029] XK7B-CA119 Located at position 101 of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2, amplified XK7B-CA119 The primer sequences include a first forward primer (SEQ ID NO:3), a second forward primer (SEQ ID NO:4), and a reverse primer (SEQ ID NO:5). The 5′ in the primer sequences... GAAGGTGACCAAGTTCATGCT-3′ is a universal primer for FAM fluorescence. The FAM fluorescent group is observed at excitation wavelengths of 485 nm and emission wavelengths of 520 nm. (5′) GAAGGTCGGAGTCAACGGATT-3′ is a universal HEX fluorescent primer. The HEX fluorescent group is observed at excitation wavelengths of 535 nm and emission wavelengths of 556 nm. The first forward and reverse primers are used to detect wheat materials with the A allele at the KASP molecular marker, and the second forward and reverse primers are used to detect wheat materials with the G allele at the KASP molecular marker.

[0030] SEQ ID NO: 1: 5′-TTGTTCCTCGATTGAGGTAGGCATGACTATGTCTCTGCCCTATCCCCTAGGATTTTTTTAGAGCACTCAAGATGTGTTTGTGATAGACAGGAAAACTACG A GCAGACTAAATTTCAAGATTCTGCAACTGATATTGAAGACCACGTACACCTAACTCTCTAGCCTTTGAACCTTCGCAACTACTTACTACGCCCCAATCCA-3′; SEQ ID NO: 2: 5′-TTGTTCCTCGATTGAGGTAGGCATGACTATGTCTCTGCCCTATCCCCTAGGATTTTTTTAGAGCACTCAAGATGTGTTTGTGATAGACAGGAAAACTACG G GCAGACTAAATTTCAAGATTCTGCAACTGATATTGAAGACCACGTACACCTAACTCTCTAGCCTTTGAACCTTCGCAACTACTTACTACGCCCCAATCCA-3′; (The underlined position is the KASP molecular marker) SEQ ID NO: 3: 5′-GAAGGTGACCAAGTTCATGCTgcagaatcttgaaatttagtctgcA-3′; SEQ ID NO: 4: 5′-GAAGGTCGGAGTCAACGGATTgcagaatcttgaaatttagtctgcG-3′; SEQ ID NO: 5: 5'-tctctgccctatcccctagg-3'.

[0031] Example 2 This embodiment provides the KASP molecular marker. XK7B-CA119 In identifying whether wheat materials are resistant to stripe rust and whether they contain stripe rust resistance genes... YrCen Applications in [the field].

[0032] Using 221 natural wheat populations as test materials (Table 1), genomic DNA was extracted from the wheat materials using the CTAB method and used as amplification templates. KASP molecular markers were then used for amplification. XK7B-CA119 The primer sequences were used to amplify the genomic DNA of the sample to be tested by PCR to obtain the amplification products.

[0033] The PCR amplification reaction system consisted of: 0.2 μg of genomic DNA from the sample to be tested, 2 μL of 2×KASP V4.0 Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O.

[0034] The mixed primer system consisted of: 12 μL of the first forward primer (100 μM), 12 μL of the second forward primer (100 μM), 30 μL of the reverse primer (100 μM), and 46 μL of ddH2O.

[0035] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

[0036] The amplification products were transferred to a microplate reader to read the fluorescence data. This fluorescence data was then imported into KlusterCaller software for analysis to obtain genotype data. The homozygous allele genotype with HEX fluorescence was "Y:Y," indicating that the tested wheat material contained a stripe rust resistance gene. YrCen , recorded as YrCen+ The homozygous allele genotype with FAM fluorescence is "X:X", and the tested wheat material does not contain the stripe rust resistance gene. YrCen , recorded as YrCen- The heterozygous genotype is "X:Y" or "Y:X", and the wheat material being tested contains a heterozygous stripe rust resistance gene. YrCen , recorded as YrCen+ / - The missing genotype is marked with a "?". The genotyping results of 221 natural wheat populations are shown in Table 1. Figure 2 As shown, the association results between genotype and phenotype are as follows: Figure 3 As shown.

[0037] Table 1. Genetic testing results of 221 natural wheat populations.

[0038]

[0039]

[0040] Depend on Figure 2 It can be seen that the genotype is Y:Y YrCen Homozygous positive wheat materials and those with genotype X:X YrCen In homozygous negative wheat materials, clear genotyping and clustering with no ambiguous samples were observed using this KASP molecular marker, and no amplification contamination was found in the blank control, indicating that this KASP marker can stably distinguish between different types of wheat. YrCen Two homozygous alleles at the locus can be used for wheat YrCen Molecular detection and marker-assisted selection of genes.

[0041] Depend on Figure 3 It can be seen that in the marking XK7B-CA119 Contains genes that resist stripe rust YrCen The average IT value of the plants was 3.5, which was significantly lower than that of plants without the stripe rust resistance gene. YrCen The plants had an average IT value of 6.4 and contained a gene for resistance to stripe rust. YrCen The average DS of the plants was 20.1, which was significantly lower than that of plants without the stripe rust resistance gene. YrCen The average DS of the plants was 53.6. The actual results were consistent with the expected results, demonstrating the effectiveness of the molecular markers used in this invention. XK7B-CA119 It can replace phenotypic identification for products containing stripe rust resistance genes. YrCen Genotypic selection and germplasm resource screening of individual wheat individuals can be applied to... YrCen Molecular-assisted selection breeding can accelerate the breeding process.

[0042] Example 3 This embodiment provides the KASP molecular marker. XK7B-CA119 To verify the genotyping in the population.

[0043] Forty-five wheat samples were selected from the F2 secondary segregating population as a validation population. Genomic DNA was extracted from these samples using the CTAB method and used as amplification templates. KASP molecular markers were then used for amplification. XK7B-CA119 The primer sequences were used to amplify the genomic DNA of the sample to be tested by PCR to obtain the amplification products.

[0044] The PCR amplification reaction system consisted of: 0.2 μg of genomic DNA from the sample to be tested, 2 μL of 2×KASP V4.0 Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O.

[0045] The mixed primer system consisted of: 12 μL of the first forward primer (100 μM), 12 μL of the second forward primer (100 μM), 30 μL of the reverse primer (100 μM), and 46 μL of ddH2O.

[0046] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

[0047] The amplification products were transferred to a microplate reader to read the fluorescence data. This fluorescence data was then imported into KlusterCaller software for analysis to obtain genotype data. The homozygous allele genotype with HEX fluorescence was "Y:Y," indicating that the tested wheat material contained a stripe rust resistance gene. YrCen , recorded as YrCen+ The homozygous allele genotype with FAM fluorescence is "X:X", and the tested wheat material does not contain the stripe rust resistance gene. YrCen , recorded as YrCen- The heterozygous genotype is "X:Y" or "Y:X", and the wheat material being tested contains a heterozygous stripe rust resistance gene. YrCen , recorded as YrCen+ / - The missing genotype is "?". Genotyping results for the F2 population with a size of 45 are as follows: Figure 4 As shown.

[0048] Depend on Figure 4 It can be seen that the genotype is Y:Y YrCen Homozygous positive wheat materials and those with genotype X:X YrCen Homozygous negative wheat materials, heterozygous wheat materials with genotype Y:X YrCen+ / - The KASP molecular marker showed clear genotyping and clustering with no ambiguous samples, and the blank control showed no amplification contamination, indicating that the KASP marker can stably distinguish between different samples. YrCen The two homozygous alleles and heterozygous genotypes at the locus can be used for wheat. YrCen Molecular detection and marker-assisted selection of genes.

[0049] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.

Claims

1. A KASP primer set for identifying whether wheat contains a stripe rust resistance gene. YrCen The application of this is characterized by, The KASP primer set consists of forward primers and reverse primers; The forward primer consists of a first forward primer and a second forward primer; The nucleotide sequence of the first forward primer is shown in SEQ ID NO:3; The nucleotide sequence of the second forward primer is shown in SEQ ID NO:4; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:5; Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the aforementioned KASP primer set. When the fluorescence of the amplification product was FAM, the wheat material did not contain the stripe rust resistance gene. YrCen ; When the fluorescence of the amplification products is all HEX, the wheat material contains a homozygous stripe rust resistance gene. YrCen ; When the amplified product exhibits both FAM and HEX fluorescence, the wheat material contains a heterozygous stripe rust resistance gene. YrCen .

2. The application according to claim 1, characterized in that, The PCR amplification reaction system was as follows: 0.2 μg of wheat genomic DNA to be tested, 2 μL of 2×KASP V4.0 Master mix, 0.0448 μL of mixed primers, and 1.9552 μL of ddH2O; The mixed primer consists of 12 μL of the first forward primer, 12 μL of the second forward primer, 30 μL of the reverse primer, and 46 μL of ddH2O; The concentrations of the first forward primer, the second forward primer, and the reverse primer were all 100 μM.

3. The application according to claim 1, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, 32 cycles.

4. The application of a KASP primer set in marker-assisted breeding of wheat for resistance to stripe rust, characterized in that, The KASP primer set consists of forward primers and reverse primers; The forward primer consists of a first forward primer and a second forward primer; The nucleotide sequence of the first forward primer is shown in SEQ ID NO:3; The nucleotide sequence of the second forward primer is shown in SEQ ID NO:4; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:5; Using the wheat genomic DNA to be tested as a template, PCR amplification was performed using the aforementioned KASP primer set. When the fluorescence of the amplification product was FAM, the wheat material did not contain the stripe rust resistance gene. YrCen ; When the fluorescence of the amplification products is all HEX, the wheat material contains a homozygous stripe rust resistance gene. YrCen ; When the amplified product exhibits both FAM and HEX fluorescence, the wheat material contains a heterozygous stripe rust resistance gene. YrCen ; Select those containing stripe rust resistance genes. YrCen We are breeding wheat materials.

Images