A redisporum yeast promoter and application thereof

Abstract

This invention discloses a promoter for *Rhodotorula rubrum*. PRkSym1 Its nucleotide sequence is shown in SEQ ID NO:1. This invention clones the 5' end nucleotide sequence of the promoter of the mitochondrial inner membrane protein gene from *Rhodotorula rubrum*, enabling its expression in *Rhodotorula rubrum* YM25235. The expression is then detected... RtGFP The gene expression status was analyzed, and it was determined that the 5' nucleotide sequence of the mitochondrial inner membrane protein gene of this length has promoter activity and the promoter strength is very close to that of the strong promoter on plasmid pRH2034. This invention provides a new promoter sequence for endogenous expression, which has important research significance and application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method isolated from *Rhodotorula rubrum* (…). Rhodosporidium kratochvilovae) YM25235 starter PRkSym1 And its applications. Background Technology

[0002] Red yeast, a microorganism with unique physiological characteristics and broad industrial application potential, has gradually emerged in scientific research and industrial production in recent years. Its high cell density and efficient ability to metabolize multiple carbon and nitrogen sources make it outstanding in fields such as biotransformation, lipid production, and carotenoid synthesis. In red yeast, whether studying metabolic regulatory pathways or increasing the content of metabolites, it is usually necessary to overexpress relevant genes.

[0003] Currently, there are certain obstacles to the cross-species use of Sym1 homologous proteins in functional applications or research across different species, mainly including promoter localization specificity, differences in interacting proteins, and differences in regulatory mechanisms. First, promoter localization specificity is a major obstacle. The promoter is the binding site of RNA polymerase, determining when and where gene expression begins. The sequence and structure of promoters may differ significantly between cells of different species, leading to some promoters being effective in one organism but ineffective or inefficient in another. Second, differences in transcription factors are also an important factor. Transcription factors are proteins that regulate gene expression, and the types and affinities of transcription factors may differ between cells of different species, which may result in foreign genes not being expressed correctly or at low expression levels in new species. Finally, differences in regulatory mechanisms are also a key obstacle. The regulatory mechanisms of gene expression may differ significantly between cells of different species, including differences in epigenetic modifications and chromatin structure, all of which can affect the expression efficiency and stability of foreign genes.

[0004] fungi Sym1 Gene promoters, specifically mitochondrial inner membrane protein promoters, are stress-inducible protein promoters that regulate gene expression under various conditions. Homology studies show that these promoters are conserved in fungi, exhibiting low basal expression activity under normal culture conditions, but can be upregulated 2-5 times under conditions such as heat stress, ethanol, oxidative stress, or carbon source conversion. In *Saccharomyces cerevisiae*, the Sym1 promoter exhibits moderate to weak transcriptional drive strength, weaker than strong constitutive promoters (such as TEF1 and TDH3) and strong stress promoters (such as the HSP family). For example, some Sym1 promoters may exhibit different activities due to specific environmental conditions, such as temperature and nutritional status. Summary of the Invention

[0005] This invention provides a method for obtaining Rhodotorula rubrum (Rhodosporidium kratochvilovae The mitochondrial inner membrane protein gene was isolated from YM25235. RkSym1 ) promoter ( PRkSym1 The promoter and its application are shown in SEQ ID NO:1. The gene sequence is 1992 bp long. The promoter is linked to a vector and transferred into Rhodotorula rubrum cells to regulate the transcription and expression of endogenous target genes in Rhodotorula rubrum.

[0006] Red trematosporum promoter PRkSym1 The promoter is 1992 bp in length with a GC content of approximately 71.8%, classifying it as a high-GC endogenous promoter with a stable sequence structure. Based on transcriptional function, it can be divided into a distal regulatory region, a core regulatory region, and a proximal transcription initiation region. The sequence contains several conserved cis-elements: the CAAT box and variant sequences at -960 are responsible for maintaining basic constitutive transcription; the MYB binding site at -1280 responds to environmental stress and enhances transcriptional activity; and multiple AGGGG tandem sequences distributed at -1200, -800, and -560 can bind to Sp1 and MAZ transcription factors, significantly increasing transcriptional intensity and inhibiting transcriptional silencing. The Inr element in the transcription initiation region is homologous to the weakly TATA sequence, ensuring precise and efficient transcription initiation. Although this promoter contains numerous potential CpG sites, the methylation level in *Rhodotorula rubrum* is low, resulting in stable activity during long-term expression. This promoter exhibits high compatibility with the host's endogenous transcription system, combining high expression intensity, strong environmental adaptability, and stable propagation, making it an excellent regulatory element for gene expression and metabolic engineering in *Rhodotorula rubrum*.

[0007] The objective of this invention is achieved through the following technical solution: 1. Genomic DNA was extracted from *Rhodotorula rubrum* using a DNA extraction kit. Using the genomic DNA as a template, amplification products were obtained using specific primers PRkSym1-F1 and PRkSym1-R1. PRkSym1 The carrier pRH2034 after glue recovery (containing RtGFP Through multi-fragment homologous recombination, the fragments on the pRH2034 plasmid were... GPD1 The promoter was replaced with PRkSym1 The promoter was used to obtain the recombinant plasmid pRHPRkSym1GFP. The ligation product was transformed into E. coli. Positive single clones were screened by PCR. The recombinant plasmid pRHPRkSym1GFP was verified by PCR using promoter-specific primers. After culturing the positive clones, the plasmid was extracted and sequenced to obtain the recombinant plasmid pRHPRkSym1GFP containing the promoter of the mitochondrial inner membrane protein gene. 2. The recombinant vector pRHPRkSym1GFP was transformed into *Rhodotorula rubrum* YM25235 using the PEG-mediated protoplast method. Fluorescence was then used to determine the outcome. RtGFPThe expression status of the gene was determined to determine whether the 5' nucleotide sequence of the mitochondrial inner membrane protein gene has promoter activity; and the expression level of RtGFP fluorescent protein in Rhodotorula rubrum YM25235 was detected by Western blot experiment to determine the promoter strength.

[0008] Advantages and technical effects of the present invention: This invention clones the 5' nucleotide sequence of the promoter of a mitochondrial inner membrane protein gene from *Rhodotorula rubrum*, enabling its expression in *Rhodotorula rubrum* YM25235. The expression is then assessed by detecting... RtGFP The expression status was determined, and the 5' nucleotide sequence of the mitochondrial inner membrane protein gene of this length was found to have promoter activity and promoter strength higher than that of the promoter of plasmid pRH2034. This invention provides a new promoter sequence for endogenous expression, which has important research significance and application value. Attached Figure Description

[0009] Figure 1 The red syringomyelia YM25235 of the present invention PRkSym1 PCR amplification diagram of promoter sequence fragment; 1. DNA molecular scalar DL5000; 2. PCR amplification products; Figure 2 The plasmid map of the recombinant plasmid pRHPRkSym1GFP; Figure 3 Electrophoresis diagram for colony PCR verification; 1. DNA molecular weight; 2. Negative control; 3. PCR product amplified using recombinant plasmid pRHPRkSym1GFP as template; 4-5. Colony PCR products of transformants; Figure 4 To validate the positive clone of *Rhizopus oryzae* YM25235 transformed with recombinant plasmid pRHPRkSym1GFP, the following parameters were used: 1. DNA molecular scale DL5000; 2. negative control; 3. PCR product amplified using the YM25235 genome; 4. PCR product amplified using recombinant plasmid pRHPRkSym1GFP as template; 5. PCR product amplified using the transformant genome as template. Figure 5 The expression of green fluorescent protein after transformation of Rhodotorula rubrum protoplasts (objective lens 20×); Figure 6 Fluorescent proteins of strains YM25235 / pRH2034, YM25235 / pRHPRkSym1GFP, and control strain YM25235. RtGFP The Western blot results for expression levels are shown in the lanes from left to right: YM25235 / pRHPRkSym1GFP, YM25235 / pRH2034, and Rhodotorula rubrum YM25235. Detailed Implementation

[0010] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the reagents and methods used in the embodiments are all conventional reagents and conventional methods. Example 1: Cloning of the promoter of the mitochondrial inner membrane protein gene and construction of the expression vector pRHPRkSym1GFP 1. Genomic DNA was extracted from *Rhodotorula rubrum* using the DNA extraction kit (purchased from Shanghai Sangon Biotech Co., Ltd.) following the instructions. The promoters obtained from transcriptome sequencing were then analyzed. PRkSym1 Based on the sequence, specific primers PRkSym1-F1 and PRkSym1-R1 were designed. Using the DNA template obtained above, PCR amplification was performed in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) using primers PRkSym1-F1 and PRkSym1-R1. The primers, amplification system, and amplification conditions used are as follows: PRkSym1-F1: 5'- TTTTACTAGAACTAGGACGGC CGTCTGCTGCTTCGGCTTGA-3' (underlined is the upstream vector terminal homologous sequence); PRkSym1-R1:5'- TCGAGACCGGATCCGCCAT GCGTCGAGCAGAGCTGAG-3' (underlined sequence is the downstream vector terminal homologous sequence); The PCR amplification system is as follows (50 μL): Template cDNA 1 μL, P RkSym1 -F1 2μL, P RkSym1 -R1 2μL, dNTPs Mix (10mM each) 1μL, Vazyme 2×Phanta Max Buffer 25μL, Vazyme Phanta MaxSuper-Fidelity DNA Polymerase 1μL, ddH2O added to 50μL; Amplification conditions: 95℃ pre-denaturation for 3 min, followed by 95℃ denaturation for 15 s, 63℃ annealing for 15 s, and 72℃ extension for 3 min 15 s, for a total of 30 cycles, with a final extension at 72℃ for 5 min; after the reaction, 1 μL of the product was taken and analyzed by electrophoresis on a 1% agarose gel. The results are as follows. Figure 1 As shown; the amplified fragment was approximately 2000 bp in size, named PRkSym1 , PRkSym1 The nucleotide sequence is shown in SEQ ID NO:1.

[0011] 2. Extract plasmid pRH2034 (OMEGA Plasmid Mini Kit I, OMEGA Corporation, USA), measure its concentration, and store it at -20℃ for later use. Perform multi-fragment recombination on pRH2034. Recover the recombination products using a multifunctional DNA recovery kit (Beijing Biotech Biotechnology Co., Ltd., product number: DP1502). Combine the recovered fragments with the gene fragments. PRkSym1 Ligation was performed using a seamless cloning kit (ClonExpress II One Step Cloning Kit C112, Nanjing Novizan Biotechnology Co., Ltd.) to obtain the recombinant plasmid pRHPRkSym1GFP. The ligation system was as follows (20 μL): Exnase™ II 2 μL, RkSym1 822 ng of fragment, 200 ng of linearized pRH2034, 4 μL of 5×CEⅡBuffer, and the remainder ddH2O; gently mix with a pipette, briefly centrifuge to collect the reaction solution to the bottom of the tube, and then react in a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.) at 37℃ for 30 min; cool to 4℃ or immediately place on ice to cool; 3. Add 10 μL of the ligation product to 100 μL of DH5α competent cells, gently tap the tube wall to mix, incubate on ice for 30 min, heat shock at 42℃ for 90 s, and immediately cool on ice for 90 s. Add 900 μL of LB liquid medium to the ligation system, incubate at 37℃ and 100 rpm with shaking for 1 h, centrifuge at 5000 rpm for 10 min, discard 900 μL of supernatant, and gently pipette the remaining 100 μL of LB medium to suspend the cells and spread them on LB agar plates (containing 100 µg / mL spectinomycin). Incubate upside down at 37℃ for 12-16 h. Randomly pick white colonies growing on the plates and verify positive clones by colony PCR. The results are shown in the figure. Figure 3 As can be seen from the figure, the selected monoclonal strains all amplified specific bands of the same size as the plasmid fragments by colony PCR, indicating that the selected DH5α strains were successfully transformed into recombinant plasmids. The amplification system and conditions are the same as above, and the amplification primers are as follows: PRkSym1-F1: 5'- TTTTACTAGAACTAGGACGGC CGTCTGCTGCTTCGGCTTGA-3' (underlined is the upstream vector terminal homologous sequence); RH-R: 5'-GAGCGAAACCCTATAGGAAC-3'; Positive clones were inoculated into LB liquid medium (containing 100 µg / mL spectinomycin) and cultured overnight. Bacterial cells were collected and plasmids were extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA). The plasmid, validated by PCR, was further sequenced for verification. Sequencing results (Kunming Shuoqing Biotechnology Co., Ltd.) showed that the amplified fragment was approximately 2900 bp in size, which is the size of the recombinant plasmid pRHPRkSym1GFP fragment.

[0012] 4. Select a single colony of DH5α strain successfully transformed into the correct recombinant vector pRHPRkSym1GFP and inoculate it into LB liquid medium (containing 100 µg / mL spectinomycin) for overnight culture. Extract the plasmid (OMEGA Plasmid Mini Kit I, OMEGA, USA), measure the concentration, and store at -20℃ for later use. Transform the recombinant vector pRHPRkSym1GFP into *Rhodotorula rubrum* YM25235 using PEG-mediated protoplast transformation. The specific method is as follows: Inoculate a single colony of *Rhodotorula rubrum* YM25235 into 5 mL of YPD liquid medium and culture overnight at 28℃ with shaking at 160 rpm. Use this as the seed culture. Transfer the seed culture at a 1% inoculation rate to 50 mL of YPD liquid medium and culture at 28℃ with shaking at 160 rpm until the bacterial culture reaches OD500. The concentration of 600 is between 0.45 and 0.5. The bacterial culture was centrifuged at 4500 rpm for 5 min at 4℃ to collect the bacterial cells. The collected bacterial cells were washed twice with a pre-prepared citrate buffer (3 mmol / L citric acid, 83 mmol / L sodium citrate, 600 mmol / L mannitol, and NaOH adjusted to pH 5.4), and then resuspended in 800-1000 μL of citrate buffer and placed on ice. An enzyme digest (0.075 g snail enzyme, 0.03 g Sigma-Aldrich lysozyme, 0.03 g Guangdong microbial lysozyme, diluted to 5 mL with citrate buffer) was prepared and filtered through a 0.22 μm sterile filter membrane, then placed in a 5 mL sterile centrifuge tube. 4 mL of the enzyme solution was mixed with the bacterial cells resuspended in 800-1000 μL of citrate buffer and incubated at 28℃ with shaking at 90 rpm for 2 days.Enzymatic digestion was performed after 5-3 hours. A small amount of bacterial culture was taken and the digestion efficiency was observed under a microscope. After confirming that the amount of culture was sufficient, the culture was centrifuged at 4°C and 1300 rpm for 10 min to collect the bacterial cells. 10 mL of STC buffer (12 mol / L sorbitol, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) was added and the collected bacterial cells were washed twice on ice to prepare competent yeast cells. The bacterial cells were resuspended in 800-1000 μL of STC buffer and aliquoted into 100 μL sterile centrifuge tubes for later use. 10 μL of pRHPRkSym1GFP recombinant plasmid at a concentration of 20992 μg / mL was added to 100 μL of competent cells and mixed gently. The cells were incubated on ice for 10 min. 200 μL of pre-chilled PTC buffer (50% PEG, 10 mmol / L Tris-HCl, 100 mmol / L CaCl2) was added. Add CaCl2), incubate on ice for 10 min, then add 200 μL of pre-chilled PTC buffer, incubate on ice for another 10 min, and finally add 800 μL of pre-chilled PTC buffer and gently mix. Incubate at 42°C for 30 min. After the water bath, centrifuge at 4°C and 1500 rpm for 10 min to collect the bacterial cells. Discard 1 mL of supernatant and add 1 mL of... The cells were suspended in 0.4 mol / L sucrose YPD liquid medium and cultured at 28°C with shaking at 90 rpm for 24 h to revive them. The revived cells were then collected by centrifugation at 1300 rpm for 10 min. The supernatant was discarded, and the remaining 100 μL of medium was used to resuspend the cells. The cells were then spread onto YPD solid medium supplemented with 0.4 mol / L sucrose (containing 40 μg / mL hygromycin B) and incubated upside down at 28°C for 3-4 days until growth occurred. Transformants were numbered and transferred to YPD solid medium containing 150 μg / mL hygromycin B, and incubated upside down at 28°C for two days. The resulting transformants were inoculated into 5 mL test tubes containing YPD liquid medium and cultured at 28°C with shaking at 160 rpm for 24 h, using the wild-type strain YM25235 as a control. Genomic DNA was extracted from the yeast transformants according to the instructions of the DNA extraction kit (purchased from Shanghai Sangon Biotech Co., Ltd.), and then verified by PCR. The results are shown below. Figure 4 As shown in the figure, PCR using the transformant's genome as a template amplifies a band of the same size as the pRHPRkSym1GFP fragment, confirming the correctness of the recombinant transformant's gene signature and indicating that it carries the gene. PRkSym1 The recombinant plasmid pRHPRkSym1GFP has been successfully introduced into the genome of a yeast transformant.

[0013] The amplification system and conditions are the same as above, and the amplification primers are as follows: The first pair was used for YM25235 genome amplification: PRkSym1-F1: 5'-TTTTACTAGAACTAGGACGGC CGTCTGCTGCTTCGGCTTGA-3' (underlined is the upstream vector terminal homologous sequence); PRkSym1-R1:5'- TCGAGACCGGATCCGCCAT GCGTCGAGCAGAGCTGAG-3' (underlined sequence is the downstream vector terminal homologous sequence); The second pair is used for recombinant plasmids and transformant genome amplification: PRkSym1-F1: 5'- TTTTACTAGAACTAGGACGGC CGTCTGCTGCTTCGGCTTGA-3' (underlined is the upstream vector terminal homologous sequence); RH-R: 5'-GAGCGAAACCCTATAGGAAC-3'.

[0014] Using strain YM25235 as a control, the selected positive transformants were passed through YPD solid medium containing 150 μg / mL hygromycin B for 6 generations, and the results were determined by fluorescence detection. RtGFP The expression situation, the result is as follows Figure 5 As shown, this indicates that *Rhodotorula rubrum* PRkSym1 The promoter can effectively initiate the expression of fluorescent protein genes in Rhodotorula rubrum, indicating that the constructed vector can effectively express exogenous genes in Rhodotorula rubrum.

[0015] Example 2: Rhodotorula rubrum PRkSym1 Promoter strength testing The original plasmid pRH2034 (the promoter of which is derived from Rhodotorula rubrum) was used. R. toruloides The recombinant plasmid pRHPRkSym1GFP (ATCC10657) was transformed into *Rhodotorula rubrum* YM25235 using the protoplast transformation method described above, and positive clones were screened by fluorescence detection.

[0016] Positive transformants were inoculated into 50 mL of YPD liquid medium and fermented at 28 °C and 160 rpm for 48 h. After centrifugation at 4500 rpm for 6 min, the cells were collected into 2 mL centrifuge tubes, washed twice with pre-cooled ddH2O, and finally centrifuged at 12000 rpm for 5 min to completely remove residual water. The cells were then immediately flash-frozen in liquid nitrogen and stored at -80 °C.

[0017] Sample lysis: Sample lysis is performed using conventional methods, such as ultrasonic disruption or chemical lysis.

[0018] Sample preparation: Centrifuge the lysed sample at 10,000 rpm for 10 min, discard the precipitate after centrifugation, take out the supernatant, add 5× loading buffer, and treat at 100℃ for 5-10 min; SDS-PAGE electrophoresis: Take 10 μL of sample for SDS-PAGE electrophoresis, run the gel at 80 V and 60 mA for 30 min. After the marker develops, switch to 120 V and 80 mA and continue running the gel for 1 h 30 min. Transfer: Immediately after electrophoresis, transfer the gel to deionized water and soak for 2 minutes. Equilibrate the nitrocellulose or PVDF membrane used for transfer with methanol for 15 minutes. The instrument used for semi-dry transfer is the S-TRANS rapid multichannel semi-dry transfer apparatus. Following the instrument manual, first thoroughly wet the high-efficiency transfer pads with buffer. The S-TRANS high-efficiency transfer pads wetted with S-TRANS anode buffer must be used on the anode plate side, and the S-TRANS high-efficiency transfer pads wetted with S-TRANS cathode buffer must be used on the cathode plate side. The bottom of the transfer box is the anode plate, and the lid of the transfer box is the cathode plate. Assemble the transfer "sandwich structure" in the semi-dry transfer box, remove air bubbles, slide the transfer box into the transfer tank, and set the voltage to 130V and the current to 350A for 1.5-2 hours. Cleaning: Transfer the PVDF membrane after transfer to PBST, and clean it by shaking on a decolorizing shaker at room temperature for 10 minutes each time, for a total of 2 times; Blocking: Prepare 35% skim milk as the blocking solution and block at room temperature for 2 hours; Washing: Transfer the blocked PVDF membrane to PBST, wash it with a shaker at room temperature for 10 minutes each time for a total of 3 washes, and then incubate with primary antibody after wiping the washing solution with filter paper. Primary antibody incubation: Dilute the primary antibody in the antibody dilution box according to the dilution ratio in the antibody instructions. The dilution volume is 10 mL. Place the antibody dilution box in a shaker at 4°C and incubate overnight. Primary antibody washing: Transfer the incubated membrane to PBST and wash it with a shaking incubator at room temperature for 10 minutes each time, for a total of 3 washes; Secondary antibody incubation: Dilute the secondary antibody in the antibody dilution box according to the dilution ratio in the antibody instructions. The dilution volume is 10 mL. Place the antibody dilution box in a shaker at 37°C and incubate for 1 hour. Second antibody washing: Transfer the incubated membrane to PBST, and wash it with a shaking incubator at room temperature for 10 minutes each time, for a total of 3 washes; Color development: ECL color development solution was used for color development. After 3-5 minutes of color development, the results were analyzed and observed on a fully automated chemiluminescence image analyzer.

[0019] like Figure 6 As shown, it is derived from Rhodotorula rubrum. PRkSym1 The promoter can effectively activate the fluorescent protein gene in *Rhodotorula rubrum*. RtGFP The expression can be seen above. PRkSym1The promoter can effectively express foreign genes in Rhodotorula rubrum, and the strength of this promoter is close to that of the strong promoter on plasmid pRH2034.

Claims

1. A promoter for *Rhodotorula rubrum* PRkSym1 Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The Rhodotorula rubrum promoter as described in claim 1 PRkSym1 Regulating exogenous target genes in Rhodotorula rubrum ( Rhodosporidium kratochvilovae Applications of transcription and expression in ).

Images