A method for inhibiting expression of a CsRBL1 gene to improve resistance to citrus canker

Abstract

This invention discloses a method for inhibiting CsRBL1 This invention relates to a method for improving resistance to citrus canker through gene expression, and pertains to the field of agricultural biotechnology. It is the first to disclose a method for improving resistance to citrus canker in citrus. CsRBL1 The function of the gene in citrus canker resistance, and provide a method for inhibiting CsRBL1 A method to enhance citrus resistance to bacterial canker through gene expression. Transgenic citrus plants obtained using this method show a reduction in bacterial canker incidence to 34.13% of existing citrus plants, significantly alleviating canker symptoms and demonstrating a markedly enhanced resistance to the disease.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to a method for inhibiting... CsRBL1 Methods to enhance resistance to citrus canker through gene expression. Background Technology

[0002] Citrus is a major fruit tree with a large planting area and high economic value worldwide. Citrus canker is a serious bacterial disease that damages citrus production. It is caused by Xanthomonas citrus subsp. citrus (… Xanthomonas citri subsp. citri Citrus canker, caused by infection, can damage leaves, branches, and fruits, leading to leaf and fruit drop, tree decline, and severely impacting citrus yield and quality, resulting in significant economic losses to the global citrus industry annually. Currently, production mainly relies on chemical control methods, primarily spraying copper-based agents, to control the occurrence and spread of citrus canker. However, the long-term and excessive application of these chemicals not only significantly increases citrus production costs but also easily leads to drug resistance in pathogens and causes serious pollution to soil, water, and other ecological environments. Therefore, breeding and promoting new citrus varieties resistant to citrus canker is considered an effective way to fundamentally solve the damage caused by citrus canker and achieve green and sustainable development of the citrus industry.

[0003] With the development of molecular biology and genetic engineering technologies, creating disease-resistant citrus germplasm through genetic improvement has become an important research direction. Current technologies show that using CRISPR / Cas9-mediated gene editing or RNA interference (RNAi) technology to reduce the expression level of citrus canker susceptibility genes or overexpress canker resistance genes can effectively improve citrus resistance to canker. For example, knocking out or suppressing susceptibility genes... CsLOB1 (Peng et al. 2017) CsWRKY22 (Wang et al. 2019) and CsFAO3 The expression, or overexpression, of the resistance gene (Peng et al. 2024) CiNPR4 (Zhang et al., 2021) all obtained transgenic citrus plants with enhanced resistance to citrus canker. The above studies demonstrate that it is feasible to enhance the resistance of citrus to citrus canker by regulating the expression of key functional genes. It also shows that discovering new target genes that can be used for genetic improvement of disease resistance is of great significance for enriching citrus disease resistance breeding resources and expanding disease resistance improvement pathways.

[0004] Citrus sinensis phosphatidatecytidylyltransferase is an enzyme that catalyzes a key step in phospholipid synthesis. Its gene ID (LOC102629990) is located on chromosome 2 at positions 32367716–32373109. CsRBL1 The gene, whose encoding gene belongs to the conserved CDS gene family of citrus, is involved in membrane lipid remodeling and phosphate metabolism. It participates in the conversion of phosphatidic acid to CDP-diacylglycerol, thereby affecting membrane lipid metabolism and various cellular signaling processes. Previous studies have found that rice... RBL1 The gene encodes a protein with CDS activity. RBL1 Mutations can confer enhanced resistance to rice blast without reducing yield (Sha et al. 2023); CDS1 / CDS2-mediated phosphatidic acid metabolism from Arabidopsis thaliana can regulate early embryonic development by modulating auxin transport and distribution (Du et al. 2022). These studies suggest that CDS-like genes play important regulatory roles in plant growth, development, and disease resistance. However, no relevant studies have yet been found on CDS-like genes in the citrus genome. CsRBL1 No research reports on gene function have been found to utilize [genes]. CsRBL1 Research and application of gene enhancement for citrus resistance to citrus canker. Summary of the Invention

[0005] To address the aforementioned shortcomings of existing technologies, this invention provides a method for suppressing... CsRBL1 Methods to enhance resistance to citrus canker through gene expression.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: Provide an inhibition CsRBL1 A method for enhancing resistance to citrus canker through gene expression, comprising the following steps: S1: Cloning, extraction, and transcription yielded the cDNA fragment of *Citrus medica* var. *mongolica*, using primers r as shown in SEQ ID NO:2 and SEQ ID NO:3. CsRBL1 -F and r CsRBL1 -R amplification yields the result shown in SEQ ID NO:1 CsRBL1 Interference sequences; S2: Through CsRBL1 Construction of interference sequences CsRBL1 Interference carrier; S3: To be constructed CsRBL1 The interference vector was transformed into Late Jin Orange, resulting in transgenic Late Jin Orange plants resistant to citrus canker.

[0007] Furthermore, in step S2 CsRBL1The specific methods for interfering with the carrier are as follows: A1: Will CsRBL1 Interference fragments were ligated into T-cloning vectors, transformed into competent cells, and positive clones were screened. Plasmids of positive strains were extracted to obtain cells carrying the interference fragments. CsRBL1 Recombinant T-plasmid with interfering sequence T- CsRBL1 ; A2: Select Asc I and Swa Two restriction endonucleases were used to target the empty pUC-RNAi plasmid and T-RNAi plasmid, respectively. CsRBL1 The recombinant plasmid was subjected to double enzyme digestion; the linear vector fragment of the pUC-RNAi digestion product was recovered and combined with T- CsRBL1 Obtained by enzyme digestion CsRBL1 The positive interference fragment was ligated using T4 ligase to construct a positive interference sequence plasmid carrying the positive interference fragment; A3: Select Xba I and BamH Two restriction endonucleases, one for the positive interference sequence plasmid and the other for the T-... CsRBL1 The recombinant plasmid was double-digested, and the large fragment of the positive interference sequence vector and T-1 were recovered after digestion of the positive interference sequence plasmid. CsRBL1 The interfering sequence fragments after digestion of the recombinant plasmid were ligated using T4 ligase to construct pUC-RNAi- containing both forward and reverse interfering sequences. CsRBL1 Interfering plasmids; A4: Select Kpn I and Saddle Two restriction endonucleases, one for pUC-RNAi- CsRBL1 The interfering plasmid and the empty pLGNe plasmid were double-digested with enzymes, and pUC-RNAi was recovered. CsRBL1 The forward and reverse interfering sequence fragments obtained after plasmid digestion were combined with the linearized pLGNe vector fragment obtained after pLGNe plasmid digestion; these were then ligated using T4 ligase to construct the desired vector. CsRBL1 Interference carrier.

[0008] Furthermore, in step S3, CsRBL1 The specific steps for converting the interference vector into Late Orange are as follows: Will CsRBL1 The interference vector was transformed into Agrobacterium tumefaciens using the freeze-thaw method, and then Agrobacterium tumefaciens was used to mediate the transformation of the epicotyl of Citrus latifolia. The genetically transformed epicotyl cells were then subjected to in vitro culture, staining identification, grafting, PCR verification, and qRT-PCR verification to obtain transgenic plants.

[0009] Furthermore, during PCR verification, primers such as GUS-F as shown in SEQ ID NO:4 and GUS-R as shown in SEQ ID NO:5 were used.

[0010] Furthermore, the PCR amplification program is as follows: 3 min at 94℃; 32 cycles: 30 s at 94℃, 30 s at 60℃, 30 s at 72℃; 5 min at 72℃.

[0011] Furthermore, during qRT-PCR validation, the primers used were as shown in SEQ ID NO:6. CsRBL1 -F and q as shown in SEQ IDNO:7 CsRBL1 -R.

[0012] Furthermore, the qRT-PCR validation procedure was as follows: 3 min at 95℃; 40 cycles: 10 s at 94℃, 10 s at 56℃, 10 s at 72℃; 10 min at 72℃.

[0013] The beneficial effects of this invention are as follows: This invention reveals for the first time the citrus CsRBL1 The function of the gene in citrus canker resistance, and provide a method for inhibiting CsRBL1 A method to enhance citrus resistance to bacterial canker through gene expression. Transgenic citrus plants obtained using this method show a reduction in bacterial canker incidence to 34.13% of existing citrus plants, significantly alleviating canker symptoms and demonstrating a markedly enhanced resistance to the disease.

[0014] The invention disclosed CsRBL1 This gene encodes a protein with cytidine diphosphate diacylglycerol synthase activity, which participates in phospholipid biosynthesis. Existing research indicates that cytidine diphosphate diacylglycerol synthase is mainly involved in the regulation of auxin transport and distribution, while its impact on plants, particularly on the quality and performance of citrus, remains poorly understood. By suppressing the expression of this gene, resistance to citrus canker was significantly improved while minimizing adverse effects on known citrus quality and performance, thus balancing disease resistance with the stability of agronomic traits. This provides a new genetic resource and technical approach for citrus canker resistance breeding, opening up a new avenue for citrus canker resistance breeding and holding significant importance for promoting the development of citrus canker resistance breeding. Attached Figure Description

[0015] Figure 1 For the example CsRBL1 A schematic diagram of the construction process of the interference vector; Figure 2 For different plants in the examples CsRBL1 Presenting a comparison chart; Figure 3 This is a comparative study of the characterization of leaves from different plants inoculated with ulcer pathogens in the examples. Figure 4 This example compares the lesion area of ​​leaves from different plants after inoculation with ulcer pathogen. Detailed Implementation

[0016] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0017] Unless otherwise specified, all raw materials used in the embodiments of this invention are commercially available analytical grade.

[0018] The relevant sequence information is shown below: SEQ ID NO:1: GCGGGTTTCGTATTAATTGTCTACATGGGTCATCTCTATATTACTGCAATGGTGGTTGTAATCCAAATCTTTATGGCAAGAGAGTTGTTCAACCTATTGAGGAAAGCGCATGAGGAAAGGGATCTCCCTGGATTCAGGATGTTAAATTGGCATTTCTT CTTCACTGCAATGCTATTTGTATATGGCCGCATTCTCAGTCAACGGCTTGTCAATACCGTAACTTCAGACAAATTTTTATATCAGTTTGGTGAGCAGCCTTATCAAGTATCATATGGTTATTTGTTATTTCTTATATATTTCAGGTTTTGTTTGGTTCATTCT.

[0019] SEQ ID NO: 2: TAAGGTTACCGAATTGCGGGTTTCGTATTAATTGTCT.

[0020] SEQ ID NO: 3: GTCCGGTACCGGATCAGAATGAACCAAACAAAACCTGA.

[0021] SEQ ID NO: 4: CGCGTGGTTACAGTCTTGCG.

[0022] SEQ ID NO:5:ACTCGACGGCCTGTGGGCAT.

[0023] SEQ ID NO:6: TAGCCAGTATGCTTGGACGC.

[0024] SEQ ID NO:7: TGATCAACGGGGGTTCTTCCA.

[0025] SEQ ID NO:8: CATCCCTCAGCACCTTCCAGC.

[0026] SEQ ID NO:9:CCAACCTTAGCACTTCTCCATGTC.

[0027] Example Inhibiting the expression of the CsRBL1 gene in citrus includes the following specific steps: S1. Cloning, extraction, and transcription of the *Late Jin Orange* cDNA fragment: Specifically, 0.05 g of young leaves of the *Late Jin Orange* citrus variety (Chongqing Approved Citrus License No. 2011001) were used to extract total RNA from the leaves using the EASYspIn Plant RNA Rapid Extraction Kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using a Nanodrop 2000 Thermo assay. 500 ng of RNA was then used to extract the RNA using IScrIpt. TM 10 μL of cDNA was synthesized using cDNA SynthesIs KIt (Bio-Rad, Hercules, CA, USA). The cDNA was diluted 5-fold and stored at -20°C for later use.

[0028] Take the prepared cDNA and use primers as shown in SEQ ID NO: 2. CsRBL1 -F and r as shown in SEQ ID NO: 3 CsRBL1 -R amplification yields the result shown in SEQ ID NO: 1 CsRBL1 Gene interference fragments; Amplification CsRBL1 After agarose gel electrophoresis, the gene interference fragment was recovered using a BiospIn gel extraction kit (Bohr, BSC02M1). The recovered product was then ligated into a T-cloning vector using primers r. CsRBL1 -F and r CsRBL1 The ligation product obtained by -R amplification was used to amplify the corresponding fragment in bacterial culture, which was then sequenced to obtain the fragment containing... CsRBL1 T-cloning vector for interfering sequences.

[0029] The amplification system was as follows: 2×PCR mix (TaRaKa): 25 μL; primers r CsRBL1 -F and r CsRBL1 -F (100 μmol / L): 1 μL each; approximately 60 ng of cDNA; add ddH2O to 50 μL.

[0030] The PCR amplification program was as follows: 3 min at 94℃; 30 s at 94℃, 30 s at 60℃, 30 s at 72℃, for 32 cycles; extension at 72℃ for 5 min.

[0031] S2: Through CsRBL1 Construction of interference sequences CsRBL1 Interference carrier, using such as Figure 1 The process construction shown CsRBL1 The interference carrier, the specific steps are as follows: A1: Use GenElute TM The plasmid extraction kit (Sigma, PLN350) is used to prepare plasmids containing... CsRBL1 T-cloning vectors containing interference sequences were extracted to obtain... CsRBL1 Recombinant T-plasmid with interfering sequence T- CsRBL1 .

[0032] A2: Adopt Asc I and Swa I performed separate tests on the empty pUC-RNAi plasmid and T- CsRBL1 The recombinant plasmid was subjected to double enzyme digestion, and the digestion products were recovered after agarose gel electrophoresis. Among them, T- CsRBL1 Recombinant plasmid recovery CsRBL1 Interference fragments were extracted, and large fragments were recovered from the empty pUC-RNAi plasmid. The recovered products were ligated using T4-DNase, and the ligation products were transformed into E. coli DH5α and plated on LB solid medium supplemented with 50 μg / mL ampicillin. Single colonies grown on LB medium were picked and incubated overnight in LB liquid medium supplemented with 50 μg / mL ampicillin. Plasmids were extracted from the bacterial culture using a plasmid extraction kit. Asc I and Swa I. The plasmid was double-digested with enzymes, and the digestion products were subjected to agarose gel electrophoresis. The plasmid containing a 320bp band in the electrophoresis band was identified as a positive interference sequence plasmid.

[0033] A3: Adopt Xba I and BamH I respectively targeted the positive interference sequence plasmid and T- CsRBL1 The recombinant plasmid was subjected to double enzyme digestion, and the digestion products were subjected to agarose gel electrophoresis. CsRBL1 The recombinant plasmid was recovered to obtain the interfering sequence fragment, and the positive interfering sequence plasmid was recovered to obtain the large positive interfering sequence vector fragment; The interfering sequence fragment was ligated to the linearized positive interfering sequence vector fragment using the method described in A2 above. The ligation product was then used to transform *E. coli* DH5α. Plasmids were extracted from the bacterial culture and used... Xba I and BamHI enzyme digestion yielded a plasmid containing an approximately 320 bp fragment, identified as a pUC-RNAi- fragment containing both forward and reverse interference sequences. CsRBL1 Interference plasmid.

[0034] A4: Adopt Kpn I and Saddle I respectively targeted pUC-RNAi- CsRBL1 The interfering plasmid and the empty pLGNe plasmid were double-digested with enzymes. The digestion products were recovered after agarose gel electrophoresis. pUC-RNAi- CsRBL1 Interference plasmids were recovered containing bands with both forward and reverse interference sequences. Large fragments were recovered from the empty pLGNe plasmid. The two fragments were ligated according to method A2 above, and the ligation product was used to transform *E. coli* DH5α. Plasmids were extracted from the bacterial culture and used... Kpn I and Saddle Enzyme I digestion; the digestion product contains a plasmid containing interfering fragments, i.e. CsRBL1 Interference carrier.

[0035] Using freeze-thaw method CsRBL1 The interference vector was introduced into Agrobacterium strain EHA105, and the bacterial culture was stored in a low-temperature freezer at -80°C.

[0036] S3: To be constructed CsRBL1 The interference vector was transformed into Late Jin Orange, resulting in transgenic Late Jin Orange plants resistant to citrus canker. Specifically: Seeds were extracted from the fruit of the late-ripening orange and rinsed thoroughly under running water. The seeds were then soaked in 75% alcohol for 1 minute, sterilized under aseptic conditions with 0.5% sodium dichloroisocyanurate for 20 minutes, and rinsed four times with sterile water. The seed coat was removed, and the seeds were inoculated onto MS medium (PhytoTechnology Laboratories) supplemented with 30 g / L sucrose and 8 g / L agar. TM The cells were cultured in the dark at 28°C for 2 weeks on M519, followed by 1 week of culture under a 16-hour light / 8-hour dark photoperiod. Under aseptic conditions, the epicotyls of germinating seedlings were cut into 1-cm stem segments for Agrobacterium-mediated citrus genetic transformation.

[0037] Two days before conversion, the sample prepared in Example 3 containing... CsRBL1Agrobacterium bifidum culture containing the interference expression vector was spread on LB solid medium supplemented with 50 mg / L kanamycin. Single colonies of Agrobacterium bifidum were picked and inoculated into 10 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C and 220 rpm with shaking. The OD value of the bacterial culture was measured using a spectrophotometer. The culture was diluted with the above LB liquid medium to an OD value of 0.1, and cultured under the same conditions with shaking. The OD value was monitored, and when it reached 0.5, the culture was collected in a 50 mL sterile centrifuge tube, centrifuged at 5000 rpm for 15 min, the supernatant was discarded, and the culture was resuspended in liquid medium containing 50 mM 2-(N-morpholino)ethanesulfonic acid, 10 mM magnesium chloride, and 20 μM acetylsylphenol, pH 5.6. After standing for 3 h at 28°C in the dark, the culture was used for citrus genetic transformation.

[0038] Immerse approximately 1 cm segments of the hypocotyl of the late-blooming orange in Agrobacterium tumefaciens for 13 minutes, gently agitating the segments during this time. After removing the segments, blot the surface of the bacterial solution with sterile filter paper. Transfer the segments to MS solid medium supplemented with 1 mg / L N6-isopentenyladenine, 0.5 mg / L indoleacetic acid (IAA), 1 mg / L 2,4-dichlorophenoxyacetic acid, 100 μM acetylsylsyringone, 30 g / L sucrose, and 8 g / L agar. Co-culture at 26°C in the dark for 3 days.

[0039] After co-culture, the epicotyls were transferred to MS solid medium supplemented with 2 mg / L 6-benzylaminopurine (6-BA), 0.5 mg / L IAA, 50 mg / L kanamycin, 500 mg / L cephalosporin, 30 g / L sucrose and 8 g / L agar. After 7 days of dark culture at 28°C, they were transferred to a photocycle of 28°C, 16 h light / 8 h dark, and subcultured every two weeks.

[0040] Adventitious buds sprouting from wounds at both ends of the epicotyl stem segment were subjected to GUS histochemical staining using β-glucuronidase (GUS) staining solution; those that stained blue with GUS were identified as GUS-positive buds.

[0041] GUS staining solution contains the following components: 100 mM NaH2PO4, 100 mM Na2HPO4, 0.5 mM K4[Fe(CN)6], 0.5 mM K3[Fe(CN)6], 10 mM EDTA-Na2, 1 mM 5-bromo-4-chloro-3-indole-β-glucuronic acid (X-gluc), and 0.1% Triton-100.

[0042] When the stem of the GUS-positive bud is about 0.5cm long, cut it horizontally and micrograft it onto the trifoliate orange rootstock under sterile conditions. After the graft union has fully healed, cut the GUS-positive bud horizontally from the base of the trifoliate orange rootstock and graft it onto the field trifoliate orange rootstock according to the field grafting method. Keep it moist with a plastic bag for 2 weeks. Remove the plastic bag after it has taken root.

[0043] Three months after grafting GUS-positive buds into the field, 100 mg of leaves were collected, and genomic DNA was extracted using a DNA extraction kit (Adley, CAT:DN15). PCR detection of GUS gene integration was then performed. PCR reaction conditions were: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 32 cycles; 72℃ for 5 min. The detection primers were GUS-F and GUS-R, with nucleotide sequences shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. Positive plants yielded a 505 bp amplified fragment, while wild-type Late Jin Orange plants showed no corresponding amplified band. Two transgenic plants containing the amplified band were named... CsRBL1 -1 and CsRBL1 -2; Total RNA (Adelaide, CAT No: RN09) was extracted from leaves of transgenic plants. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a NanoDrop 2000 Thermo concentration meter. 500 ng of RNA was used to analyze the RNA using iScript. TM 10 μL of cDNA was synthesized using the cDNASynthesis Kit (Bio-Rad, Hercules, CA, USA), and then diluted 5-fold. Real-time quantitative PCR was then performed. CsRBL1 For gene expression level detection, primer q was used. CsRBL1 -F and q CsRBL1 -R, whose nucleotide sequences are shown in SEQ ID NO:6 and SEQ ID NO:7, respectively. Citrus was used as the internal control for quantitative PCR. Actin The gene was extracted using primers Actin-F and Actin-R, whose nucleotide sequences are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively. Reaction system: 6 μL iTaq™ Universal SYBR®, 10 μmol / L q CsRBL1 -F and q CsRBL1 Add 0.3 μL of each of the -R and 1 μL of cDNA, and then add ddH2O to a final volume of 12 μL. Reaction conditions: 95℃ for 3 min; 94℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min. The experiment was repeated three times. The results were obtained from wild-type Late Jin Orange. CsRBL1 Gene expression levels were used as controls (the expression level of control plants was considered as 1), and 2 were used.-△△Ct Methods for calculating the number of transgenic plants CsRBL1 The relative expression level.

[0044] Test results as follows Figure 2 As shown, by Figure 2 It can be seen that, CsRBL1 exist CsRBL1 -1 and CsRBL1 The expression levels in the -2 transgenic plants were 0.426±0.108 and 0.309±0.018, respectively.

[0045] Significance analysis showed that, CsRBL1 -1 and CsRBL1 -2 transgenic plants CsRBL1 The gene expression level was significantly lower than that of the control, while CsRBL1 -1 and CsRBL1 -2 transgenic plants CsRBL1 There was no significant difference in gene expression levels. Compared to control plants, transgenic plants showed higher expression levels. CsRBL1 The gene expression level was downregulated by up to 3.24 times.

[0046] Mature leaves from transgenic plants and wild-type Late Orange were selected, washed thoroughly with tap water, and then rinsed multiple times with sterile water. Excess moisture was dried from the leaf surface and the sterile culture dish. The leaves were then laid flat in the dish, with the underside facing upwards and suspended in the air. Cotton soaked in sterile water was placed over the petiole to maintain moisture. The leaves were punctured with a 0.5mm diameter needle, making the same number of holes on both sides of the midrib. 1 μL of *Cyclocarya canker* (a fungus) was inoculated into each puncture site. Xcc YN1 strain, provided by Dr. Hu Junhua of the Citrus Research Institute of Southwest University) bacterial culture (5×10 8 (CFU / mL). After acupuncture, the leaves were cultured in a light incubator at 28℃ and 85% humidity. Photos were taken 10 days after inoculation, and the lesion area was statistically analyzed using ImageJ software, with units of mm. 2 The experiment was repeated three times.

[0047] Lesion area characterization as follows Figure 3 As shown, by Figure 3 It was observed that, 10 days after in vitro inoculation with the ulcer pathogen, wild-type plants showed more severe disease. CsRBL1 Although all transgenic plants with reduced expression levels showed varying degrees of disease, the size of the lesions was significantly different from that of the wild type, which was visible to the naked eye.

[0048] The area of ​​lesions on leaves inoculated with *Pseudomonas aeruginosa* was statistically analyzed, and the results are as follows: Figure 4 As shown, by Figure 4 It can be seen that, CsRBL1 -1 and CsRBL1-2 The lesion area of ​​the transgenic plants was significantly smaller than that of the wild-type plants, including WT, CsRBL1 -1 and CsRBL1 The lesion area of ​​-2 was 2.464±0.320 mm. 2 0.946±0.138mm 2 and 0.841±0.135mm 2 ; CsRBL1 The lesion area of ​​-2 was 34.13% of the WT; therefore, it can be concluded that... CsRBL1 -1 and CsRBL1 The incidence of citrus canker in the transgenic plants was significantly lower than that in existing citrus plants.

[0049] What we can know is that CsRBL1 The lesion area of ​​the transgenic plants with suppressed expression was significantly different from that of the wild-type plants, while the differences between the transgenic plants themselves were not significant.

[0050] In summary, reducing CsRBL1 Gene expression can significantly reduce the lesion area of ​​peptic ulcers and alleviate the severity of the disease.

Claims

1. A kind of inhibition CsRBL1 A method for enhancing resistance to citrus canker through gene expression, characterized in that, Includes the following steps: S1: The cDNA fragment of Late Orange was cloned, extracted, and transcribed, and primers r as shown in SEQ ID NO:2 and SEQ ID NO:3 were used. CsRBL1 -F and r CsRBL1 -R amplification yields the result shown in SEQ ID NO:1 CsRBL1 Interference sequences; S2: Through CsRBL1 The interfering sequence was constructed using a double restriction endonuclease digestion and ligation method. CsRBL1 Interference carrier; S3: To be constructed CsRBL1 The interference vector was transformed into Late Jin Orange, resulting in transgenic Late Jin Orange plants resistant to citrus canker.

2. The method according to claim 1, characterized in that, In step S2 CsRBL1 The specific methods for interfering with the carrier are as follows: A1: Will CsRBL1 Interference fragments were ligated into T-cloning vectors, transformed into competent cells, and positive clones were screened. Plasmids of positive strains were extracted to obtain cells carrying the interference fragments. CsRBL1 Recombinant T-plasmid with interfering sequence T- CsRBL1 ; A2: Select Asc I and Swa Two restriction endonucleases were used to target the empty pUC-RNAi plasmid and T-RNAi plasmid, respectively. CsRBL1 The recombinant plasmid was subjected to double enzyme digestion; the linear vector fragment of the pUC-RNAi digestion product was recovered and combined with T- CsRBL1 Obtained by enzyme digestion CsRBL1 The positive interference fragment was ligated using T4 ligase to construct a positive interference sequence plasmid carrying the positive interference fragment; A3: Select Xba I and BamH Two restriction endonucleases, one for the positive interference sequence plasmid and the other for the T-... CsRBL1 The recombinant plasmid was double-digested, and the large fragment of the positive interference sequence vector and T-1 were recovered after digestion of the positive interference sequence plasmid. CsRBL1 The interfering sequence fragments after digestion of the recombinant plasmid were ligated using T4 ligase to construct pUC-RNAi- containing both forward and reverse interfering sequences. CsRBL1 Interfering plasmids; A4: Select Kpn I and Sal Two restriction endonucleases, one for pUC-RNAi- CsRBL1 The interfering plasmid and the empty pLGNe plasmid were double-digested with enzymes, and pUC-RNAi was recovered. CsRBL1 The forward and reverse interference sequence fragments after digestion of the interference plasmid and the linearized pLGNe vector fragment obtained after digestion of the pLGNe plasmid. The structure was obtained by ligation with T4 ligase. CsRBL1 Interference carrier.

3. The method according to claim 1, characterized in that, In step S3 CsRBL1 The specific steps for converting the interference vector into Late Orange are as follows: Will CsRBL1 The interference vector was transformed into Agrobacterium tumefaciens using the freeze-thaw method, and then Agrobacterium tumefaciens was used to mediate the transformation of the epicotyl of Citrus latifolia. The genetically transformed epicotyl cells were then subjected to in vitro culture, staining identification, grafting, PCR verification, and qRT-PCR verification to obtain transgenic plants.

4. The method according to claim 3, characterized in that, For PCR verification, primers such as GUS-F as shown in SEQ ID NO:4 and GUS-R as shown in SEQ ID NO:5 were used.

5. The method according to claim 4, characterized in that, The PCR amplification program was as follows: 3 min at 94℃; 32 cycles: 30 s at 94℃, 30 s at 60℃, 30 s at 72℃; 5 min at 72℃.

6. The method according to claim 5, characterized in that, For qRT-PCR validation, the primers used are as shown in SEQ ID NO:

6. CsRBL1 -F and q as shown in SEQ ID NO:7 CsRBL1 -R.

7. The method according to claim 6, characterized in that, The qRT-PCR validation program was as follows: 3 min at 95℃; 40 cycles: 10 s at 94℃, 10 s at 56℃, 10 s at 72℃; 10 min at 72℃.

Images