Primers and probes, primer-probe combinations, primer-probe premixes, kits, and applications for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA.

Abstract

This invention relates to the field of biotechnology, and in particular to a primer probe, primer probe combination, primer probe premix, kit, and application for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA. The sequences of the primer probes for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA are shown in SEQ ID Nos. 4-13. The detection kit of this invention simultaneously detects Mycoplasma pneumoniae and the drug resistance sites A2063G, A2064G, A2067G, and C2617G. This kit has advantages such as high detection sensitivity, strong specificity, good repeatability, low requirements for equipment, simple operation, and short detection time. It is suitable for the detection of Mycoplasma pneumoniae and its drug resistance sites, and has significant application value for clinical diagnosis and treatment.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer probe, primer probe combination, primer probe premix, kit, and application for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA. Background Technology

[0002] Mycoplasma pneumoniae (MP) is a major pathogen causing respiratory infections in humans, accounting for 10%-30% of community-acquired pneumonia (CAP) cases. Clinically, treatment primarily relies on macrolide antibiotics (such as azithromycin and erythromycin). However, with the widespread use of these drugs in recent years, the resistance rate of MP has been rising annually, exceeding 90% in some areas, easily leading to refractory pneumonia (RMP) or severe pneumonia. This is especially true in children, often causing severe pneumonia and threatening their lives. Studies have found that the resistance rate of Mycoplasma pneumoniae in children in Beijing and Shanghai is particularly high, reaching 80-90%, while in Zhejiang it is around 50%. Furthermore, research indicates that the main mechanism of MP resistance to macrolide drugs is a target site single nucleotide polymorphism (SNP) mutation in its 23S rRNA gene, leading to a decreased affinity of the antibiotic for the ribosome. Currently known core mutation sites are highly concentrated in the V region of the 23S rRNA domain, with positions 2063 and 2064 being the most common, accounting for approximately 70-90%, while new mutations such as those at position 2067 are also increasing.

[0003] Currently, routine detection methods for mycoplasma pneumoniae (MP) resistance include drug susceptibility testing (AST) and first-generation sequencing. However, the former has a long culture period of several weeks, and the latter is cumbersome and relies on specialized sequencing platforms, neither of which can meet the needs of early and rapid clinical diagnosis. In recent years, molecular detection technologies based on quantitative real-time PCR have gradually become more widespread. However, when faced with the three highly adjacent (high-density continuous) SNP sites 2063, 2064, and 2067 in the 23S rRNA V region of Mycoplasma pneumoniae, existing technologies have revealed serious technical shortcomings: (1) ARMS-PCR (amplification blocking mutation system) suffers from severe steric hindrance: This technique relies on the precise matching of the 3' end of the primer with the mutation site. Since the interval between the 2063, 2064, and 2067 sites is extremely short (only 0-2 bases), if they are detected in the same reaction tube, there will be severe physical overlap and steric hindrance between the primers, which will easily form primer dimers, resulting in nonspecific amplification (false positive) and a sharp drop in the sensitivity of multiplex detection.

[0004] (2) Traditional TaqMan probe methods lack single-base discrimination and are prone to fluorescence crosstalk: The length of traditional TaqMan probes is usually 20-30 bp. The change of a single base has a negligible effect on the melting temperature (Tm value) of the entire long probe (usually <2℃). When the above three consecutive mutation sites are concentrated within the coverage of a single probe, the probe cannot accurately distinguish the specific mutation type; if long probes are designed for each mutation site separately, it will cause serious competition for binding sites and fluorescence signal crosstalk.

[0005] (3) LNA (locked nucleic acid) modification technology is complex to design and has poor robustness: Although LNA can improve single base resolution, the selection of modification sites is extremely strict when facing dense SNP clusters. Too much modification will lead to non-specific binding, while too little modification will result in insufficient discrimination; moreover, LNA probes lack compatibility with complex combined mutations, making the kit extremely sensitive to reaction conditions, which makes it difficult to promote on a large scale in clinical practice.

[0006] (4) The probe melting curve method (FMCA / HRM) has drawbacks such as ambiguous typing, low sensitivity to heterogeneous samples, and long processing time: The melting curve method relies on the heating and melting process after amplification to distinguish mutations. However, since mutation sites such as 2063 and 2064 are highly adjacent and both involve A to G base substitution, the changes in probe Tm values ​​caused by mutations at different sites are extremely small, often resulting in severe overlap of melting peaks, making accurate mutation typing impossible. More seriously, clinical samples often contain mixed infections of wild-type and mutant types (heterogeneity). In melting curve analysis, high concentrations of wild-type amplification products will produce huge background signal peaks, directly masking the weak signal peaks of low-abundance mutants, leading to serious missed detection of low proportions of drug-resistant strains. In addition, this method requires an additional long and slow heating procedure after PCR amplification, and has stringent requirements for the temperature control accuracy of the instrument, making it difficult to meet the needs of rapid and universal clinical testing.

[0007] In summary, how to overcome the physical interference between continuous sites in a simple and rapid reaction system to achieve accurate identification and typing of high-density continuous SNP sites is a technical challenge that urgently needs to be solved in the field of Mycoplasma pneumoniae drug resistance detection. Summary of the Invention

[0008] To address the shortcomings of existing technologies in detecting consecutive drug-resistant mutation sites (2063, 2064, 2067) in Mycoplasma pneumoniae 23S rRNA, such as large steric hindrance of ARMS-PCR primers, weak single-base discrimination power of traditional TaqMan probes, and poor robustness of LNA modification, this invention provides primers and probes, primer-probe combinations, primer-probe premixes, kits, and applications for detecting drug-resistant mutant genes in Mycoplasma pneumoniae 23S rRNA. By utilizing short probes of specific lengths combined with minor groove binders (MGB) modification and a special high-annealing temperature amplification program, it is possible to accurately and rapidly distinguish between wild-type and multiple mutant types.

[0009] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a primer probe for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA, including Mp 2063-2067 -Univ-F、Mp 2063-2067 -Univ-R、Mp A2063G -P、Mp A2064G -P、Mp A2067G -P、Mp 2617 -Univ-F、Mp 2617 -Univ-R、Mp 2617G -P Wild-type Blocking Probe, wherein the wild-type blocking probe is Blocker-WT 2063-2067 and Blocker-WT 2617 ; The Mp 2063-2067 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 4; The Mp 2063-2067 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 5; The Mp A2063G The nucleotide sequence of -P is shown in SEQ ID No. 6; The Mp A2064G The nucleotide sequence of -P is shown in SEQ ID No. 7; The Mp A2067G The nucleotide sequence of -P is shown in SEQ ID No. 8; The Mp 2617 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 9; The Mp 2617 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 10; The Mp 2617G The nucleotide sequence of -P is shown in SEQ ID No. 11; The Blocker-WT 2063-2067 The nucleotide sequence is shown in SEQ ID No. 12; The Blocker-WT 2617 The nucleotide sequence is shown in SEQ ID No. 13.

[0010] Preferably, the mutation sites of the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene are A2063G, A2064G, A2067G and C2617G.

[0011] Preferably, the Mp A2063G -P、Mp A2064G -P、Mp A2067G -P and Mp 2617G -P is marked with FAM, ROX or HEX at the 5' end and MGB at the 3' end; The Blocker-WT 2063-2067 and Blocker-WT 2617 The 3' end of the C3 Spacer is modified.

[0012] This invention also provides a primer-probe combination for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, including the primer-probes described in the above technical solution, primer-probes targeting the universal detection gene of Mycoplasma pneumoniae, and primer-probes targeting the internal standard gene RNase-P. The primers and probes targeting the universal detection gene for Mycoplasma pneumoniae include MP-F, MP-R, and MP-P; The nucleotide sequence of the MP-F is shown in SEQ ID No. 1; The nucleotide sequence of the MP-R is shown in SEQ ID No. 2; The nucleotide sequence of the MP-P is shown in SEQ ID No. 3; The primers and probes targeting the internal standard gene RNase-P include RNase PF, RNase PR, and RNase PP; The nucleotide sequence of the RNase PF is shown in SEQ ID No. 14; The nucleotide sequence of the RNase PR is shown in SEQ ID No. 15; The nucleotide sequence of the RNase PP is shown in SEQ ID No. 16.

[0013] Preferably, the 5' end of the MP-P and RNase PP is labeled with FAM, ROX or HEX, and the 3' end is labeled with MGB.

[0014] The present invention also provides a primer and probe premix for detecting Mycoplasma pneumoniae and Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, characterized in that it includes the primers and probes described in the above technical solution and the primer and probe combination described in the above technical solution.

[0015] Preferably, the final concentration of primers in the primer-probe premix is ​​0.1-0.4 μM, and the final concentration of probes other than the wild-type blocking probe is 0.1-0.3 μM. The Blocker-WT... 2063-2067 and Blocker-WT 2617 The final concentration is 0.2~1.5 μM.

[0016] This invention also provides a kit for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, comprising the primer and probe premix, PCR reaction solution, positive control and negative control as described in the above technical solution.

[0017] Preferably, the positive control is a mixed plasmid containing sequences SEQ ID No. 17~21 and SEQ ID No. 24; The negative control is a plasmid containing the sequence SEQ ID No. 24.

[0018] This invention also provides the application of the primers and probes described in the above-mentioned technical solutions, the primer and probe combinations described in the above-mentioned technical solutions, the primer and probe premixes described in the above-mentioned technical solutions, or the kits described in the above-mentioned technical solutions in the preparation of products for detecting Mycoplasma pneumoniae and Mycoplasma pneumoniae 23S rRNA drug resistance mutation genes.

[0019] The beneficial effects of this invention are: (1) Extremely high recognition accuracy and steric hindrance avoidance of single bases: This invention employs an extremely short 14-17 bp MGB-modified probe, which not only significantly reduces the probe binding footprint and completely resolves the physical overlap and multiple amplification interference between consecutive mutation sites at 2063, 2064, and 2067, but also causes a sharp drop in the Tm value of single-base mismatch and a jump in the Tm value of matching, resulting in a significant ∆Tm difference. Furthermore, this invention innovatively introduces a blocking probe that preferentially and specifically binds to and blocks the wild-type template during amplification, completely blocking non-specific signals in the wild-type background at the physical level. Simultaneously, the Tm value of the blocking probe on the mutant template is significantly lower than the reaction annealing temperature, thereby ensuring efficient release and amplification of the mutant template and endowing this invention with extremely high single-base recognition accuracy.

[0020] (2) Precise single-tube typing and excellent detection sensitivity: This invention enables simultaneous identification and drug-resistant mutation typing of Mycoplasma pneumoniae (MP) within a single reaction tube, completely overcoming the limitations of traditional melting curve methods, which are easily masked by wild-type background and suffer from ambiguous typing in heterogeneous samples. Experimental data show that this invention has extremely high analytical sensitivity: the limits of detection for both Mycoplasma pneumoniae (MP) and drug-resistant mutants are less than 1000 copies / mL. More significantly, in heterogeneous mixed infection samples, this invention achieves a detection rate as low as 0.1% for the proportion of drug-resistant mutations, enabling very early and accurate interception of low-abundance drug-resistant mutations, fully meeting the clinical needs for accurate diagnosis of complex and refractory pneumonia. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0022] Figure 1 Schematic diagram of Mycoplasma pneumoniae drug resistance gene detection Figure 2 This is a specific detection result for Mycoplasma pneumoniae 23 rRNA A2063G; Figure 3 This is a specific detection result for Mycoplasma pneumoniae 23 rRNA A2064G; Figure 4 This is a specific detection result for Mycoplasma pneumoniae 23 rRNA A2067G; Figure 5 This is a specific detection result for Mycoplasma pneumoniae 23 rRNA A2617G. Figure 6 Results of the general standard curve for Mycoplasma pneumoniae; Figure 7 Results of the standard curve for Mycoplasma pneumoniae 23 rRNA A2063G; Figure 8 Results of the standard curve for Mycoplasma pneumoniae 23 rRNA A2064G; Figure 9 Results of the standard curve for Mycoplasma pneumoniae 23 rRNA A2067G; Figure 10 The results of the standard curve for Mycoplasma pneumoniae 23 rRNA A2617G; Figure 11 95% LOD results for detection of universal and drug-resistant Mycoplasma pneumoniae strains; Figure 12 The results are from a heterogeneous drug resistance test (A2064G). Figure 13 Amplification curves for clinical samples (representative samples). Detailed Implementation

[0023] This invention provides a primer probe for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA, including Mp 2063-2067 -Univ-F、Mp 2063-2067 -Univ-R、Mp A2063G -P、Mp A2064G -P、Mp A2067G -P、Mp 2617 -Univ-F、Mp 2617 -Univ-R、Mp 2617G -P and wild-type blocking probe, wherein the wild-type blocking probe is Blocker-WT 2063-2067 and Blocker-WT 2617 ; The Mp 2063-2067 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 4; the Mp 2063-2067 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 5; the Mp A2063G The nucleotide sequence of -P is shown in SEQ ID No. 6; the Mp A2064G The nucleotide sequence of -P is shown in SEQ ID No. 7; The Mp A2067G The nucleotide sequence of -P is shown in SEQ ID No. 8; the Mp 2617 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 9; the Mp 2617 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 10; the Mp 2617G The nucleotide sequence of -P is shown in SEQ ID No. 11; the Blocker-WT 2063-2067 The nucleotide sequence is shown in SEQ ID No. 12; the Blocker-WT 2617 The nucleotide sequence is shown in SEQ ID No. 13; Blocker-WT 2063-2067 and Blocker-WT 2617 It is a wild-type closed probe.

[0024] In this invention, the mutation sites of the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene (V region) are preferably A2063G, A2064G, A2067G, and C2617G. In this invention, the Mp... A2063G -P、Mp A2064G -P、Mp A2067G -P and Mp 2617GThe 5' end of -P is preferably labeled FAM, ROX, or HEX, and the 3' end is preferably labeled MGB. In this invention, the Blocker-WT 2063-2067 and Blocker-WT 2617 The 3' end of the C3 Spacer is preferably modified.

[0025] This invention also provides a primer-probe combination for detecting Mycoplasma pneumoniae and its 23S rRNA drug resistance mutation gene, comprising the primer-probes described in the above technical solution, primer-probes targeting the Mycoplasma pneumoniae P1 gene, and primer-probes targeting the internal control gene RNase-P; the primer-probes targeting the Mycoplasma pneumoniae P1 gene include MP-F, MP-R, and MP-P; the nucleotide sequence of MP-F is shown in SEQ ID No. 1; the nucleotide sequence of MP-R is shown in SEQ ID No. 2; the nucleotide sequence of MP-P is shown in SEQ ID No. 3; the primer-probes targeting the internal control gene RNase-P include RNase PF, RNase PR, and RNase PP; the nucleotide sequence of RNase PF is shown in SEQ ID No. 14; the nucleotide sequence of RNase PR is shown in SEQ ID No. 15; and the nucleotide sequence of RNase PP is shown in SEQ ID No. 16. In this invention, the 5' end of the MP-P and RNase PP is preferably labeled with FAM, ROX or HEX, and the 3' end is preferably labeled with MGB.

[0026] Table 1. Primer and probe sequence information for Mycoplasma pneumoniae

[0027] Note: The underscore "_" indicates a mutation site.

[0028] This invention also provides a primer-probe premix for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, comprising the primers and probes described in the above-mentioned technical solutions, and the primer-probe combination described in the above-mentioned technical solutions. In this invention, the final concentration of the primers in the primer-probe premix is ​​preferably 0.1-0.4 μM, and the final concentration of probes other than the wild-type blocking probe is preferably 0.1-0.3 μM. The Blocker-WT... 2063-2067 and Blocker-WT 2617 The final concentration is preferably 0.2~1.5 μM.

[0029] This invention also provides a kit for detecting Mycoplasma pneumoniae and its 23S rRNA drug resistance mutation gene, comprising the primer and probe premix, PCR reaction solution, positive control, and negative control as described in the above technical solution. In this invention, the positive control is preferably a mixed plasmid containing sequences SEQ ID No. 17-21 and SEQ ID No. 24; the negative control is preferably a plasmid containing sequence SEQ ID No. 24.

[0030] SEQ ID No. 17: MP universal detection target: Attttggtagaagctattttatttccacttcagaaacacccacagcagctattcgcttctttggtagctggttacgggaatatgtaccagagcaccccagaagggcttacttatatgaaattcgtgccgaccaacacttttacaatgcccgcgccactggggagaacttgttagatttaatgcgtcaaagacaa gtagtatttgactctggtgatcgagaaatggcacaaatgggaattagagctttacgcacttcctttgcgtatcaacgtgaatggtttaccgatggtc caattgcagcagctaatgtccgtagtgcttgactagtagatgctgttcccgttgaacctggtcatgctcaccacccggctggtcgtgttgtagaga.

[0031] SEQ ID No. 18: Mp-A2063G: CCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGG2063A2064AGA2067CCCCG TGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACTACCCTTGGTTGTGTGCTGTTCTAATTGGTAACTGTTATCCAGTTTCA.

[0032] SEQ ID No.19:Mp-A2064G: CCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGA2063G2064AGA2067CCCCGTGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACTACCCTTGGTTGTGTGCTGTTCTAATTGGTAACTGTTATCCAGTTTCA。

[0033] SEQ ID No.20:Mp-A2067G: CCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGA2063A2064AGG2067CCCCGTGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACTACCCTTGGTTGTGTGCTGTTCTAATTGGTAACTGTTATCCAGTTTCA。

[0034] SEQ ID No.21:Mp-C2617G: TCATATCGACGGCAGTGTTTGGCACCTCGATGTCGACTCATCTCATCCTCGAGCTGAAGCAGGTTCGAAGGGTTCGGCTGTTCGCCGATTAAAGAGATACGTGAGTTGGGTTCAAACCGTCGTGAGACAGGTTGGTCG2617CTATCTATTGTGCCCGTAGGAAGATTGAAGAGTGTTGCTTCTAGTACGAGAGGACCGAAGCGAGGACACCTCTTATGCTCCAGTTGTAGCGCCAGCTGCACCGCTGGGTAGTAACGTGTCTATTAGATAAACGCTGAAAGCATCTAAGTGTGAAACTATCTC。

[0035] SEQ ID No.22:Mp-WT(2063-2067): CCTAAGGTAGCGAAATTCCTAGTCGGGTAAATTCCGTCCCGCTTGAATGGTGTAACCATCTCTTGACTGTCTCGGCTATAGACTCGGTGAAATCCAGGTACGGGTGAAGACACCCGTTAGGCGCAACGGGACGGA2063A2064AGA2067CCCCGTGAAGCTTTACTGTAGCTTAATATTGATCAGGACATTATCATGTAGAGAATAGGTAGGAGCAATCGATGCAAGTTCGCTAGGACTTGTTGATGCGAAAGGTGGAATACTACCCTTGGTTGTGTGCTGTTCTAATTGGTAACTGTTATCCAGTTTCA。

[0036] SEQ ID No.23:Mp-WT(2617): TCATATCGACGGCAGTGTTTGGCACCTCGATGTCGACTCATCTCATCCTCGAGCTGAAGCAGGTTCGAAGGGTTTCGGCTGTTCGCCGATTAAAGAGATACGTGAGTTGGGTTCAAACCGTCGTGAGACAGGTTGGTCC2617CTATCTATTG TGCCCGTAGGAAGATTGAAGAGTGTTGCTTCTAGTACGAGAGGACCGAAGCGAGGACACCTCTTATGCTCCAGTTGTAGCGCCAGCTGCACCGCTGGGTAGTAACGTGTCTATTAGATAAACGCTGAAAGCATCTAAGTGTGAAACTATCTC.

[0037] SEQ ID No. 24: RNase-P: ATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTTCAC AACTTTGCCAATTGTACAGGGAAATCAAGACCAATTAAAATTTTAACTAGATTAACAATTATTGTCTCGGATCCATCTCACTGCAATGTTTTGAGAGCAACTTCTTCAAGGGCCCGGCTCTATGATGTTGTTGCAGTTTTTCCAAAGACAGAAAAGCTTTTTCATATTGCTTGCACACATTTAGATG.

[0038] In this invention, the method for rapid detection of Mycoplasma pneumoniae and drug resistance genes using the kit is as follows: 1. The sample type is sputum, swab, or bronchoalveolar lavage fluid; 2. Sample DNA extraction: DNA was extracted using the Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0) and the Tianlong Automatic Nucleic Acid Extractor. 3. Using the DNA from step 2 as a template, perform multiplex fluorescent PCR detection; 4. The test results are interpreted as follows: This invention's kit includes a positive control and a negative control. A negative control and a positive control must be established for each sample test; these two controls play a crucial role in the interpretation of results. The following quality control conditions must be met: (1) Negative control: The HEX channel has a clear amplification curve and the Ct value is ≤38, while other channels have no amplification curve; (2) Positive control samples: The FAM and ROX detection channels both showed obvious amplification curves, and the Ct value was ≤38; the HEX channel may or may not have an amplification curve; All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0039] (3) Result interpretation: Based on the quality control conditions of (1) and (2), the results are interpreted according to the following table.

[0040] Table 2 Result Judgment

[0041] Note: When the target gene detection channel (FAM / ROX) is positive, the HEX channel (internal standard channel) result may be negative due to the competition between the systems.

[0042] This invention also provides the application of the primers and probes described in the above-mentioned technical solutions, the primer and probe combinations described in the above-mentioned technical solutions, the primer and probe premixes described in the above-mentioned technical solutions, or the kits described in the above-mentioned technical solutions in the preparation of products for detecting Mycoplasma pneumoniae and Mycoplasma pneumoniae 23S rRNA drug resistance mutation genes.

[0043] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] Establishment of a detection method for Mycoplasma pneumoniae and 23S rRNA drug resistance mutation genes. 1. Primer and probe design (1) Download the reference sequence containing the standard strain of Mycoplasma pneumoniae from the NCBI (National Center for Biotechnology Information) website; (2) Alignment of nucleotide sequences was performed using Mega 6 software, and primers and probes were designed using Primer Select software. (3) Primer and probe BLAST evaluation: The nucleotide sequences of the primers and probes that have been initially designed are compared again using the BLAST search function on the NCBI website, and primers and probe sequences with high specificity are selected. (4) Design universal primers and specific probes targeting A2063G, A2064G, A2067G and C2617G.

[0046] The nucleotide sequences of the primers and probes are shown in Table 1: Table 1. Primer and probe sequence information for Mycoplasma pneumoniae

[0047] Note: The underscore "_" indicates a mutation site.

[0048] 2. Construction of Standard Products The universal detection sequence for Mycoplasma pneumoniae (SEQ ID No:17), the 23S rRNA gene sequences for Mycoplasma pneumoniae (SEQ ID No:18-SEQ ID No:23) were ligated into the pUC57 vector to construct a positive control containing the universal detection target for Mycoplasma pneumoniae, the 23S rRNA genes A2063G, A2064G, A2067G, and C2617G, and an internal control gene (RNase-P) plasmid. The sequence information is shown in SEQ ID No:24. The above were processed at a ratio of 1×10⁻⁶. 4 The plasmid was composed of equal volumes of copies / mL; the internal standard gene sequence SEQ ID No:24 was ligated into the pUC57 vector to construct the negative control. The copy number of the plasmid was calculated based on the plasmid length and concentration using the following formula:

[0049] Wild-type and mutant plasmids containing the target gene locus were constructed, quantitatively analyzed, and then diluted tenfold using a serial dilution method. 1 ~10 6 Copies / mL were used as standards. Multiplex PCR reactions were performed using the standards, and a standard curve was plotted.

[0050] 3. Optimization of primer and probe concentrations To obtain optimal amplification efficiency and mutation detection specificity, the concentrations of primers, probes, and blockers in the multiplex PCR system were optimized using a matrix method (orthogonal experiment). The primer and probe concentration matrix is ​​as follows: The final concentrations of the primers were set to 0.1µM, 0.2µM, 0.3µM, and 0.4µM, respectively; the final concentrations of the probes other than the wild-type blocking probe were set to 0.1µM, 0.2µM, 0.25µM, and 0.3µM, respectively.

[0051] (1) Optimization of universal primers and probe concentrations for Mycoplasma pneumoniae Use 10 4Using a wild-type Mycoplasma pneumoniae standard at a concentration of copies / µL as a template, the matrix concentrations of universal primers (MP-F / R, SEQ ID No. 1-2) and universal probes (MP-P, SEQ ID No. 3) were optimized, and the detection was repeated three times. The Ct values ​​of the FAM channel were detected, and the results are shown in Table 6.

[0052] (2) Optimization of drug resistance mutation primer and probe concentrations (represented by MpA2063G-P) Since the 23S rRNA A2063G mutation is the most common in clinical practice, this experiment used it as a representative to optimize the concentration of the mutation system. Using 10... 4 Using copies / μL of the A2063G mutant standard as a template, the matrix concentrations of the mutant primers (Mp2063-2067-Univ-F / R, SEQ ID No. 4-5) and the mutant probe (MpA2063G-P, SEQ ID No. 6) were optimized. The Ct values ​​of the ROX channel were detected, and the results are shown in Table 7.

[0053] Blocker concentration optimization: Based on the determination of optimal primer and probe concentrations, the final concentrations of wild-type blocking probes (Blocker-WT2063-2067 and Blocker-WT2617) were set to 0.2 μM, 0.5 μM, 1.0 μM, and 1.5 μM, respectively, targeting drug-resistant mutation sites. (The text abruptly ends here, so the translation stops as well.) 4 Using wild-type and mutant plasmids (copies / μL) as templates, the inhibitory effect of Blocker on wild-type plasmids and its impact on mutant amplification were evaluated. The results are shown in Table 8.

[0054] Evaluation criteria: The optimal concentration combination is selected based on early peak onset of the amplification curve (lowest Ct value), strong fluorescence signal (maximum ΔRn), and no nonspecific peak on the negative control / wild-type template (Ct>40 or no Ct).

[0055] Table 6. Optimization results of the universal primer and probe (MP-P) concentration matrix for Mycoplasma pneumoniae (FAM channel Ct values)

[0056] *Note: Considering both amplification efficiency and reagent cost, select the concentration combinations marked with an asterisk.

[0057] Table 7. Optimization results of the concentration matrix of drug resistance mutation primers and probes (MpA2063G-P) (ROX channel Ct values)

[0058] *Note: Considering both amplification efficiency and reagent cost, select the concentration combinations marked with an asterisk.

[0059] Table 8. Optimization results of Blocker-WT2063-2067 concentration (template concentration 10) 4 copies / μL)

[0060] Primer and probe concentration analysis: As shown in Tables 6 and 7, the Ct value gradually decreased and the fluorescence signal increased with increasing primer and probe concentrations. When the primer concentration reached 0.3 µM and the probe concentration reached 0.2 µM, the Ct value basically reached a plateau. Further increasing the concentration did not significantly contribute to improving amplification efficiency, and excessively high probe concentrations led to increased background fluorescence. Therefore, the optimal primer concentration for universal detection and mutation detection of Mycoplasma pneumoniae was determined to be 0.3 µM, and the optimal probe concentration was determined to be 0.2 µM. Since the internal standard (RNase P) was only used for quality control, its primer and probe concentrations were lowered to 0.2 µM and 0.1 µM, respectively, to avoid competition with the target gene for amplification resources.

[0061] Blocker Concentration Analysis: As shown in Table 8, without the addition of a blocker, the mutation detection probe (ROX channel) exhibited significant non-specific binding to the wild-type template (CT=28.45-29.56), easily leading to false positives. With increasing blocker concentration, non-specific amplification of the wild-type template in the ROX channel was significantly inhibited. When the blocker concentration reached 1.0 µM, the wild-type template showed no amplification (no Ct value), and the amplification efficiency of the mutant template (Ct=27.06-27.46) was not significantly affected. When the blocker concentration was further increased to 1.5 µM and above, although it completely inhibited the wild-type, it also began to competitively inhibit the amplification of the mutant template, resulting in a significant delay in the mutant Ct value. Therefore, the optimal blocker concentration was determined to be 1.0 µM.

[0062] (3) The final determined concentration of the reaction system After the above optimization, the final concentrations of each primer and probe in the multiplex PCR reaction system are shown in Table 9: Table 9. Final Concentrations of Primers and Probes for the Multiplex PCR System

[0063] 4. Performance validation: Validate the specificity, sensitivity, accuracy, and repeatability of this kit, and test clinical samples after method validation.

[0064] Example 2

[0065] Preparation and Usage of Mycoplasma pneumoniae and 23S rRNA Drug Resistance Mutation Gene Detection Kit 1. Composition of the kit of the present invention: The kit of the present invention consists of PCR reaction solution, primer and probe premix solution, positive control, and negative control. Specifically, it includes the following: (1) Primer probe premix: It consists of primer sequences for detecting Mycoplasma pneumoniae and 23S rRNA drug resistance mutant genes and primer sequences for detecting internal standard genes, as described above in SEQ ID No:1-SEQ ID No:16.

[0066] The optimal primer-probe concentration ratio is shown in Example 1. The primer-probe premix was prepared by mixing according to the proportions shown in Table 9 of Examples.

[0067] (2) The PCR reaction solution can be of a composition known to those skilled in the art. The composition recommended in this invention is: 2X Pro TaqHS Probe Premix, purchased from Hunan Aikerui Biotechnology Co., Ltd., catalog number: AG11704).

[0068] (3) Positive control samples: Universal detection plasmid for Mycoplasma pneumoniae, sequence information as shown in SEQ ID No:17; mutant plasmids of Mycoplasma pneumoniae 23S rRNA 2063, 2064, 2067 and 2617, sequence information as shown in SEQ ID No:18-SEQ ID No:21; internal control gene (RNase-P) plasmid, sequence information as shown in SEQ ID No:24, the above in a 1×10⁻⁶ ratio. 4 Composition is formed by mixing equal volumes of copies / mL.

[0069] (4) Negative control: Composed of an internal control gene (RNase-P) plasmid, with sequence information such as SEQ ID NO:24.

[0070] 2. How to use the reagent kit of this invention: (1) DNA extraction from the sample to be tested DNA was extracted using the Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0) and the Tianlong Automated Nucleic Acid Extractor. (2) Multiplex PCR amplification Using the DNA from step 2 as a template, the above extract was amplified using a kit.

[0071] Reaction system (25 μL): PCR reaction solution (2X Pro Taq HS Probe Premix): 12.5 μL, primer and probe premix solution: 7.5 μL, template: 5 μL.

[0072] Reaction program: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s, for a total of 40 cycles.

[0073] (3) Result interpretation This invention's kit includes a positive control and a negative control. A negative control and a positive control must be established for each sample test; these two controls play a crucial role in the interpretation of results. The following quality control conditions must be met: 1) Negative control: The HEX channel showed a clear amplification curve with a Ct value ≤ 38, while other channels showed no amplification curve; 2) Positive control samples: Both FAM and ROX detection channels showed obvious amplification curves, and the Ct value was ≤38; the HEX channel may or may not have an amplification curve. All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0074] 30. Result Interpretation: Based on the quality control conditions of 1) and 2), the results shall be interpreted according to the following table.

[0075] Table 2 Result Judgment

[0076] Note: When the target gene detection channel (FAM / ROX) is positive, the HEX channel (internal standard channel) result may be negative due to the competition between the systems.

[0077] Example 3

[0078] Reagent kit detection performance validation 1. Specificity verification Two methods were used for specificity verification: (1) verification of cross-pathogens; and (2) specificity verification of drug resistance mutation sites. (1) Verification of cross-pathogens Clinical samples of wild-type Mycoplasma pneumoniae, mutant Mycoplasma pneumoniae, Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis (MRSE), Corynebacterium diphtheriae, Haemophilus influenzae, Streptococcus pneumoniae, Escherichia coli, and Candida albicans were collected. The samples were tested according to the kit usage method described in Example 2.

[0079] The results showed that the detection method of the present invention was positive for Mycoplasma pneumoniae positive samples. If the sample contained wild-type Mycoplasma pneumoniae, no amplification curve was observed, indicating a negative result. If the sample contained mutant Mycoplasma pneumoniae, an amplification curve was observed, indicating a positive result. Furthermore, the detection method showed no cross-reactivity with samples infected by pathogens such as Staphylococcus aureus, methicillin-resistant Staphylococcus epidermidis (MRSE), Corynebacterium diphtheriae, Haemophilus influenzae, Streptococcus pneumoniae, Escherichia coli, and Candida albicans, indicating high specificity. Specific results are shown in Table 3. Table 3 Results of cross-reactivity experiments

[0080] Note: NA indicates no amplification curve or undetected CT value. (2) Verification of drug-resistant mutant genes To verify the physical suppression effect of the combination of the blocking probe and the MGB short probe on the wild-type background in this invention, this kit was used to detect high concentrations (1×10⁻⁶) of the wild-type background. 6 Wild-type and mutant plasmid DNA (copies / mL) were amplified. This experiment aimed to verify whether the system could accurately amplify only the mutant template without producing false positives under interference from extremely high concentrations of wild-type template. Each reaction was repeated three times, and the results were as follows: Figures 2-5 As shown.

[0081] The results showed that: at a height of 1×10 6 At a template loading of copies / mL, only templates containing the A2063G, A2064G, A2067G, and C2617 mutation sites produced specific amplification curves, while the corresponding high-concentration wild-type templates were completely blocked, with no non-specific amplification curves generated. This result strongly confirms that the detection system of this invention can achieve precise identification at the single-base level, accurately detect core drug resistance mutation sites on 23S rRNA, and achieve zero cross-reactivity with high-concentration wild-type templates.

[0082] 2. Validation of reagent kit sensitivity (limit of detection, LOD) and linear range. (1) Linear range verification The Mycoplasma pneumoniae identification target (wild type) and plasmid DNA standards containing A2063G, A2064G, A2067G, and C2617 mutation sites were serially diluted 10-fold with negative matrix solution to prepare concentration gradients of 1×10⁻⁶. 1 copies / mL to 1×10 6 A series of test templates in copies / mL. Single-tube multiplex detection was performed using the kit of this invention. A standard curve was plotted based on the logarithm of the amplified Ct value and the template concentration. The results are as follows. Figures 6-10 As shown. The results indicate that the detection system of the present invention is effective at 1×10⁻⁶. 2 -1×10 6 Excellent linear correlation was observed in the low concentration range of copies / mL (linear correlation coefficient R). 2 >0.99, indicating high and stable amplification efficiency.

[0083] (2) Determination of the lowest detection limit (95% LOD) To accurately determine the detection limit of the kit, serially diluted templates within the aforementioned low concentration range were subjected to 10 independent replicate tests, and the positive detection frequency at each concentration was recorded. Subsequently, a Probit probability regression model was used to perform statistical fitting analysis on the data, calculating the target concentration (95% LOD) corresponding to a 95% positive detection rate. The results are as follows: Figure 11 As shown. The results confirmed that, according to Probit probability regression analysis, the limits of detection (95% LOD) of the kit of this invention for the universal identification target of Mycoplasma pneumoniae and the drug resistance mutation targets A2063G, A2064G, A2067G, and C2617 were 595.16 copies / mL, 893.19 copies / mL, 815.3 copies / mL, 940.36 copies / mL, and 775.46 copies / mL, respectively.

[0084] 3. Validation of heterogeneous drug resistance in the reagent kit To simulate complex heterogeneous infections in clinical settings (i.e., the presence of a large number of wild-type sensitive strains and a very small number of drug-resistant mutant strains in the patient's body) and to verify the ability of the system of this invention to intercept low-abundance drug-resistant mutants at an extremely early stage, a heterogeneous mixing experiment was designed.

[0085] Taking the A2063G mutation site as an example, wild-type (WT) plasmids and mutant (MT) plasmids were precisely mixed. This was done while maintaining a total template concentration of 1×10⁻⁶. 6 Given a limit of copies / mL, a series of heterogeneous simulated samples were prepared with mutant percentages of 100%, 10%, 1%, 0.1%, and 0% (i.e., pure wild type). Single-tube multiplex fluorescent PCR amplification was performed according to the operating steps of the kit of this invention, with each concentration gradient tested three times, and the amplification results were recorded.

[0086] The test results are shown in Table 4 and Figure 12 As shown. The results indicate that, in terms of drug resistance mutation detection: when the mutant proportion gradually decreases from 100% to 1%, or even 0.1%, the detection system of this invention can still amplify significant and typical positive curves; while when the mutant proportion is 0% (i.e., 1×10⁻⁶), the detection system can still amplify significant and typical positive curves. 6 When there are pure wild-type plasmids (copies / mL as background), the ROX channel shows no non-specific amplification signal.

[0087] Table 4. Detection results of heterogeneous drug resistance simulation samples

[0088] Note: NA indicates that there was no amplification curve because the plasmid did not cover the region. The results show that the innovative "wild-type blocking probe (Blocker)" introduced in this invention effectively locks in 99.9% of the wild-type template during amplification, completely eliminating background interference. This allows the MGB short probe to accurately capture the trace mutant strains, which account for only 0.1%. This experiment perfectly verifies that the system still possesses excellent single-base resolution and anti-interference capabilities even under extreme heterogeneous environments.

[0089] Example 4

[0090] Application of Mycoplasma pneumoniae and 23S rRNA drug resistance mutation gene detection kit in clinical specimens 1. Clinical sample collection A total of 100 clinical respiratory samples were collected from suspected Mycoplasma pneumoniae infection patients at the collaborating hospitals. The sample types included sputum, throat swabs, and bronchoalveolar lavage fluid (BALF). All samples were preserved at low temperatures and transported to the laboratory.

[0091] 2. Nucleic acid extraction The Tianlong Nucleic Acid Extraction and Purification Kit (Ex-DNA / RNA Virus 4.0) was used in conjunction with the Tianlong Automated Nucleic Acid Extractor, and automated nucleic acid extraction was performed strictly according to the kit instructions. The extracted DNA eluent was used directly for subsequent testing or stored at -20℃ for later use.

[0092] 3. PCR detection Using the DNA extracted in step 2 as a template, single-tube multiplex fluorescent PCR detection was performed using the kit of this invention. The reaction system and amplification procedure were the same as in Example 2. Negative and positive controls were also set up to monitor the entire experimental process.

[0093] 4. Results Analysis and Comparative Verification To objectively evaluate the clinical accuracy of the kit of the present invention, the extracted DNA from the above 100 clinical samples was simultaneously sent to a third-party sequencing institution, and the V region of 23S rRNA (covering sites 2063, 2064, 2067, and 2617) was amplified and sequenced using the gold standard Sanger sequencing method.

[0094] The kit of this invention detected 65 positive samples and 35 negative samples of Mycoplasma pneumoniae (MP). Among the 65 MP-positive samples, the kit further precisely classified them into: 38 wild-type (sensitive strains) and 27 drug-resistant mutants. Some sample test results are shown below. Figure 13 As shown in the table, the traditional nested PCR combined with sequencing method also detected 65 MP-positive cases and 35 MP-negative cases, but there was a slight difference in the determination of drug-resistant mutants compared with this kit. The comparison results of the two methods are shown in Table 5: Table 5. Evaluation of the clinical specimen application of the Mycoplasma pneumoniae drug resistance mutation gene detection kit.

[0095] As shown in Table 5, 25 samples tested positive for drug resistance using both methods, while 73 samples tested negative for both methods (wild-type or MP-negative).

[0096] Positive compliance rate (PPA) = 25 / 25 × 100% = 100.00% (95% CI: 86.68% ~ 100.00%); The negative compliance rate (NPA) was approximately 97.33% (95% CI: 90.77% ~ 99.24%). Overall compliance rate (OPA) = (25 + 73) / 100 × 100% = 98.00% (95% CI: 93.00% ~ 99.42%); Kappa=0.948.

[0097] Statistical analysis showed that the overall concordance rate between the kit of this invention and the gold standard sequencing method was as high as 98.00%, and the Kappa value was 0.948 (>0.81 represents extremely strong concordance). This fully demonstrates that the system of this invention has excellent stability and accuracy in complex clinical matrices, with a positive concordance rate of 100% and no missed detections of drug-resistant strains.

[0098] The above description is merely a preferred embodiment of the present invention. The Mycoplasma pneumoniae and 23S rRNA drug resistance mutation gene detection kit of the present invention can be used to detect clinical samples infected with Mycoplasma pneumoniae, simultaneously detecting Mycoplasma pneumoniae and the resistance sites of four macrolide drugs: A2063G, A2064G, A2067G, and C2617G. This method has high specificity and sensitivity and can be applied to the detection of Mycoplasma pneumoniae and its drug resistance genes, demonstrating good application value for the clinical diagnosis and treatment of Mycoplasma pneumoniae.

[0099] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer probe for detecting the drug resistance mutation gene of Mycoplasma pneumoniae 23S rRNA, characterized in that, Including Mp 2063-2067 -Univ-F、Mp 2063-2067 -Univ-R、Mp A2063G -P、Mp A2064G -P、Mp A2067G -P、Mp 2617 -Univ-F、Mp 2617 -Univ-R、Mp 2617G -P and wild-type blocking probe, wherein the wild-type blocking probe is Blocker-WT 2063-2067 and Blocker-WT 2617 ; The Mp 2063-2067 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 4; The Mp 2063-2067 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 5; The Mp A2063G The nucleotide sequence of -P is shown in SEQ ID No. 6; The Mp A2064G The nucleotide sequence of -P is shown in SEQ ID No. 7; The Mp A2067G The nucleotide sequence of -P is shown in SEQ ID No. 8; The Mp 2617 The nucleotide sequence of -Univ-F is shown in SEQ ID No. 9; The Mp 2617 The nucleotide sequence of -Univ-R is shown in SEQ ID No. 10; The Mp 2617G The nucleotide sequence of -P is shown in SEQ ID No. 11; The Blocker-WT 2063-2067 The nucleotide sequence is shown in SEQ ID No. 12; The Blocker-WT 2617 The nucleotide sequence is shown in SEQ ID No.

13.

2. The primer probe according to claim 1, characterized in that, The mutation sites of the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene are A2063G, A2064G, A2067G and C2617G.

3. The primer probe according to claim 1, characterized in that, The Mp A2063G -P、Mp A2064G -P、Mp A2067G -P and Mp 2617G -P is marked with FAM, ROX or HEX at the 5' end and MGB at the 3' end; The Blocker-WT 2063-2067 and Blocker-WT 2617 The 3' end of the C3 Spacer is modified.

4. A primer-probe combination for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, characterized in that, Includes the primers and probes as described in any one of claims 1-3, primers and probes targeting the universal detection gene for Mycoplasma pneumoniae, and primers and probes targeting the internal standard gene RNase-P; The primers and probes targeting the universal detection gene for Mycoplasma pneumoniae include MP-F, MP-R, and MP-P; The nucleotide sequence of the MP-F is shown in SEQ ID No. 1; The nucleotide sequence of the MP-R is shown in SEQ ID No. 2; The nucleotide sequence of the MP-P is shown in SEQ ID No. 3; The primers and probes targeting the internal standard gene RNase-P include RNase PF, RNase PR, and RNase PP; The nucleotide sequence of the RNase PF is shown in SEQ ID No. 14; The nucleotide sequence of the RNase PR is shown in SEQ ID No. 15; The nucleotide sequence of the RNase PP is shown in SEQ ID No.

16.

5. The primer feature combination according to claim 4, characterized in that, The 5' end of the MP-P and RNase PP is labeled with FAM, ROX or HEX, and the 3' end is labeled with MGB.

6. A primer-probe premix for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, characterized in that, Includes the primers and probes as described in any one of claims 1-3, and the primer and probe combinations as described in claim 4 or 5.

7. The primer-probe premix according to claim 6, characterized in that, The final concentration of primers in the primer-probe premix solution is 0.1-0.4 μM, and the final concentration of probes other than the wild-type blocking probe is 0.1-0.3 μM. The Blocker-WT... 2063-2067 and Blocker-WT 2617 The final concentrations were all 0.2~1.5 μM.

8. A kit for detecting Mycoplasma pneumoniae and the Mycoplasma pneumoniae 23S rRNA drug resistance mutation gene, characterized in that, Includes the primer and probe premix, PCR reaction solution, positive control and negative control as described in claim 6 or 7.

9. The reagent kit according to claim 8, characterized in that, The positive control is a mixed plasmid containing sequences SEQ ID No. 17~21 and SEQ ID No. 24; The negative control is a plasmid containing the sequence SEQ ID No.

24.

10. The use of the primers and probes according to any one of claims 1-3, the primer and probe combinations according to any one of claims 4-5, the primer and probe premixes according to any one of claims 6-7, or the kits according to any one of claims 8-9 in the preparation of products for detecting Mycoplasma pneumoniae and Mycoplasma pneumoniae 23S rRNA drug resistance mutation genes.

Images