A snp molecular marker related to the inner skin color of cassava tuber and application thereof

Abstract

The application discloses a SNP (Single Nucleotide Polymorphism) molecular marker related to the inner skin color of cassava tuber and application thereof, and relates to the field of molecular markers. The SNP molecular marker is located on chromosome 2 of cassava, and contains one SNP site Chr02_7589856_(A / G) on the SNP molecular marker; the SNP site Chr02_7589856_(A / G) is located at the 7589856th base of chromosome 2 of cassava, and the polymorphism site is A / G. Through the SNP molecular marker of the application, high-throughput, low-cost, rapid and accurate screening of red inner skin germplasm of cassava tuber can be realized.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, specifically to an SNP molecular marker related to the color of cassava tuber endodermis and its application. Background Technology

[0002] Cassava ( Manihot esculenta Crantz Cassava tubers are rich in starch, widely planted, and have high economic value. The color of the inner skin of the tuber is one of the important traits in the description and quality evaluation of cassava germplasm resources. It typically exhibits various phenotypes, including white, yellow, purplish-red, and dark purple, mainly determined by the differential accumulation of anthocyanins and flavonoid secondary metabolites in the inner skin tissue. This color is closely related to nutritional quality, antioxidant capacity, and stress resistance. Among these, purplish-red and dark purple inner skin germplasm, rich in anthocyanins, have high utilization value in the screening of edible cassava and deep-processing raw materials.

[0003] Currently, research on the molecular mechanisms of cassava tuber inner skin color formation is relatively weak, and reports on functional sites significantly associated with it are scarce. Traditional identification of tuber inner skin color mainly relies on phenotypic observation after field harvest, requiring plants to be cultivated to maturity before determination. This method is time-consuming, costly in the field, and inefficient in breeding. Furthermore, the lack of reliable molecular selection criteria in early-generation segregating populations and hybrid seedlings makes it difficult to achieve targeted screening based on inner skin color in early generations, thus hindering the efficient creation of high-value-added breeding materials such as those with purplish-red or dark purple inner skin. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a SNP molecular marker related to the color of cassava tuber endodermis and its application. The SNP molecular marker of this invention can perform genotyping based on genomic DNA at the seedling stage, enabling rapid, stable, and low-cost identification and screening of red (purplish-red and dark purple) and non-red endodermis germplasm.

[0005] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides an application of SNP molecular markers related to the color of cassava tuber inner skin in identifying the trait of cassava tuber inner skin color, screening for cassava with red inner skin, and genetic breeding of cassava tuber inner skin with red inner skin. The SNP molecular marker contains a SNP locus Chr02_7589856_(A / G); the SNP locus is located at base 7589856 on cassava chromosome 2, and the polymorphic site is A / G. The SNP molecular markers are based on the cassava reference genome M. esculenta v7.1; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the SNP site Chr02_7589856_(A / G) is located at the 26th base of SEQ ID NO: 1.

[0006] The present invention also provides primers for obtaining the SNP molecular markers, wherein the primers for obtaining the sequence xl-KASP containing the SNP site Chr02_7589856_(A / G) are allele-specific forward primer F1, allele-specific forward primer F2 and reverse universal primer R; The nucleotide sequence of the allele-specific forward primer F1 is shown in SEQ ID NO: 2, the nucleotide sequence of the allele-specific forward primer F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse universal primer R is shown in SEQ ID NO: 4. The allele-specific forward primer F1 contains a FAM fluorescent tag, and the allele-specific forward primer F2 contains a HEX fluorescent tag.

[0007] Furthermore, the nucleotide sequence of the xl-KASP sequence obtained by primer amplification is shown in SEQ ID NO: 1, and the SNP site Chr02_7589856_(A / G) is located at the 26th base of the xl-KASP sequence.

[0008] The present invention also provides a KASP detection method for the SNP molecular marker described above, wherein the method uses the primers described above for amplification and completes genotyping by detecting fluorescence signals; When the SNP site Chr02_7589856_(A / G) has a genotype of AG or GG, the inner skin of the cassava tuber is red.

[0009] This invention also provides the application of the primers described above in identifying the color trait of cassava tuber inner skin, screening cassava with red inner skin, and genetic breeding of cassava tuber inner skin trait.

[0010] The present invention also provides a method for identifying the color trait of cassava tuber endodermis, wherein the method uses the primers to amplify cassava DNA and completes genotyping by detecting fluorescence signals; The specific steps are as follows: S1. Extract DNA from the cassava to be tested; S2. PCR amplification of cassava DNA was performed using the primers described above; S3. Read the fluorescence signals of the FAM and HEX dual channels. If only the FAM channel fluorescence signal is present, the SNP site Chr02_7589856_(A / G) genotype is the AA genotype. Or there is only HEX channel fluorescence signal, and the SNP site Chr02_7589856_(A / G) genotype is GG genotype; Alternatively, both FAM and HEX dual-channel fluorescence signals are present, and the SNP site Chr02_7589856_(A / G) genotype is AG genotype; When the SNP site Chr02_7589856_(A / G) has a genotype of AG or GG, the inner skin of the cassava tuber is red.

[0011] The present invention also provides a kit for detecting the SNP molecular markers, the kit comprising the primers described above.

[0012] The present invention also provides the application of the kit described herein in identifying the color trait of cassava tuber inner skin, screening cassava with red inner skin, and in the genetic breeding of cassava tuber inner skin with red trait.

[0013] The beneficial effects of this invention are: (1) The present invention develops a functional SNP molecular marker located in the Manes.02G085400 gene that is significantly associated with the color of the cassava tuber endodermis, which can be used for accurate identification of red and non-red endodermis germplasm.

[0014] (2) The SNP molecular markers provided by this invention have high specificity and clear genotyping. In the preliminary verification of 34 germplasm accessions, the accuracy rate of AG and GG genotypes in determining red tuber endodermis reached 100%, and the accuracy rate of AA genotype in determining non-red tuber endodermis reached 88.89%. In the expanded verification of 48 natural population accessions, the screening efficiency of red tuber endodermis germplasm reached 94.12%, and the AA, AG, and GG genotypes showed clear clustering and no obvious non-specific amplification on the scatter plot.

[0015] (3) The identification method of the present invention can complete the genotyping based on leaf genomic DNA at the seedling stage of cassava, which originally required 8 to 12 months to achieve the phenotypic identification through phenotype observation, thus significantly shortening the breeding cycle, reducing field costs, and improving selection efficiency.

[0016] (4) The KASP detection system is simple, requires little reagent, and can perform high-throughput parallel detection in 96-well plates. It has the technical advantages of high throughput, low cost, and easy promotion, and is suitable for large-scale germplasm resource screening and molecular breeding applications.

[0017] (5) This invention can serve as an important molecular tool for cassava functional genomics research, pigment metabolism mechanism analysis, and breeding of high-nutrition, multi-purpose edible cassava varieties. It has important theoretical and practical value for promoting cassava germplasm innovation, edible and deep processing industry upgrading. Attached Figure Description

[0018] Figure 1 Example image showing the color classification of the inner skin of cassava tubers; In the diagram, 1 and 2 have white inner skin; 3 has yellow inner skin; 4, 5, 6, and 8 have purplish-red inner skin; and 7 has dark purple inner skin. Figure 2 Scatter plot of genotyping of SNP loci in 34 germplasm accessions; Figure 3 Scatter plot of genotyping for SNP loci in 48 germplasms. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0020] Example 1 Genome-wide association analysis identified SNPs significantly associated with the color of cassava tuber endodermis. 1. The genome-wide association analysis (GWAS) population consisted of 288 cassava germplasm resources from domestic and international sources. These resources were field-grown at the Shidui base in Danzhou City, Hainan Province from 2020 to 2021. Cassava was harvested at the harvest season, and the color of the inner skin of the tubers of the 288 cassava accessions was observed.

[0021] like Figure 1 As shown, the inner skin color of 288 cassava tubers was divided into white, yellow, purplish-red, and dark purple. Purplish-red and dark purple were classified as red, and white and yellow were classified as non-red.

[0022] 2. Genomic DNA was extracted from the young leaves of 288 cassava germplasm resources. The OD260 / OD280 ratio of the DNA was detected using a NanoDrop micro spectrophotometer, and the ratio was required to be between 1.8 and 2.0. The purity and integrity of the DNA were checked by 1% agarose gel electrophoresis. The qualified DNA samples were diluted to 100 ng / μL for sequencing library construction.

[0023] 3. Library construction and resequencing were commissioned to Beijing Novogene Technology Co., Ltd. The resequencing data of 288 germplasm resources were compared with the cassava reference genome (M. esculenta v7.1), and 242 SNP loci were identified in the Manes.02G085400 gene. A chi-square test was used to analyze whether the distribution of tuber endodermal color differed among different genotypes at each SNP locus.

[0024] A SNP locus, Chr02_7589856_(A / G), significantly associated with the color of cassava tuber endodermis was identified. The SNP locus Chr02_7589856_(A / G) is located at base 7589856 on chromosome 2 of the cassava reference genome M. esculenta v7.1, with a polymorphism of A / G. Furthermore, the SNP locus Chr02_7589856_(A / G) is located at base 1768 of Manes.02G085400, which is located at bases 7588088–7594688 on chromosome 2 of the cassava reference genome M. esculenta v7.1 (https: / / phytozome-next.jgi.doe.gov / info / Mesculenta_v7_1).

[0025] Example 2 Development of SNP molecular markers associated with cassava tuber endodermal color SNP molecular markers were developed targeting the SNP site Chr02_7589856_(A / G), which can be used to identify and screen cassava germplasm resources for red and non-red endodermal cells.

[0026] 1. Primer design For the SNP site Chr02_7589856_(A / G), two allele-specific forward primers and one reverse universal primer were designed using the online software Primer3Plus (http: / / www.primer3plus.com).

[0027] According to the KASP technical specifications, the standard FAM fluorescent tag sequence (5'-GAAGGTGACCAAGTTCATGCT-3') was added to the 5' end of the primer for detecting the A allele, and the standard HEX fluorescent tag sequence (5'-GAAGGTCGGAGTCAACGGATT-3') was added to the 5' end of the primer for detecting the G allele.

[0028] The designed primer sequences are as follows: Allele-specific forward primer F1 (FAM tag, for detecting A allele): GAGGTGACCAAGTTCATGCTCCTAAGACCATAAATATTAGAAATAA (SEQ ID NO: 2); where the bolded part is the FAM fluorescent tag; Allele-specific forward primer F2 (HEX tag, for detecting G allele): GAAGGTCGGAGTCAACGGATTCCTAAGACCATAAATATTAGAAATAG (SEQ ID NO: 3); where the bolded part is the HEX fluorescent tag; Reverse universal primer R: GCAACTGCAAATACCGACAC (SEQ ID NO: 4).

[0029] 2. PCR reaction Genomic DNA was extracted from cassava and amplified by PCR using allele-specific forward primers F1 and F2 and a reverse universal primer R, with cassava genomic DNA as a template.

[0030] PCR amplification was performed using the 2× KASP Master Mix from the 2× Master Mix for ASPCR V1 Allele-Specific Genotyping Kit (Chengdu Hanchen Guangyi Biotechnology Co., Ltd.). The reaction system (total volume 10 μL) was as follows: Genomic DNA template (50 ng / μL): 1 μL; 2× KASP Master Mix: 5 μL; Allele-specific forward primer F1 (10 μmol / L): 0.1 μL; Allele-specific forward primer F2 (10 μmol / L): 0.1 μL; Reverse universal primer R (10 μmol / L): 0.3 μL; ddH2O: 3.5 μL.

[0031] The PCR reaction procedure is shown in Table 1.

[0032] Table 1 PCR reaction procedure 3. Genotyping test After PCR amplification, the gene sequence xl-KASP containing the SNP site Chr02_7589856_(A / G) was obtained. Its nucleotide sequence is shown in SEQ ID NO: 1. The degenerate base R is A / G, and the SNP site Chr02_7589856_(A / G) is located at the 26th base of the gene sequence xl-KASP, with the polymorphic site being A / G.

[0033] SNP genotyping was performed using a Bio-Rad CFX Opus96 real-time PCR instrument in 96-well plates, with two wells of ddH2O per plate as negative controls (NTC). Genotyping data were analyzed using the Bio-Rad CFX Opus96 instrument, and t-tests were applied to detect phenotypic differences between alleles. FAM and HEX dual-channel fluorescence signals were read, and genotype interpretation was performed based on clustering results in the scatter plot. (1) Only FAM channel fluorescence signal (scatter points located along the FAM axis): interpreted as AA homozygous genotype; (2) Only HEX channel fluorescence signal (scatter points located along the HEX axis): interpreted as GG homozygous genotype; (3) Both FAM and HEX dual-channel fluorescence signals are present (scatter points are located between the two axes): interpreted as AG heterozygous genotype; (4) Low fluorescence signal in both channels (NTC clustering region): negative control.

[0034] Based on the genotype of the SNP site Chr02_7589856_(A / G), the color of the inner skin of the cassava tuber is determined. When the genotype of the SNP site Chr02_7589856_(A / G) is AG or GG, the inner skin of the cassava tuber is red.

[0035] Example 3 Preliminary validation of SNP molecular markers associated with cassava tuber endodermal color 1. Verification materials From the 288 population in Example 1, 18 samples with red root endodermal color (purple-red and dark purple) and 16 samples with non-red root endodermal color (white and yellow) were randomly selected, for a total of 34 samples, for preliminary verification of SNP molecular markers.

[0036] 2. Verification Results Genotyping was performed on 34 validation germplasms using the method described in Example 2. Combined with data on the color of the tuberous root endodermis for each germplasm type, the results are as follows: Figure 2 As shown, the specific genotyping results and statistical analysis are shown in Tables 2 and 3.

[0037] Table 2 Inner skin color and KASP genotyping of 34 cassava germplasms Table 3 Statistical analysis of the accuracy of cassava root inner skin color based on marker genotype in 34 cassava germplasms Note: Different lowercase letters after the peer index indicate significant differences between groups (P<0.05, Bonferroni correction), the same applies below.

[0038] Figure 2 The FAM / HEX fluorescence signals were clearly clustered into three groups: orange for AA genotype, green for AG genotype, and blue for GG genotype, with no cross-contamination. The black negative control NTC was located in the lower left corner, indicating high genotyping quality and no obvious non-specific amplification.

[0039] The verification results showed that among the 34 cassava germplasms, the AG and GG genotypes of the SNP site Chr02_7589856_(A / G) were mostly concentrated in the red endodermal group of the tuber, while the AA genotype was mostly concentrated in the non-red group (Table 2). This preliminarily shows that the SNP site Chr02_7589856_(A / G) is highly associated with the color of the endodermal group of the tuber.

[0040] Table 3 shows that the accuracy rate of red cassava tuber inner skin for AG and GG genotypes is 100%, while the accuracy rate of non-red cassava tuber inner skin for AA genotype is 88.89%. The genotyping effect is significant, and it can sensitively, efficiently, and cost-effectively predict the color of cassava tuber inner skin.

[0041] Example 4 Application of SNP molecular markers in the screening of 48 cassava germplasm accessions Forty-eight cassava germplasm resources were selected, covering germplasm materials with different inner skin colors of the tubers. Genotyping was performed on the 48 cassava germplasm resources using the method in Example 2, and the inner skin color of the tubers was observed. The results are as follows: Figure 3 As shown in Tables 4 and 5.

[0042] Table 4 Inner skin color and KASP genotyping of 48 cassava tuber samples Table 5 Statistical analysis of the accuracy of endodermal color of 48 germplasm resources based on marker genotypes The SNP molecular markers of this invention were used to screen 48 cassava germplasm accessions. Figure 3The results showed that the 48 cassava germplasm accessions exhibited clear genotyping and clustering with no significant non-specific amplification. Table 4 revealed that the SNP molecular markers were present in the natural population for all three genotypes: AA, AG, and GG. Germplasm with AG and GG genotypes had red inner tuber skin, while those with AA genotypes had non-red inner tuber skin, demonstrating good genotyping performance. Table 5 showed that 16 cassava germplasm accessions with AG and GG genotypes (red inner tuber skin) were screened out from the 48 accessions, achieving a screening efficiency of 94.12%. The frequency of AA genotype cassava germplasm with non-red inner tuber skin was significantly higher than that of red inner tuber skin, with a significant difference at the 0.05 level. This further confirms the good practicality and reliability of the SNP molecular markers in the screening of cassava germplasm with red inner tuber skin.

[0043] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of primers or kits containing said primers for detecting SNP molecular markers related to the color of cassava tuber endodermis in identifying the color of cassava tuber endodermis, screening for cassava with red tuber endodermis, and cassava tuber endodermis red molecular marker-assisted breeding, characterized in that: The SNP molecular marker contains a SNP site Chr02_7589856_(A / G); the SNP site is located at base 7589856 on chromosome 2 of the cassava reference genome M. esculenta v7.1, and the polymorphism site is A / G; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and the SNP site Chr02_7589856_(A / G) is located at the 26th base of SEQ ID NO: 1; When the SNP site Chr02_7589856_(A / G) has a genotype of AG or GG, the inner skin of the cassava tuber is red.

2. The application according to claim 1, characterized in that: The primers are allele-specific forward primer F1, allele-specific forward primer F2, and reverse universal primer R; The nucleotide sequence of the allele-specific forward primer F1 is shown in SEQ ID NO: 2, the nucleotide sequence of the allele-specific forward primer F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse universal primer R is shown in SEQ ID NO:

4. The allele-specific forward primer F1 contains a FAM fluorescent tag, and the allele-specific forward primer F2 contains a HEX fluorescent tag.

3. A method for identifying the color characteristics of the inner skin of cassava tubers, characterized in that: The method uses the primers in claim 2 to amplify cassava DNA and completes genotyping by detecting fluorescence signals; The specific steps are as follows: S1. Extract DNA from the cassava to be tested; S2. PCR amplification of cassava DNA using the primers in claim 2; S3. Read the fluorescence signals of the FAM and HEX dual channels. If only the FAM channel fluorescence signal is present, the SNP site Chr02_7589856_(A / G) genotype is the AA genotype. Or there is only HEX channel fluorescence signal, and the SNP site Chr02_7589856_(A / G) genotype is GG genotype; Alternatively, both FAM and HEX dual-channel fluorescence signals are present, and the SNP site Chr02_7589856_(A / G) genotype is AG genotype; When the SNP site Chr02_7589856_(A / G) has a genotype of AG or GG, the inner skin of the cassava tuber is red.

Images