SNP molecular marker related to apple nitrogen utilization rate, detection reagent and application thereof

Abstract

The application discloses an SNP molecular marker related to nitrogen utilization rate of apples, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. An SNP site significantly related to high-efficiency utilization of nitrogen of apples is identified at 3,292,581 bp of a GDDH13 V1.1 apple reference genome Chr16 chromosome, a corresponding relationship between a genotype of the site and nitrogen utilization rate of apples is established, new molecular evidence is provided for analyzing the genetic basis of high-efficiency absorption and utilization of nitrogen of apples, and functional molecular marker resources related to the nitrogen utilization rate of apples are enriched.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a SNP molecular marker, detection reagent, and application related to nitrogen utilization in apples. Background Technology

[0002] Nitrogen, a key nutrient element for apple tree growth and development, is a major component of biomolecules such as amino acids, nucleotides, and chlorophyll. Its supply level directly affects apple biomass accumulation and quality formation. Different apple varieties exhibit significant differences in nitrogen use efficiency: the 'Qin Guan' variety shows a high nitrogen use efficiency under low-nitrogen conditions, while the 'Mi Cui' variety shows a relatively low one. Furthermore, red-fleshed apple varieties and their hybrids also demonstrate high nitrogen use efficiency. Nitrogen-efficient varieties can maintain high photosynthetic efficiency and biomass even under low-nitrogen conditions, thus ensuring fruit yield and quality, significantly reducing fertilizer application, and lowering environmental pollution.

[0003] In recent years, a series of key genes involved in regulating nitrogen use efficiency in apples have been identified. Among them, the nitrate transporter MdNRT2.4 has been shown to enhance root growth and biomass accumulation in apples under low nitrogen conditions. The nitrate reductase MdNIA2 improves nitrogen use efficiency and plant growth rate by promoting root hair elongation. The WRKY transcription factor MdWRKY17 positively regulates apple tolerance to low nitrogen stress by activating the expression of the high-affinity nitrate transporter MdNRT2.5. In addition, the autophagy-related gene MdATG5a positively regulates nitrogen use efficiency in apples under low nitrogen conditions by promoting the accumulation of root flavonoids and root growth.

[0004] However, molecular markers closely linked to nitrogen efficiency (or nitrogen sensitivity) in apples have not yet been systematically developed. Therefore, how to further screen nucleotide variations that are stably associated with nitrogen use efficiency in apples from nitrogen response-related genes and develop them into easily detectable molecular markers remains an important problem to be solved in nitrogen-efficient apple breeding. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a SNP molecular marker, detection reagent, and application related to nitrogen use efficiency in apples. The SNP molecular marker of this invention can be used to screen or identify nitrogen-efficient apple varieties, which is beneficial for early screening of high-quality germplasm resources.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SNP molecular marker related to nitrogen utilization in apples, the nucleotide sequence of which is shown in SEQ ID NO.1; the 261st base from the 5' end of the sequence is an SNP site, and its base polymorphism is C or T.

[0007] The specific nucleotides labeled with the SNP are as follows: AATCTAAACCACAGGGGAAGCAGGGGTGTGAGTGGAGGATGACGTAGCAGTCGAATTGGAGTGACCGCGGCCTTCGCTGTGGCTGACCCTTTCGTCTGAATGAAAGGGTTTGGGTTGCTTTGGCCGCGGT CTTTGAATTGGTGGTGAGACCTGTGTGACAGCAGGAGTTGAAGCCAAGGGTGCATATATTCCATTGGCTGCCTCCCCAGAAGCAGTGGTTGCTGCCATTGCTGCGTACTCCTGGGGTGGCACCCAAATGC C / T TCCCACAACCACAAATTGCGGTGCTGGTGCGCCGCTGTTACTGTTGCCGTGCATTGTTGGAGTTGGTCTTCGAGTATGTAAACGATATTTCTGCGAACAACAAAACATGATCGAAATTAGACTCTGACGAATCGGCTAAATGAAAATTCACAATTTGTTAATGATTCTTCAAGATAACGCATGCTTCTTATGTCACTATTTTTTAAGGACATCCACGCCTGCTTGCACATAGAGAG.

[0008] Note: The nucleotides in bold italics in the sequence are SNP sites, which are represented in the sequence listing as the corresponding degenerate base "Y".

[0009] This invention discovered a SNP at 3,292,581 bp on chromosome 3,292,581 of the apple genome, which is strongly associated with nitrogen use and has a base polymorphism of C / T. The dominant allele associated with nitrogen use efficiency in apples is T. Apples with the TT or CT genotypes at this SNP site correspond to higher nitrogen use efficiency.

[0010] The physical location of the SNP in this invention is determined based on the apple genome GDDH13 V1.1.

[0011] A second aspect of the present invention provides the application of the above-mentioned SNP molecular markers in screening or identifying nitrogen-efficient apple materials.

[0012] A third aspect of the present invention provides a detection reagent comprising: a primer pair for detecting the above-mentioned SNP molecular marker, said primer pair being composed of primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3; specifically as follows: Primer F: 5'-AATCTAAACCACAGGGGAAGCA-3'; (SEQ ID NO.2) Primer R: 5'-CTCTCTATGTGCAAGCAGGCG-3'. (SEQ ID NO.3) Furthermore, the detection reagent also includes: PCR amplification reagent; the PCR amplification reagent includes: 2×Phanta Max Master Mix, DNA template and RNase-free ddH2O.

[0013] Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.

[0014] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2): (1) Screening or identifying apple materials with high nitrogen utilization rate; (2) Select and breed nitrogen-efficient apple varieties.

[0015] In the above applications, the method for screening or identifying apple materials with high nitrogen utilization is as follows: Using the genomic DNA of the apples to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products. The amplification products were sequenced, and the nitrogen utilization rate of the apple materials was identified based on the sequencing results. Apple materials with high nitrogen utilization rates were screened.

[0016] Specifically, the sequencing results of the amplified product correspond to apple materials with the TT or CT genotype at position 261 of the sequence shown in SEQ ID NO.1, and their nitrogen utilization rate is higher than that of apple materials with the CC genotype at position 261 of the sequence shown in SEQ ID NO.1.

[0017] Preferably, the PCR amplification system is as follows: 12.5 µL of 2×Phanta Max Master Mix, 1 µL of primer F, 1 µL of primer R, 1 µL of DNA template, and RNase-free ddH2O to a final volume of 25 µL.

[0018] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 90 sec, for 34 cycles; 72℃ final extension for 5 min.

[0019] The beneficial effects of this invention are: (1) In this invention, a SNP locus significantly associated with efficient nitrogen utilization in apples was identified at chromosome 3,292,581 bp on Chr16 of the GDDH13 V1.1 apple reference genome. The correspondence between the genotype of this locus and the nitrogen utilization rate of apples was established, providing new molecular evidence for elucidating the genetic basis of efficient nitrogen absorption and utilization in apples, and enriching the resources of functional molecular markers related to nitrogen utilization in apples.

[0020] (2) This invention clarifies that the T allele at the 3,292,581 bp locus on chromosome 16 is associated with nitrogen-efficient utilization traits in apples. When the genotype at this locus is C / T heterozygous or T / T homozygous, the apple material to be tested can be identified as nitrogen-efficient; when the genotype at this locus is C / C homozygous, the apple material to be tested can be identified as ordinary. This forms a clear, stable, and easy-to-operate molecular determination rule, which can quickly identify nitrogen-efficient apple materials based on the genotype of a single locus.

[0021] (3) By using the SNP loci and detection reagents of the present invention, a large number of germplasm resources or breeding offspring can be genotyped during the apple seedling stage, eliminating C / C common type materials in advance and giving priority to retaining nitrogen-efficient candidate materials carrying C / T or T / T genotypes, avoiding nitrogen efficiency phenotypic identification after the plants have grown for many years, thereby improving the selection efficiency of nitrogen-efficient apple breeding and shortening the breeding cycle. (4) The molecular markers of the present invention can be used for identification of nitrogen-efficient germplasm resources of apples, selection of parents, screening of hybrid offspring, evaluation of rootstocks and molecular marker-assisted breeding. This is beneficial for cultivating apple varieties or rootstocks that still have high nitrogen absorption and utilization capacity under low nitrogen fertilizer input conditions, and provides technical support for reducing the amount of nitrogen fertilizer applied in orchards, reducing production costs and agricultural non-point source pollution, and promoting the green and sustainable development of the apple industry. Attached Figure Description

[0022] Figure 1 Manhattan plot of nitrogen-efficient apples.

[0023] Figure 2 : QQ plot of GWAS for nitrogen utilization traits.

[0024] Figure 3 : A magnified view of the SNP with the strongest association signal and candidate genes Md16G1047300Surrounding LD heatmap; in the figure, A is a magnified view of the SNP with the strongest association signal, and B is the candidate gene. Md16G1047300 The surrounding LD heatmap.

[0025] Figure 4 Example 1: Schematic diagram of the location of the SNP sites selected.

[0026] Figure 5 Haplotype analysis of SNP sites screened in Example 1. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] Terminology Explanation: Nitrogen use efficiency: The ratio of the total nitrogen absorbed by the plant from fertilizer to the total nitrogen applied by the fertilizer.

[0029] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0030] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: The method for determining nitrogen utilization rate is as follows: Apple seedlings that had grown to 10 true leaves in Hogrange nutrient solution were starved with distilled water for 7 days, and then treated with total nitrate nitrogen [Ca( 15 NO3)2, Shanghai Chemical Industry Research Institute, with an abundance of 10.16%] was used as the sole nitrogen source. After 20 days of treatment, when the seedlings had 16-17 true leaves, samples were collected. The nitrate nitrogen content was determined by the hydrazine sulfate reduction method described by Liu et al. (The long noncoding RNA T5120 regulates nitrate response and assimilation in Arabidopsis. New Phytologist, 2019, 224(1): 117-131); and by referring to Wang and Tsay ( ArabidopsisThe nitrate transporter NRT1.9 is important in Phloem nitrate transport. The method described in *The Plant Cell*, 2011, 23(5): 1945-1957, describes sample preparation, and the nitrate was determined using a MAT-251 mass spectrometer (Finnigan, USA). 15 The abundance of N is calculated according to the following formula. 15 NO3 - Absorption and nitrogen utilization rate.

[0031] Ndff (%) = [in plant samples] 15 N abundance (%) – natural abundance (%)] / [in fertilizer] 15 [N abundance (%) – natural abundance (%)] × 100; 15 NO3 - Absorption (g) = Ndff (%) × Total nitrogen content of organ (g); Nitrogen utilization rate (%) = [Ndff (%) × total nitrogen content of organs (g)] / fertilizer application rate (g) × 100.

[0032] Example 1: Screening of SNP sites related to nitrogen use efficiency 1. Test method: Resequencing data from 605 Malus species in major apple-producing regions were used to detect site-specific nuclei (SNPs) (Han et al., 2021; Chen et al., 2022), identifying a total of 2,567,213 SNPs. Genome-wide association studies (GWAS) were then conducted to analyze nitrogen-efficient traits in apples.

[0033] 2. Test Results: The Manhattan diagram of nitrogen-efficient apples Figure 1 As shown in the figure, the dashed lines represent significant thresholds across the genome, the x-axis represents the 17 chromosomes of the apple genome, and the y-axis represents -log10 ( P The QQ plot of GWAS for nitrogen utilization traits is shown below. Figure 2 As shown in the figure, the x-axis represents the expected value of P after the -log10 transformation, and the y-axis represents the expected value of P after the -log10 transformation. P Actual values. A magnified view of the SNP with the strongest association signal and candidate genes. Md16G1047300 Surrounding LD thermal maps such as Figure 3 As shown.

[0034] Therefore, the analysis of nitrogen efficiency traits in apples using genome-wide association analysis (GWAS) revealed that a SNP located at 3,292,581 bp on chromosome Chr16 of the apple genome showed a strong correlation with nitrogen efficiency.

[0035] The location diagram of this SNP site is shown below. Figure 4 As shown, orange rectangles represent exons, blue rectangles represent UTR regions, solid lines represent introns, and dashed arrows indicate SNP positions (-3,292,581 bp). Ref. and Alt. represent the target gene, respectively. Md16G1047300 Exon 4 reference genome bases (C) and mutant bases (T).

[0036] Haplotype analysis of this SNP site is as follows: Figure 5 As shown, the three main haplotypes regulating nitrogen utilization traits in apples are: Hap1 (C / C ratio), Hap2 (C / T ratio), and Hap3 (T / T ratio). Among them, haplotypes Hap2 and Hap3 exhibit higher nitrogen utilization rates than haplotype Hap1.

[0037] Example 2: Design of SNP molecular markers and detection reagents related to nitrogen utilization in apples 1. Design of SNP molecular markers related to nitrogen utilization in apples: Based on the SNP locus associated with apple nitrogen utilization (at position 3,292,581 bp on chromosome 3,292,581 of the apple genome, with a base polymorphism of C / T) screened in Example 1, this example designs a molecular marker for SNP associated with apple nitrogen utilization.

[0038] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the 261st base from the 5' end of the sequence is the SNP site, and its base polymorphism is C or T.

[0039] 2. Design of detection reagents: Based on the above SNP molecular markers, detection reagents were also designed, which include primer pairs and PCR amplification reagents for detecting the above SNP molecular markers. The primer pair consists of primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3; the PCR amplification reagents include: 2×Phanta Max Master Mix, DNA template and RNase-free ddH2O.

[0040] Example 3: Application Investigation of Identifying Nitrogen Use Efficiency in Apples 1. Test method: Genomic DNA was extracted from the apples to be tested using the DNA Secure Novel Plant Genomic DNA Extraction Kit (Tiangen Biotech (Beijing) Co., Ltd.).

[0041] Using apple genomic DNA as a template, PCR amplification and detection were performed using the detection reagents of Example 2. The PCR amplification system is shown in Table 1.

[0042] Table 1: PCR amplification system The reaction conditions on the PCR instrument were set as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 90 sec, for 34 cycles; 72℃ final extension for 5 min.

[0043] Sanger sequencing was performed on the amplified products. The genotype at the SNP site was determined based on the sequencing results. The nitrogen utilization rate of apples was judged based on the genotype at the SNP site: apple materials whose sequencing results correspond to the T / T or T / C genotype at the 261st base of the sequence shown in SEQ ID NO.1 have a higher nitrogen utilization rate than apple materials whose sequencing results correspond to the C / C genotype at the 261st base of the sequence shown in SEQ ID NO.1.

[0044] At the same time, the nitrogen utilization rate of the apples to be tested was determined.

[0045] 2. Test Results: The results of genotyping and nitrogen utilization rate determination for different apple varieties are shown in Table 2.

[0046] Table 2: Results of apple genotype and nitrogen use efficiency determination The results showed that apple materials with the genotype T / T or T / C at the SNP locus had higher measured nitrogen utilization rates than apple materials with the genotype C / C at the SNP locus.

[0047] The identification results based on molecular markers were completely consistent with the nitrogen use efficiency measurement results. This demonstrates that the molecular markers of the present invention are accurate and reliable for identifying the nitrogen use efficiency of apples.

[0048] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of SNP molecular markers in screening or identifying nitrogen-efficient apple materials, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the 261st base from the 5' end of the sequence is the SNP site, and its base polymorphism is C or T; The SNP sites are nitrogen-efficient apple materials corresponding to the TT or CT genotypes.

2. The application of the detection reagent in screening or identifying apple materials with high nitrogen utilization rate, characterized in that, The detection reagent comprises: a primer pair for detecting the SNP molecular marker of claim 1, wherein the primer pair consists of primer F shown in SEQ ID NO.2 and primer R shown in SEQ ID NO.3; The method for screening or identifying apple materials with high nitrogen utilization is as follows: Using the genomic DNA of the apple to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the nitrogen use efficiency of the apple materials was identified based on the sequencing results, and apple materials with high nitrogen use efficiency were screened. The sequencing results of the amplified product correspond to apple materials with the TT or CT genotype at position 261 of the sequence shown in SEQ ID NO.1, and their nitrogen utilization rate is higher than that of apple materials with the CC genotype at position 261 of the sequence shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The PCR amplification system consisted of: 12.5 µL of 2×Phanta Max MasterMix, 1 µL of primer F, 1 µL of primer R, 1 µL of DNA template, and RNase-free ddH2O to a final volume of 25 µL.

4. The application according to claim 2, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 90 sec, for 34 cycles; 72℃ final extension for 5 min.

5. The application according to claim 2, characterized in that, The detection reagent also includes: PCR amplification reagent; the PCR amplification reagent includes: 2×Phanta Max Master Mix, DNA template and RNase-free ddH2O.

Images