Method, kit, biosensor for the detection of 17-beta estradiol and use thereof

Abstract

This application provides a method for detecting 17-β estradiol, comprising: S100, providing a composite probe, the composite probe including magnetic beads and modified with green fluorescent groups and red fluorescent groups; S200, providing a solid support containing anodized aluminum oxide nanoporous membrane; S300, mixing the composite probe with a sample solution containing 17-β estradiol, performing magnetic separation after the reaction, collecting the magnetic bead precipitate and adding buffer solution again to obtain a magnetic bead suspension; S400, dropping the magnetic bead suspension onto the anodized aluminum oxide nanoporous membrane; S500, acquiring fluorescence images of the green and red fluorescence channels using a fluorescence microscope, and analyzing the average green light intensity I... Green and average red light intensity I Red Calculate the ratio Ratio=I Red / I Green A kit, sensor, and application for detecting 17-β estradiol are also provided.

Description

Technical Field

[0001] This application relates to the field of biochemical analysis technology, and in particular to methods, kits, biosensors and applications for the detection of 17-β estradiol. Background Technology

[0002] 17-β estradiol (E2) is an endocrine disruptor (EDC). Excessive E2 entering the environment and water can negatively impact the growth, metabolism, and reproduction of organisms, and may even trigger diseases such as breast cancer in humans. Existing methods for E2 detection mainly include high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC / MS), and enzyme-linked immunosorbent assay (ELISA). However, chromatographic methods rely on expensive instruments and involve cumbersome pretreatment; ELISA methods suffer from drawbacks such as antibody denaturation, large batch-to-batch variability, and susceptibility to cross-reactivity with structural analogs.

[0003] Nucleic acid aptamers, as novel recognition molecules, have advantages such as broad target range, high stability, and ease of synthesis and modification, and are widely used in small molecule detection, often in conjunction with fluorescent aptamer sensors. However, existing detection methods often suffer from issues such as susceptibility to interference from single fluorescence, weak signals, and uneven distribution, making accurate quantitative analysis of 17-β estradiol impossible. Summary of the Invention

[0004] In view of this, the purpose of this application is to provide a method, kit, biosensor and application for the detection of 17-β estradiol that is not affected by single fluorescence interference, has a strong and uniformly distributed detection signal.

[0005] To achieve the above objectives, this application provides a method for detecting 17-β estradiol, comprising the following steps:

[0006] S100 provides a composite probe, the composite probe comprising magnetic beads and modified with green fluorescent groups and red fluorescent groups; S200 provides a solid-phase support containing anodized aluminum oxide nanoporous membranes; S300, the composite probe is mixed with the test sample solution containing 17-β estradiol. After the reaction is completed, magnetic separation is performed, the magnetic bead precipitate is collected and buffer solution is added again to obtain the magnetic bead suspension. S400, the magnetic bead suspension is dropped onto the anodic alumina nanoporous membrane; S500 acquires fluorescence images of the green and red fluorescence channels, and measures the average green light intensity I. Green and average red light intensity I Red Calculate the ratio Ratio = I Red / I GreenBased on the inverse logarithmic relationship between the Ratio value and the concentration of 17-β estradiol, accurate quantification of 17-β estradiol can be achieved.

[0007] In one embodiment, the method of providing the composite probe in step S100 includes: S110 provides streptavidin-modified magnetic beads; S120 provides an anchoring internal reference chain, wherein the 5' end of the anchoring internal reference chain is modified with biotin and the 3' end is modified with a green fluorescent group; S130 provides a signal recognition chain, wherein the 5' end of the signal recognition chain is modified with a red fluorescent group, and the signal recognition chain can specifically bind 17-β estradiol; S140, streptavidin-modified magnetic beads are combined with the anchoring internal reference chain, and then a signal recognition chain is added for hybridization assembly to obtain the composite probe.

[0008] In one embodiment, the sequence of the signal recognition chain is: 5'- ATACGAGCTTGTTCAATACGAAGGGATGCCGTTTG -3'.

[0009] In one embodiment, the signal recognition chain has no cross-binding response to progesterone and / or testosterone. In one embodiment, the method for preparing the solid support containing the anodic alumina nanoporous membrane in step S200 includes: S210, anodized aluminum nanoporous membrane is fixed on a transparent substrate; S220, a poly-lazy ine solution is added dropwise to the surface of an anodized aluminum nanoporous membrane for positive charge modification; S230, clean and air dry before use.

[0010] In one embodiment, step S210, which involves fixing the anodic aluminum oxide nanoporous membrane onto the transparent substrate, includes: S211, add ultrapure water droplets to a transparent substrate; S212, anodized aluminum nanoporous membrane is laid flat on an ultrapure water droplet; S213, using an oven for drying and fixing, wherein the drying temperature is 55-60℃.

[0011] In one embodiment, the mass concentration of poly-lazy ine added in step S220 is 0.1%.

[0012] A kit for detecting 17-β estradiol includes a composite probe used in the aforementioned method and a solid support containing an anodic aluminum oxide nanoporous membrane.

[0013] A biosensor for detecting 17-β estradiol includes: a composite probe comprising magnetic beads and nucleic acid aptamers immobilized on the magnetic beads, the nucleic acid aptamers being modified with green fluorescent groups and red fluorescent groups; and a solid support on which an anodic aluminum oxide nanoporous membrane is immobilized.

[0014] Application of the methods, kits, or biosensors described in any of the preceding items for the detection of 17-β estradiol for non-diagnostic and therapeutic purposes.

[0015] As can be seen from the above, the 17-β estradiol detection method provided in this application embodiment has the following advantages: First, the composite probe is simultaneously modified with green and red fluorescence. Compared with the single fluorescence used in traditional fluorescence detection, the dual-channel fluorescence detection provided in this application embodiment is less susceptible to interference from light source fluctuations, probe concentration errors, and environmental factors, resulting in higher reproducibility of the detection results. Second, this application uses anodized aluminum nanoporous membrane as the substrate for fluorescence reading after magnetic separation. The unique vertical pore structure of the anodized aluminum nanoporous membrane promotes rapid liquid infiltration and allows magnetic beads to be evenly spread on the membrane surface. This effectively avoids the coffee ring effect, which previously occurred on traditional carriers, characterized by extremely weak signals in the central region and extremely uneven distribution. This achieves uniform signal spreading and confinement enhancement, resulting in more accurate and reliable measurement data. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in this application or related technologies, the drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the drawings described below are only embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is a schematic diagram of the detection method for 17-β estradiol in this application.

[0018] Figure 2 These are flowcharts corresponding to Embodiments 1 to 4 of this application. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with specific embodiments and the accompanying drawings.

[0020] It should be noted that, unless otherwise defined, the technical or scientific terms used in the embodiments of this application should have the ordinary meaning understood by a person skilled in the art to which this application pertains. Terms such as "comprising" or "including" mean that the element or object preceding the word encompasses the elements or objects listed following the word and their equivalents, without excluding other elements or objects.

[0021] Please refer to Figure 1 This application provides a method for detecting 17-β estradiol, comprising the following steps: S100 provides a composite probe, which includes magnetic beads and is modified with green fluorescent groups and red fluorescent groups; S200 provides a solid support on which an anodic aluminum oxide nanoporous membrane is fixed; S300: The composite probe is mixed with the sample solution containing 17-β estradiol. After the reaction is complete, magnetic separation is performed, and the magnetic bead precipitate is collected. S400, add buffer solution to the magnetic bead precipitate to obtain magnetic bead suspension; S500, magnetic bead suspension is dropped onto an anodic alumina nanoporous membrane on a solid support; S600 acquires fluorescence images of the green and red fluorescence channels, and measures the average green light intensity (I0). Green ) and average red light intensity (I Red ), calculate the ratio Ratio = I Red / I Green Based on the inverse logarithmic relationship between the Ratio value and the concentration of 17-β estradiol, precise quantification of 17-β estradiol can be achieved.

[0022] The method for detecting 17-β estradiol provided in this application has two aspects: First, the composite probe is simultaneously modified with green and red fluorescence. Compared with the single fluorescence used in traditional fluorescence detection, the dual-channel fluorescence detection provided in this application is less susceptible to interference from light source fluctuations, probe concentration errors, and environmental factors, resulting in higher reproducibility of the detection results. Second, this application uses anodized aluminum nanoporous membrane as the substrate for fluorescence reading after magnetic separation. The unique vertical pore structure of the anodized aluminum nanoporous membrane promotes rapid liquid infiltration and allows magnetic beads to be evenly spread on the membrane surface. This effectively avoids the coffee ring effect, which previously occurred on traditional carriers, characterized by extremely weak signals in the central region and extremely uneven distribution. This achieves uniform signal spreading and confinement enhancement, resulting in more accurate and reliable measurement data.

[0023] In one embodiment, the specific steps of providing the composite probe in step S100 may further include: S110 provides streptavidin-modified magnetic beads. Preferably, the provided magnetic beads are washed multiple times, for example, 3-5 times, using binding buffer (SBB).

[0024] S120 provides an anchored internal reference strand (cDNA) with one end (e.g., the 5' end) modified with biotin and the other end (e.g., the 3' end) modified with a green fluorescent group. The green fluorescence can be FAM, and it can serve as a constant internal reference in subsequent detection. The sequence of the anchored internal reference strand can be as shown in SEQ ID NO.1, specifically 5'-TTTTTTCTAGCATTGGGT AGGACGC-3'.

[0025] S130 provides a signal recognition chain (Aptamer) with one end modified with a red fluorescent group (for example, when the 5' end of the anchoring internal reference chain is modified with biotin and the 3' end is modified with a green fluorescent group, the 5' end of the signal recognition chain can be modified with a red fluorescent group), and the signal recognition chain can specifically bind to 17-β estradiol. The red fluorescent group can be Texas Red.

[0026] Preferably, the sequence of the signal recognition chain is as shown in SEQ ID NO.2, specifically: 5'-ATACGAGCTTGTTCAATACGAAGG GATGCCGTTTG -3'. This truncated sequence has extremely high specificity and no cross-binding reaction with structural analogs such as progesterone and / or testosterone, which can greatly reduce the error in results caused by the presence of progesterone or testosterone.

[0027] In step S140, streptavidin-modified magnetic beads are combined with an anchoring internal reference chain, followed by hybridization assembly with a signal recognition chain to obtain a composite probe with both green and red fluorescent groups on its surface. The amount of the anchoring internal reference chain added relative to the magnetic beads can be appropriate or excessive, preferably excessive, to increase its binding with the magnetic beads. Optionally, the signal recognition chain is added for hybridization assembly under room temperature and light-protected conditions. In this step, a washing step can be added before and after the addition of the signal recognition chain for hybridization assembly. Washing before adding the signal recognition chain can remove free anchoring internal reference chains, reducing the consumption of subsequent signal recognition chains and saving costs. Preferably, the assembled magnetic composite probe needs to be thoroughly cleaned, for example, by rigorously washing the magnetic beads 4-5 times with buffer solution to completely remove unhybridized free signal recognition chains and reduce subsequent experimental errors.

[0028] In one embodiment, the method for preparing a solid support containing anodized aluminum nanoporous membrane in step S200 may include: S210, fix the anodic aluminum oxide nanoporous membrane onto a transparent substrate. Specifically, the transparent substrate can be a quartz glass slide. This step may further include the following steps: S211, drop ultrapure water onto the transparent substrate; S212, lay the anodic aluminum oxide nanoporous membrane flat on the ultrapure water droplet, preferably, the anodic aluminum oxide nanoporous membrane can be circular; S213, dry and fix it using an oven, wherein the drying temperature of the oven can be 55-60℃, for example, 55℃, 57℃, or 60℃.

[0029] S220, a polylysine solution is dropped onto the surface of an anodic alumina nanoporous membrane for positive charge modification, followed by incubation at room temperature for 30 min. Optionally, the mass concentration of the polylysine solution can be 0.1%. Optionally, the molecular weight of the polylysine can be between 150,000 and 300,000, specifically 150,000, 200,000, 250,000, 300,000, etc. Adding a polylysine (PLL) solution to the surface of an anodic alumina (AAO) nanoporous membrane for positive charge modification has several beneficial effects: Firstly, strong electrostatic adsorption can be used to achieve two-dimensional monolayer fixation of magnetic beads. The surface of the bare AAO nanoporous membrane is weakly charged, while the surface of the magnetic beads modified with nucleic acid probes (rich in phosphate backbone) carries a strong negative charge. After adding PLL rich in amino groups, the AAO... The surface of the nanoporous membrane is endowed with a dense layer of positive charge. When magnetic bead suspension droplets are added to the surface of the AAO nanoporous membrane, the negatively charged magnetic beads are instantly and firmly "anchored" to the positively charged AAO nanoporous membrane surface due to strong attraction between opposite charges (electrostatic adsorption). This completely eliminates the Brownian motion of the magnetic beads in the buffer solution, ensuring that all magnetic beads are on the same focal plane of the microscope, greatly improving the stability and accuracy of fluorescence signal reading. On the other hand, it further helps to overcome the "coffee ring effect" and achieve uniform dispersion of the target surface. During the natural evaporation and drying process of the droplets, the "coffee ring effect" caused by capillary flow is easily generated, causing the magnetic beads to aggregate and stack towards the edge. In this application, a poly-L-lysine (PLL) positive charge layer is added. Its electrostatic anchoring force on the magnetic beads is much greater than the capillary drag force of the liquid, thus effectively resisting the edge flow of the liquid. This allows the magnetic beads to achieve uniform monolayer dispersion on the AAO nanoporous membrane. This avoids self-absorption of fluorescence signals and spatial occlusion caused by magnetic bead aggregation. Finally, it provides a flexible hydration microenvironment to protect the probe's fluorescence performance. PLL, as a polymer, forms a nanoscale flexible hydrophilic buffer layer after being attached to the rigid surface of the AAO nanoporous membrane. This structure can retain trace amounts of water molecules at the bottom of the magnetic beads in a nearly dry state, maintaining the hydration microenvironment required by the nucleic acid aptamers and fluorescent groups, effectively mitigating the extreme dehydration quenching of fluorescent molecules, and further ensuring detection sensitivity.

[0030] S230, clean and air-dry before use. Air-drying methods may include nitrogen blowing or natural air drying.

[0031] In step S300 of one embodiment, after the composite probe is mixed with the test sample solution containing 17-β-estradiol, the 17-β-estradiol can specifically bind to the signal recognition chain with a red fluorescent group in the composite probe, causing a conformational change in the signal recognition chain, which then detaches from the anchored internal control chain on the magnetic bead and enters the liquid phase in a free state. After the reaction is complete, an external magnetic field can be applied for magnetic separation, and the supernatant containing free 17-β-estradiol and the signal recognition chain with a red fluorescent group is discarded, while the magnetic bead precipitate is retained. The total amount of green fluorescent groups on the magnetic beads, which serve as a constant internal control, remains unchanged, while the amount of red fluorescent groups, which serve as a dynamic parameter, decreases.

[0032] In one embodiment, step S400, the magnetic bead suspension is vertically dropped onto the anodic aluminum oxide nanoporous membrane. Utilizing the capillary action of the anodic aluminum oxide nanopores, the magnetic bead suspension can rapidly seep vertically downwards. The magnetic beads and surface fluorescent molecules are uniformly trapped and spread evenly on the membrane surface, thereby completely eliminating the "coffee ring effect" caused by droplet evaporation on traditional solid-phase carriers.

[0033] In one embodiment, step S500 involves acquiring green and red fluorescence images using a fluorescence microscope. This should be done under identical conditions, with the green and red fluorescence images acquired at the same focal length and within the same field of view. This minimizes experimental errors caused by environmental factors such as operation and instrumentation. Specifically, after acquiring the green fluorescence image, while maintaining the same focal length and field of view, the instrument can be switched to a red filter, and a red fluorescence image of the same field of view can be captured. The detected red / green signal ratio (Ig) is then extracted. Red / I Green This method can be used to quantitatively analyze the content of 17-β estradiol, which can offset systematic errors caused by uneven magnetic bead addition, light source aging, absolute volume deviation, etc., and significantly improve the reproducibility and reliability of 17-β estradiol detection results.

[0034] The method for detecting 17-β estradiol provided in this application has two advantages: firstly, the complex target identification process is carried out in a homogeneous solution, which speeds up the reaction rate and saves time; secondly, the signal reading is carried out on a solid support containing anodized aluminum nanoporous membrane, which makes it easier to automatically read the signal under a microscope. The entire detection process utilizes both the efficiency of homogeneous reaction and the ease of use of solid-phase detection, making it convenient and fast.

[0035] This application also provides a kit for detecting 17-β estradiol, comprising a composite probe used in any of the aforementioned methods and a solid-phase support containing an anodic alumina nanoporous membrane. The composite probe may further comprise streptavidin-modified magnetic beads, an anchoring internal reference chain, and a signal recognition chain. One end of the anchoring internal reference chain is modified with biotin and fixed to the magnetic beads, while the other end is modified with a green fluorescent group. The signal recognition chain can hybridize with the anchoring internal reference chain and has a red fluorescent group modified at one end.

[0036] This application also provides a biosensor for detecting 17-β estradiol, comprising: a composite probe including magnetic beads and modified with green fluorescent groups and red fluorescent groups; and a solid support on which an anodic aluminum oxide nanoporous membrane is fixed.

[0037] This application also provides the application of any of the foregoing methods, kits, or biosensors in the detection of 17-β estradiol for non-diagnostic and therapeutic purposes.

[0038] The technical solution of this application will be further described below with reference to specific implementation methods.

[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. A flowchart of the methods can be found here. Figure 2 .

[0040] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0041] Example 1: Construction of a dual-fluorescent magnetic composite probe 1) Prepare nucleic acid sequences: Anchored internal reference strand (cDNA): 5'-Biotin-cDNA-FAM-3' (one end modified with biotin-binding magnetic beads, and the other end modified with FAM to emit stable green light); wherein, the sequence of the anchored internal reference strand can be (5'to3'): TTTTTTCTAGCATTGGGTAGGACGC.

[0042] Signal recognition chain (Aptamer): 5'-TexasRed-Alsager35mer-3' (specifically, it can be 5'-TexasRed-ATACGAGCTTGTTCAATACGAAGGGATGCCGTTTG-3', which modifies TexasRed to emit red light. The signal recognition chain can specifically bind to E2).

[0043] 2) Functionalization and assembly of magnetic beads: Washing the magnetic beads: Take an appropriate amount (10 mg / mL, 30 µL) of streptavidin magnetic nanospheres (MNPs) into a 1.5 mL EP tube and wash three times with binding buffer (PBS-T). The streptavidin magnetic nanospheres (MNPs) were purchased from Beaver Biotechnology. The microspheres had a particle size of 1 μm and were in aqueous solution form.

[0044] Anchoring cDNA: Add an excess of the anchoring internal control strand (Biotin-cDNA-FAM) and incubate at room temperature for 30 minutes. Separate on a magnetic rack, discard the supernatant, and wash three times (at this point, the magnetic beads will be illuminated green). Hybridization aptamers: Add the signal recognition chain (TexasRed-Aptamer) to the tube and incubate for hybridization at room temperature in the dark for 1 hour; place the tube on a magnetic rack, discard the supernatant, and wash the magnetic beads thoroughly with buffer 4-5 times to completely remove unhybridized free red aptamers; the molar ratio of probes can be (A-FM):(P-TR35) = 3.4:1.

[0045] Volume adjustment and ready for use: Resuspend the assembled "dual fluorescent magnetic composite probe" in a quantitative amount of SBB buffer and store at 4°C in the dark for later use.

[0046] Example 2: Preparation of AAO solid support (AAO Carrier Functionalization) 1) Applying the film: Take a clean glass slide, add 1 drop of ultrapure water, lay the circular AAO film flat on the water drop, and put it in a 60°C oven to dry and fix it.

[0047] 2) Positive charge modification: Add 50 μL of 0.1% polylysine (PLL) solution to the surface of the AAO membrane and incubate at room temperature for 30 minutes.

[0048] 3) Cleaning and drying: Gently rinse the AAO surface with ultrapure water, then blow it dry with nitrogen or let it air dry naturally for later use.

[0049] Example 3: Core Competitive Reaction and Magnetic Bead Retention 1) Sample addition: Prepare a series of 1.5 mL EP tubes and add equal volumes and concentrations of the dual fluorescent magnetic composite probe suspension prepared in Example 1.

[0050] 2) Competitive substitution: Different concentrations of 17-β estradiol (E2) standard solutions were added to the experimental group; an equal volume of blank buffer was added to the blank control group; all systems were made up to a total volume of 100 μL with buffer and incubated at room temperature in the dark for 30-45 minutes.

[0051] 3) Magnetic separation and cleaning: Place all EP tubes on a magnetic rack and let stand for 3 minutes; discard all supernatant (containing free red light aptamers and E2 complexes, to be treated as waste); add 100 μL buffer, gently wash the magnetic beads once, perform magnetic separation again and discard the supernatant to eliminate background interference.

[0052] 4) Resuspension of magnetic beads: Add 20 μL of buffer solution to the magnetic bead precipitate in each tube and gently blow to resuspend it evenly.

[0053] Example 4: AAO Dropping and Dual-Channel Ratio Microscopy 1) Sample preparation by drop addition: 20 μL of the suspension containing magnetic beads obtained in Example 3 is vertically dropped into the center of the functionalized AAO membrane. Due to the capillary action of the micropores of AAO, the liquid will rapidly seep vertically downwards, and the magnetic beads will be evenly trapped and spread on the membrane surface. Allow to air dry naturally in the dark.

[0054] 2) Microscope dual-channel acquisition: Place the slide containing the AAO film under an upright fluorescence microscope (such as a Leica platform). Positioning and Internal Reference Channel (Green): Switch to the FITC filter (excitation around 488nm) and observe the FAM green light. Use the green light channel for precise focusing and take images. Theoretically, the green light intensity of samples of all concentrations should be basically the same, representing the total amount of magnetic beads in the field of view. Signal Channel (Red): Keep the focal length and field of view absolutely unchanged, switch to the TexasRed filter (excitement at around 590nm), and capture a red light image of the same field of view.

[0055] 3) Data analysis and standard curve plotting: Using ImageJ or the microscope's built-in software, measure the average green fluorescence intensity (IL) within the same region of interest (ROI). Green ) and average red fluorescence intensity (I Red ), calculate the ratio: Ratio = I Red / I Green ; The blank group had the highest Ratio value; as the E2 concentration increased, the number of red aptamers on the magnetic beads decreased, and the Ratio value decreased in a gradient manner. An inverse standard curve was fitted with the logarithm of the E2 concentration on the x-axis and the Ratio value on the y-axis.

[0056] Example 517 - β-estradiol sensitivity detection response verification 17-β-estradiol standard solutions with concentrations of 0 nM, 0.1 nM, and 1 nM were prepared for detection. The ratio of red to green fluorescence intensity at each concentration (Ratio = I) was extracted. Red / IGreen ).

[0057] Experimental results show that, in the blank control group (0 nM), the probe remained intact, with a mean Ratio of approximately 0.97. However, upon the addition of only 0.1 nM of trace 17-β-estradiol, the Ratio value quenched rapidly, dropping sharply to around 0.13, and remained saturated at a concentration of 1 nM (Ratio approximately 0.10). These results demonstrate that the sensor described in this invention exhibits exceptionally sensitive quenching response to extremely low concentrations (picomolar levels, <0.1 nM) of 17-β-estradiol, making it suitable for early warning detection of trace environmental endocrine disruptors.

[0058] Example 6: High specificity detection of non-target interference by the sensor Bisphenol A (BPA), a common nonsteroidal endocrine disruptor found in environmental water bodies, was selected as a control sample. A BPA standard with a final concentration as high as 50 nM was added to the detection system. The sensor was used for detection, and the ratio value was calculated.

[0059] The results showed that the Ratio value of the 50 nM BPA interference group was approximately 1.05, with no significant difference in signal compared to the blank control group (0 nM estradiol); however, the sample group containing extremely low concentrations of estradiol experienced significant quenching. This example fully demonstrates that the competitive substitution system designed in this invention has extremely high specificity for estradiol-like substances, is unaffected by conventional pollutants, and exhibits excellent anti-interference ability in complex environments.

[0060] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of this disclosure (including the claims) is limited to these examples; within the framework of this disclosure, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of the embodiments of this disclosure as described above, which are not provided in detail for the sake of brevity.

[0061] Although this disclosure has been described in conjunction with specific embodiments thereof, many substitutions, modifications and variations of these embodiments will be apparent to those skilled in the art from the foregoing description.

[0062] This disclosure is intended to cover all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the scope of protection of this disclosure.

Claims

1. A method for detecting 17-β estradiol, characterized in that, Includes the following steps: S100 provides a composite probe, the composite probe comprising magnetic beads and modified with green fluorescent groups and red fluorescent groups; S200 provides a solid-phase support containing anodized aluminum oxide nanoporous membranes; S300, the composite probe is mixed with the test sample solution containing 17-β estradiol. After the reaction is completed, magnetic separation is performed, the magnetic bead precipitate is collected and buffer solution is added again to obtain the magnetic bead suspension. S400, the magnetic bead suspension is dropped onto the anodic alumina nanoporous membrane; S500 acquires fluorescence images of the green and red fluorescence channels, and measures the average green light intensity I. Green and average red light intensity I Red Calculate the ratio Ratio=I Red / I Green .

2. The detection method according to claim 1, characterized in that, The method for providing the composite probe in step S100 includes: S110 provides streptavidin-modified magnetic beads; S120 provides an anchoring internal reference chain, wherein one end of the anchoring internal reference chain is modified with biotin and the other end is modified with a green fluorescent group; S130 provides a signal recognition chain, one end of which is modified with a red fluorescent group, and the signal recognition chain can specifically bind to 17-β estradiol; S140, streptavidin-modified magnetic beads are combined with the anchoring internal reference chain, and then a signal recognition chain is added for hybridization assembly to obtain the composite probe.

3. The detection method according to claim 2, characterized in that, The sequence of the signal recognition chain is: 5'- ATACGAGCTTGTTCAATACGAAGGGATGCCGTT TG -3'.

4. The detection method according to claim 2 or 3, characterized in that, The signal recognition chain does not cross-bind with progesterone and / or testosterone.

5. The detection method according to claim 1, characterized in that, The method for preparing the solid support containing the anodic alumina nanoporous membrane in step S200 includes: S210, anodized aluminum nanoporous membrane is fixed on a transparent substrate; S220, positive charge modification is performed by adding polylazy ine solution to the surface of anodized aluminum nanoporous membrane; S230, clean and air dry before use.

6. The detection method according to claim 5, characterized in that, Step S210, which involves fixing the anodic aluminum oxide nanoporous membrane onto the transparent substrate, includes: S211, add ultrapure water droplets to a transparent substrate; S212, Anodized aluminum oxide nanoporous membrane is laid flat on the ultrapure water droplet; S213, drying and fixing, wherein the drying temperature is 55-60℃.

7. The detection method according to claim 5, characterized in that, The mass concentration of the polyoxoline solution added in step S220 is 0.1%.

8. A kit for detecting 17-β estradiol, characterized in that, The method includes the composite probe used in the detection method of 17-β estradiol according to any one of claims 1 to 7 and the solid support containing anodized aluminum nanoporous membrane.

9. A biosensor for detecting 17-β estradiol, characterized in that, include: A composite probe comprising magnetic beads modified with green and red fluorescent groups; A solid support on which an anodic aluminum oxide nanoporous membrane is fixed.

10. The use of the method for detecting 17-β estradiol according to any one of claims 1 to 7, the kit according to claim 8, or the biosensor according to claim 9 in the detection of 17-β estradiol for non-diagnostic and therapeutic purposes.

Images