Foot-and-mouth disease virus 3Dpol recombinant protein, polyclonal antibody and preparation and application thereof

Abstract

The application belongs to the technical field of antibody preparation, and particularly relates to a foot-and-mouth disease virus 3Dpol recombinant protein, polyclonal antibody and preparation and application. The full-length sequence of O type FMDV 3Dpol gene is inserted into a pET28a vector to obtain a pET28a-3Dpol recombinant expression plasmid; then the recombinant expression plasmid is transformed into E. coli BL21 (DE3), 3Dpol recombinant protein is expressed by IPTG induction, and the 3Dpol recombinant protein is obtained by nickel column purification. The purified 3Dpol recombinant protein is further used for immunization of BALB / c mice to obtain polyclonal antibody, the antibody can be combined with O type FMDV 3Dpol recombinant protein, the antibody titer reaches 1:640000, and the antibody can be used for Western blot or ELISA detection, thereby providing an important tool for further exploration of the function of 3Dpol protein in FMDV.

Description

Technical Field

[0001] This invention belongs to the field of antibody preparation technology, specifically relating to a foot-and-mouth disease virus 3Dpol recombinant protein, polyclonal antibody, and their preparation and application. Background Technology

[0002] Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious disease caused by the foot-and-mouth disease virus (FMDV), which can cause vesicular lesions in cloven-hoofed animals such as pigs. FMDV has a wide host range and a high mutation rate, making FMD prevention and control exceptionally difficult. Therefore, effective vaccines are a crucial means of controlling FMDV outbreaks.

[0003] FMDV is a single-stranded positive-sense RNA virus belonging to the genus Foot-and-Mouth Diseasevirus (FMDV) of the family Picornaviridae. The viral nucleic acid is coated within a core composed of capsid proteins, forming a spherical particle with an icosahedral structure, approximately 30 nm in diameter. The FMDV genome is approximately 8.5 kb in length, containing 5' untranslated regions (UTRs), 3' UTRs, and an open reading frame (ORF). The 5' UTR sequences are highly conserved in the FMDV genome and are commonly used clinically for FMDV detection. The ORF encodes a precursor polyprotein, which is cleaved by the viral-encoded protease 3C into three structural proteins (VP1, VP3, and VP0) and ten non-structural proteins (Lpro, 2A, 2B, 2C, 3A, 3B1-3, 3Cpro, and 3Dpol).

[0004] The non-structural protein 3Dpol of FMDV is a 470-amino acid RNA polymerase encoded by viral RNA. It is a polymerase required for FMDV replication and plays a crucial role in the replication of foot-and-mouth disease virus. Furthermore, 3Dpol protein is type-independent and can serve as a highly sensitive antigen for detecting infected animals. Studies have also shown that FMDV 3Dpol protein possesses T-cell epitopes, making it a potential immune enhancer and adjuvant. As a key RNA-dependent RNA polymerase in FMDV replication, the expression level and functional state of 3Dpol are closely related to the virus's replication capacity. Therefore, obtaining specific anti-3Dpol antibodies is of great significance for research on FMDV infection mechanisms, vaccine quality control, and the development of potential diagnostic and therapeutic targets.

[0005] In existing technologies, 3Dpol recombinant proteins are mostly expressed in the form of inclusion bodies, which requires complex denaturation and renaturation operations and easily destroys the protein's native conformation and immunogenicity. The reported 3Dpol polyclonal antibodies generally have a titer of less than 1:000, insufficient sensitivity, and most cannot specifically recognize the native 3Dpol protein in FMDV-infected cells. They also lack standardized preparation systems, have poor batch stability, and are difficult to meet the needs of practical applications. Summary of the Invention

[0006] To overcome the shortcomings of the prior art, the primary objective of this invention is to provide a foot-and-mouth disease virus 3Dpol recombinant protein, which exists mainly in the form of a soluble protein with a concentration of 1.26 mg / mL, meeting the requirements for subsequent immunization experiments.

[0007] Another object of the present invention is to provide a method for preparing the above-mentioned foot-and-mouth disease virus 3Dpol recombinant protein.

[0008] Another objective of this invention is to provide a polyclonal antibody against the 3Dpol protein of foot-and-mouth disease virus, which has a titer of over 1:640,000, strong specificity, and can be adapted to multiple detection scenarios, providing core technical support for FMDV prevention and control.

[0009] A fourth objective of this invention is to provide a method for preparing the above-mentioned polyclonal antibody against the foot-and-mouth disease virus 3Dpol protein.

[0010] The fifth object of the present invention is to provide the application of the above-mentioned foot-and-mouth disease virus 3Dpol recombinant protein and the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein.

[0011] The objective of this invention is achieved through the following technical solution: A recombinant 3Dpol protein of foot-and-mouth disease virus, the amino acid sequence of which is shown in SEQ ID No. 1.

[0012] The gene encoding the aforementioned foot-and-mouth disease virus 3Dpol recombinant protein has the nucleotide sequence shown in SEQ ID No. 2.

[0013] One recombinant vector is obtained by linking the nucleotide sequence of the gene encoding the foot-and-mouth disease virus 3Dpol recombinant protein to a vector.

[0014] The preferred carrier is pET28a.

[0015] A strain expressing the foot-and-mouth disease virus 3Dpol recombinant protein was obtained by transforming the above recombinant vector into Escherichia coli BL21(DE).

[0016] The method for preparing the foot-and-mouth disease virus 3Dpol recombinant protein includes the following steps: (1) The nucleotide sequence of the gene encoding the foot-and-mouth disease virus 3Dpol recombinant protein was ligated to the vector to obtain the recombinant vector; (2) The recombinant vector obtained in step (1) was transformed into Escherichia coli BL21(DE) to obtain the pET28a-3Dpol recombinant engineered strain; (3) The pET28a-3Dpol recombinant engineered strain was cultured to OD using conventional methods. 600 IPTG was added to induce expression when the concentration was 0.4-0.8. (4) After the induction expression is completed, centrifuge, collect the bacterial cell pellet, add lysis buffer to lyse the bacterial cell pellet, centrifuge, and collect the supernatant; (5) The supernatant collected in step (4) was purified by nickel column and dialyzed with imidazole to obtain foot-and-mouth disease virus 3Dpol recombinant protein.

[0017] The preferred culture conditions in step (3) are 37℃ and 200 r / min constant temperature shaking culture for 12 h.

[0018] The final concentration of IPTG in the system in step (3) is 1.0 mM, and the preferred induction time is 6 h.

[0019] The nickel pillars mentioned in step (5) are preferably Ni Smart Beads.

[0020] The preferred specific operation of the imidazole dialysis in step (5) is as follows: the protein solution purified by nickel column is added to a dialysis bag containing dialysis solution, and dialysis is performed stepwise at 4°C. The dialysis solution is replaced every 12 hours, and the concentration of imidazole in the dialysis solution is gradually reduced until it is 0.

[0021] The dialysate is a Tris buffer containing a gradient concentration of imidazole, wherein the gradient concentrations of imidazole are 25, 10, 5, and 0 mM. The Tris buffer contains the following components: 50 mM Tris, 500 mM NaCl, and pH=12.

[0022] A polyclonal antibody against foot-and-mouth disease virus 3Dpol protein was prepared by immunizing mice with the above-mentioned recombinant foot-and-mouth disease virus 3Dpol protein, collecting blood, centrifuging to obtain antiserum, which is the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein.

[0023] The method for preparing the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein includes the following steps: The above-mentioned foot-and-mouth disease virus 3Dpol recombinant protein was used as an antigen. It was mixed with ISA201VG adjuvant at a volume ratio of 1:1 at a dose of 100 μg protein / mouse. After emulsification, mice were immunized by intraperitoneal injection. A second immunization was performed on day 14 after the second immunization. A third immunization was performed 7 days after the second immunization. Blood was collected from the eyeballs from day 7 to 35 after the third immunization and centrifuged to obtain antiserum.

[0024] The application of the recombinant foot-and-mouth disease virus 3Dpol protein or the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein in the field of immunoassay.

[0025] The methods or applications described herein are not intended for the treatment or diagnosis of diseases.

[0026] The present invention has the following advantages and effects compared with the prior art: (1) The present invention uses reverse transcription-polymerase chain reaction (RT-PCR) to successfully clone the full-length sequence of type O FMDV 3Dpol gene; then the 3Dpol gene is inserted into the pET28a vector to construct the pET28a-3Dpol recombinant expression plasmid.

[0027] (2) In this invention, the correct pET28a-3Dpol recombinant expression plasmid was transformed into Escherichia coli BL21 (DE3), IPTG was used to induce the expression of 3Dpol recombinant protein, and the 3Dpol recombinant protein was purified by nickel column. The target protein was mainly expressed in soluble form, which provided a good foundation for subsequent purification and immunoassay experiments.

[0028] (3) The concentration of the purified 3Dpol recombinant protein of this invention is 1.26 mg / mL. Both the quality and concentration meet the standards required for animal immunization, which verifies the feasibility of the expression system and the stability of protein expression.

[0029] (4) In this invention, the purified 3Dpol recombinant protein was used to immunize BALB / c mice three times. Western blot was used to detect the affinity of the monoclonal antibody, and enzyme-linked immunosorbent assay (ELISA) was used to detect the serum titer of the mice. The results of the immunization experiment showed that after three immunizations, the serum antibody titer of the mice reached 1:640,000, indicating that the 3Dpol recombinant protein has good immunogenicity and can effectively induce the body to produce high-titer specific antibodies. Western blot detection showed that the prepared polyclonal antibody could clearly recognize the FMDV 3Dpol recombinant protein and showed a clear and specific band at 50-70 kDa with a clean background. This result not only verified the specificity and sensitivity of the antibody, but also provided a powerful tool for subsequent related immunoassays, studies on viral replication mechanisms, and exploration of the function of 3Dpol protein during FMDV infection.

[0030] (5) This invention not only established an efficient expression and purification system for FMDV 3Dpol protein, but also successfully prepared a high-titer, high-specificity polyclonal antibody, providing a reliable tool for subsequent FMDV molecular biology research and having broad application prospects. Attached Figure Description

[0031] Figure 1 This is a diagram showing the results of cloning and recombination of the 3Dpol gene. In the diagram, A represents the 3Dpol gene amplification product, 1: 3Dpol amplification product, 2: negative control; B represents the PCR identification of single-clone colonies, 1-5: 3Dpol single-clone colonies; C represents the double enzyme digestion identification of the recombinant plasmid, 1: pET28a-3Dpol double enzyme digestion product; M: DNA Maker.

[0032] Figure 2 These are SDS-PAGE and Western blot results of 3Dpol recombinant protein expression. In A, SDS-PAGE was used to detect the expression of 3Dpol recombinant protein; in B, Western blot was used to detect the expression of 3Dpol recombinant protein using His-tagged monoclonal antibody as the primary antibody; and in C, SDS-PAGE was used to detect the expression of 3Dpol recombinant protein at different induction times with 1mM IPTG.

[0033] Figure 3 The images show the SDS-PAGE and Western blot results of purified 3Dpol recombinant protein. In A, SDS-PAGE was used to detect purified 3Dpol recombinant protein; in B, Western blot was used to detect purified 3Dpol recombinant protein using His-tagged monoclonal antibody as the primary antibody; and in C, a standard curve was plotted using the BCA protein assay.

[0034] Figure 4 Figure A shows the immunogenicity and antibody titer results of the 3Dpol protein polyclonal antibody. In Figure A, PK-15 and BHK cells were infected with the O-type FMDV Cathay strain (MOI=1), with uninfected blank cells as a control. Total cell protein was separated at 6 and 12 h. The mouse serum containing the 3Dpol protein polyclonal antibody prepared in this invention was diluted 1:800 (v / v) as the primary antibody, and Western blot was used to detect 3Dpol protein in PK-15 and BHK cells. Figure B shows the antibody titer in the mouse serum containing the 3Dpol protein polyclonal antibody prepared in this invention, detected by ELISA at dilution ratios of 1:10000, 1:20000, 1:40000, 1:80000, and 1:160000. At ratios of 1:320000, 1:640000, and 1:1280000, the P / N values ​​are 7.204, 7.053, 7.059, 6.856, 6.131, 3.923, 2.652, and 1.966, respectively. Detailed Implementation

[0035] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0036] The main materials and methods involved in the embodiments are as follows: (1) Laboratory animals SPF-grade female BALB / c mice, 6 weeks old and weighing approximately 30g, were purchased from Southern Medical University in Guangdong Province. They were housed in the experimental animal center of South China Agricultural University. During the rearing period, the mice had free access to water and were fed normally. The rearing area was equipped with 24-hour circulating lighting, constant humidity, and a temperature controlled between 22 and 25°C.

[0037] (2) Cells, strains and viruses DH5α competent cells were purchased from Beijing Qingke Biotechnology Co., Ltd., and Escherichia coli BL21(DE3) was purchased from Shanghai Weidi Biotechnology Co., Ltd. FMDV O / CATHAY strain, pET28a expression plasmid, PK-15 cells, and BHK cells were all preserved in our laboratory; plasmids and cells are commercially available. All experimental procedures involving live FMDV were performed at the National Foot-and-Mouth Disease Reference Laboratory under biosafety level 3 (ABSL-3) conditions.

[0038] (3) Main reagents and instruments IPTG and kanamycin sulfate were purchased from Beijing Bio-Tech Co., Ltd., China; Iron Hammer Super Creeping Broth was purchased from Changzhou Boyi Biotechnology Co., Ltd.; T4 polynucleotide kinase (T4... Polynucleotide kinase (T4 PNK) and T4 ligase were purchased from Takara Corporation, Japan; horseradish peroxidase (HRP)-labeled goat anti-mouse IgG and BCA kits were purchased from Beyotime Biotechnology Co., Ltd., Shanghai; Freund's complete adjuvant was purchased from Sigma-Aldrich, USA; Ni Smart Beads were purchased from Changzhou Tiandi Renhe Biotechnology Co., Ltd.

[0039] Example 1

[0040] 1. Primer design (1) Primers for amplifying the FMDV 3Dpol gene were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the primer sequences are shown in Table 1.

[0041] Table 1. PCR primer sequences for the 3Dpol gene 3Dpol-F GGAATTCGGGTTGATCGTTGACACCAGAGA 3Dpol-R AAGGAAAAAAGCGGCCGCATGCGTCACCGCACACG 2. Amplification of the FMDV 3Dpol gene (1) Using the cDNA of the FMDV O / CATHAY strain as a template, PCR amplification was performed using the primers in Table 1 to obtain the full-length sequence of the FMDV 3Dpol gene (SEQ ID No. 3). The reaction system (25 μL) and reaction procedure are as follows: ① The reaction system (25 μL) consisted of: 12 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix (10 mM each), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 0.5 μL of Phanta Max Super Fidelity DNA polymerase, and 1 μL of template cDNA; ddH2O was added to bring the total volume to 25 μL.

[0042] ②The PCR reaction program was as follows: 98℃ for 30 seconds; 98℃ for 10 seconds, 70℃ for 20 seconds, 72℃ for 45 seconds, for a total of 35 cycles; 72℃ for 5 minutes.

[0043] (2) Perform nucleic acid electrophoresis on the target fragment obtained in step (1), and perform gel recovery and purification of the target band according to the instructions of the gel recovery kit.

[0044] 3. Construct the pET28a-3Dpol recombinant plasmid vector (1) Enzyme digestion: The target fragment (FMDV 3Dpol gene) and pET28a plasmid purified in step 2 were digested with EcoR I enzyme and Not I enzyme respectively according to conventional methods.

[0045] (2) Recombination ligation: The enzyme digestion products (target fragment and plasmid) obtained in step (1) are ligated using T4 ligase according to conventional methods.

[0046] (3) Transformation: The ligation product obtained in step (2) is transformed into DH5α competent cells using conventional methods and then spread onto a culture plate containing kanamycin-resistant bacteria. After the bacterial solution is absorbed by the plate, the plate is inverted and cultured overnight in a 37°C incubator.

[0047] (4) Screening and identification of positive clones: On the next day, a number of single clones were randomly selected from the transformation plate and colony PCR was performed to identify the 3Dpol recombinant positive single clone colonies. The recombinant plasmid of the positive single clone was extracted and the recombinant plasmid (pET28a-3Dpol) was identified by double digestion with EcoR I and Not I enzymes and screened to obtain the recombinant plasmid pET28a-3Dpol.

[0048] II. Test Results 1. Cloning of the FMDV 3Dpol gene The full-length fragment of the FMDV 3Dpol gene was amplified using primers 3Dpol-F and 3Dpol-R. The amplified band size was 1436 bp, which is consistent with the theoretical size (Figure 1A). Its nucleotide sequence is shown in SEQ ID No. 3.

[0049] The amino acid sequence of the 3Dpol recombinant protein (SEQ ID No. 1): GLIVDTRDVEERVHVMRKTKLAPTVAHGVFNPEFGPAALSNKDPRLNEGVILDDVIFSKHKGDTRMSEDDKALFRRCAADYASRLHSVLGTANAPLSVYEAIKGVDGLDAMEPDTAPGLPWALQGKRRGALIDFENGTVGPEVEAALKLMESREYKFVCQTFLKDEIRPLEKVRAGKTRIVDVLPVEHILYTRMMIGRFCAQMHSNNGPQIGSAVGCNPDVDWQRFGTHFAQYKNVWDVDYSAFDANHCSDAMNIMFEEVFRTEFGFHPNAEWILKTLVNTEHAYENKRIIVEGGMPSGCSATSIINTILNNIYVLYALRRHYEGVELDTYTMISYGDDIVVASDHDLDFEALKPHFKSLGQTITPADKSDKGFVLGHSITDVTFLKRHFHMDYGTGFYKPVMASKTLEAILSFARRGTIQEKLISVAGLAVHSGPDEYRRLFEPFQGLFEIPSYRSLYLRWVNAVCGDA The CDS sequence of the 3Dpol gene is shown below (SEQ ID No. 2, 1410bp): Full-length amplified FMDV 3Dpol gene sequence (SEQ ID No. 3, 1436bp): 2. Construction of pET28a-3Dpol vector After transforming the ligation product into DH5α competent cells, single colonies were selected for PCR verification. Of the five randomly selected single colonies, three showed amplification of a band of approximately 1400 bp, consistent with the theoretical size of the FMDV3Dpol target gene (Figure 1B). Double digestion of the pET28a-3Dpol recombinant plasmid with EcoRI and NotI enzymes yielded bands consistent with the lengths of the pET28a plasmid (approximately 5000 bp) and FMDV 3Dpol (1436 bp). Figure 1 C) indicates that the correct pET28a-3Dpol recombinant plasmid was successfully constructed.

[0050] Example 2: Expression and purification of FMDV 3Dpol recombinant protein 1. Expression of FMDV 3Dpol recombinant protein (1) The pET28a-3Dpol recombinant plasmid obtained in Example 1 was transformed into Escherichia coli BL21(DE) according to conventional methods to obtain FMDV pET28a-3Dpol recombinant engineered strain.

[0051] (2) The recombinant engineered bacteria obtained in step 1 were added to LB medium with Kanamycin resistance and cultured at 37°C and 200 r / min for 12 h with constant temperature shaking. Then, IPTG with a final concentration of 1.0 mM was added to induce expression and cultured at 37°C and 200 r / min for another 6 h with constant temperature shaking.

[0052] (3) Centrifuge, collect the bacterial precipitate, use a hammer super lysing solution on ice to lyse the bacterial precipitate for more than 20 minutes until the bacterial solution is clear and free of impurities, and finally centrifuge to obtain the supernatant protein.

[0053] (4) The lysis supernatant and lysis precipitate were analyzed by SDS PAGE and Western blot according to conventional methods.

[0054] 2. Optimization of Inducing Conditions Following step 1, induction was performed at an induction temperature of 37℃, an IPTG concentration of 1.0 mM, and different induction times (0, 2, 4, 6, 8). Protein samples with different induction durations were prepared and collected for SDS-PAGE analysis.

[0055] 3. Purification of FMDV 3Dpol recombinant protein The recombinant protein was purified using Ni Smart Beads, and the specific steps are as follows: (1) Take an appropriate amount of Ni Smart Bead into the gravity column and drain the protective liquid.

[0056] (2) Add 5 times the volume of the medium to the gravity column of lysis buffer (20 mM NaH2PO4, 500 mM NaCl, pH 8.0) to wash the medium, drain the lysis buffer, and repeat twice.

[0057] (3) Put the cap on the bottom of the chromatography column, load the supernatant protein solution, let the supernatant protein solution and the medium combine overnight at 4°C, remove the cap, and let the lysis solution flow out naturally under gravity.

[0058] (4) Wash the column with 3 to 5 column volumes of washing solution (20 mM NaH2PO4, 500 mM NaCl, 0-5 mM imidazole, pH 8.0) to remove unbound impurities.

[0059] (5) Elute with 5 to 10 column volumes of elution buffer (20 mM NaH2PO4, 500 mM NaCl, 250 mM imidazole, pH 8.0) and collect the sample.

[0060] (6) Dialyze the collected purified protein with imidazole: Add the purified protein solution to the dialysis bag for dialysis, and gradually replace the dialysis buffer (Tris buffer: 50 mM Tris, 500 mM NaCl, pH=12) with low imidazole concentration (gradient concentration imidazole: 25, 10, 5, 0 mM). Dialyze the imidazole gradually at 4℃, and replace it with a new imidazole concentration gradient Tris buffer every 12 h.

[0061] (7) The 3Dpol recombinant protein purified in step (6) is filtered through a 0.22 μm filter membrane for later use.

[0062] (8) The protein concentration of the purified and filtered 3Dpol recombinant protein in step (7) was calculated using the BCA method, and a small amount was used for SDS PAGE and Western blot detection.

[0063] II. Test Results 1. Expression of FMDV pET28a-3Dpol recombinant protein SDS-PAGE results showed that the lysate supernatant of the expressing bacteria contained distinct protein bands between the protein markers at 50 and 70 kDa. Figure 2 A) The size matches the expected target protein size; such as Figure 2As shown in Figure B, Western blot results indicated that, using a His-tagged protein monoclonal antibody, a distinct band was detected in the supernatant of the expressed bacteria between 50 and 70 kDa for the protein marker. This demonstrates that the recombinant plasmid pET28a-3Dpol successfully expressed the soluble 3Dpol recombinant protein in BL21(DE3) competent cells.

[0064] like Figure 2 As shown in Figure C, the expression level of 3Dpol recombinant protein is closely related to the induction time of IPTG. The expression level at 6 h of induction is significantly higher than that at other time points, indicating that soluble 3Dpol recombinant protein is expressed more under the conditions of IPTG concentration of 1 mM and induction time of 6 h.

[0065] 2. Purification of FMDV pET28a-3Dpol recombinant protein The FMDV 3Dpol recombinant protein was purified using a His-tagged nickel column. Figure 3 The SDS-PAGE results of A showed that the purified protein had obvious protein bands between the protein markers at 50 and 70 kDa, while no obvious protein bands were observed at other locations.

[0066] Figure 3 Western blot results for B showed that the His-tagged monoclonal antibody could detect a distinct band in the purified protein sample between 50 and 70 kDa, consistent with the size of the unpurified target protein.

[0067] BCA analysis showed that the purified protein solution was in A... 562 The absorbance at that point is 1.564. The formula obtained from the measured standard curve is (…). Figure 3 (C) can be used to calculate that the concentration of purified protein is approximately 1.26 mg / mL.

[0068] The above results indicate that the purified 3Dpol recombinant protein in this study has high purity and good immunogenicity for Western blot detection.

[0069] Example 3

[0070] I. Experimental Methods 1. Immunization of BALB / c mice The FMDV 3Dpol recombinant protein solution purified in Example 2 was used as an immunogenic antigen and injected subcutaneously into mice. The specific method is as follows: (1) Six 6-week-old female BALB / c mice were randomly divided into two groups of three each. One group was used as the immunization group, and the other group was injected with PBS as a blank control. Purified 3Dpol recombinant protein was used as the antigen. 100 μg protein / mouse dose was mixed with ISA 201VG adjuvant at a volume ratio of 1:1 and emulsified. After emulsification, the mice were immunized by intraperitoneal injection.

[0071] (2) On day 14 after immunization, select mice in good mental condition for a second immunization, and administer the second injection in the same manner. Seven days after the second immunization, administer a booster immunization for a third immunization.

[0072] (3) On the 7th day after the third immunization, blood was collected from the eyeballs of mice using the conventional method, and serum was separated for subsequent antibody specificity detection and antibody titer determination.

[0073] 2. Western blot detection of 3Dpol antibody specificity (1) Mix PK-15 and BHK cells at a ratio of 3 × 10⁶ cells per well. 6 Cells were seeded at a density of 100 cells / well in 6-well plates. When the cells reached 70-80% confluence, the FMDV O / CATHAY strain was used to infect PK-15 and BHK cells at an MOI of 1. Uninfected blank cells were set up as a control. Total cell protein was isolated 6 and 12 h after infection.

[0074] (2) The mouse serum containing the 3Dpol protein polyclonal antibody prepared in step 1 was diluted at a volume ratio of 1:800 to form a primary antibody, and the 3Dpol protein in PK-15 and BHK cells in step (1) was detected by Western blot.

[0075] 3. ELISA detection of 3Dpol antibody titer (1) Coating: The 3Dpol recombinant protein purified in Example 2 was diluted to 1 μg / mL PBS solution as the coating antigen. The prepared antigen protein was added to 100 μL / well in a 96-well plate and coated overnight at 4°C. The coating solution was discarded the next day, and PBST was added at 200 μL / well. The plate was shaken and washed 3 times for 5 min each time. The plate was then patted dry on the last wash.

[0076] (2) Blocking: Add 200 μL of blocking solution (5% skim milk) to each well, block at 37℃ for 1 h, then discard the blocking solution and wash, the washing method is the same as above.

[0077] (3) Add serum: Dilute the diluted 3Dpol protein polyclonal antibody mouse serum at ratios of 1:10000, 1:20000, 1:40000, 1:80000, 1:160000, 1:320000, 1:640000 and 1:1280000, and prepare negative serum (1:1000 diluted PBS mouse serum) and add it to the ELISA plate, 100 μL / well, incubate at 37℃ for 1 h, discard the liquid, and wash as above.

[0078] (4) Add enzyme-labeled secondary antibody: Dilute the enzyme-labeled secondary antibody (HRP Goat anti mouse IgG) with PBS at a ratio of 1:500 and add it to the microplate at 100 μL / well. Incubate at 37°C for 1 h, discard the liquid, and wash as above.

[0079] (5) Color development: Add TMB color development solution to the microplate, 100 μL / well, and react at 37°C in the dark for 30 min.

[0080] (6) Termination: Add stop solution to the microplate, 50 μL / well. OD 450 Value determination: OD was measured using an enzyme-linked immunosorbent assay (ELISA) reader. 450 value.

[0081] (7) Calculation: positive serum is P, and negative serum is N. When the ratio of positive serum to negative serum P / N>2.1, the serum antibody is considered positive; when 2.1>P / N>1.5, the serum titer is considered questionable; when P / N<1.5, the serum antibody is considered negative. II. Test Results

[0082] 1. Specificity detection of FMDV 3Dpol protein polyclonal antibody Western blot analysis of 3Dpol antibody specificity yielded the following results: Figure 4 As shown in Figure A, in PK-15 cells and BHK cells, specific protein bands were detected in cell samples infected with FMDV at 6 h and 12 h in the range of 50–70 kDa, while no specific protein bands were observed in cell samples not infected with FMDV at 6 h and 12 h. This indicates that the prepared FMDV3Dpol protein polyclonal antibody has good immunogenicity and can be applied to Western blot.

[0083] 2. Antibody titer determination The antibody titer of 3Dpol was measured by ELISA, and the results were as follows: Figure 4As shown in Figure B, the P / N ratio was greater than 2.1 when the serum dilution of FMDV 3Dpol protein was 1:10000 to 640000, indicating that the serum titer of 3Dpol antibody reached more than 1:640000. This shows that the prepared FMDV 3Dpol protein polyclonal antibody has good immunogenicity and high antibody titer, and can be used for ELISA detection.

[0084] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A foot-and-mouth disease virus 3Dpol recombinant protein, characterized in that... Its amino acid sequence is shown in SEQ ID No.

1.

2. The gene encoding the foot-and-mouth disease virus 3Dpol recombinant protein as described in claim 1, characterized in that... Its nucleotide sequence is shown in SEQ ID No.

2.

3. A recombinant vector, characterized in that it is obtained by linking the nucleotide sequence of the gene encoding the foot-and-mouth disease virus 3Dpol recombinant protein as described in claim 2 to the vector.

4. A strain expressing the foot-and-mouth disease virus 3Dpol recombinant protein, characterized in that... It is obtained by transferring the recombinant vector described in claim 3 into Escherichia coli BL21(DE).

5. The method for preparing the foot-and-mouth disease virus 3Dpol recombinant protein, characterized in that... It includes the following steps: (1) The nucleotide sequence of the gene encoding the foot-and-mouth disease virus 3Dpol recombinant protein as described in claim 2 is ligated to a vector to obtain a recombinant vector; (2) The recombinant vector obtained in step (1) was transformed into Escherichia coli BL21(DE) to obtain the pET28a-3Dpol recombinant engineered strain; (3) The pET28a-3Dpol recombinant engineered strain was cultured to OD using conventional methods. 600 IPTG was added to induce expression when the concentration was 0.4-0.

8. (4) After the induction expression is completed, centrifuge, collect the bacterial cell pellet, add lysis buffer to lyse the bacterial cell pellet, centrifuge, and collect the supernatant; (5) The supernatant collected in step (4) was purified by nickel column and dialyzed with imidazole to obtain foot-and-mouth disease virus 3Dpol recombinant protein.

6. The method for preparing foot-and-mouth disease virus 3Dpol recombinant protein according to claim 5, characterized in that: The final concentration of IPTG in the system in step (3) is 1.0 mM, and the induction time is 6 h.

7. The method for preparing foot-and-mouth disease virus 3Dpol recombinant protein according to claim 5, characterized in that: The specific operation of imidazole dialysis in step (5) is as follows: the protein solution purified by nickel column is added to a dialysis bag containing dialysis solution, and dialysis is performed stepwise at 4°C. The dialysis solution is replaced every 12 hours, and the concentration of imidazole in the dialysis solution is gradually reduced until it is 0.

8. A polyclonal antibody against foot-and-mouth disease virus 3Dpol protein, characterized in that... Mice were immunized with the foot-and-mouth disease virus 3Dpol recombinant protein as described in claim 1, and blood was collected and centrifuged to obtain antiserum, which is a polyclonal antibody against foot-and-mouth disease virus 3Dpol protein.

9. The method for preparing the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein as described in claim 8, characterized in that... It includes the following steps: The foot-and-mouth disease virus 3Dpol recombinant protein described in claim 1 was used as an antigen. It was mixed with ISA 201VG adjuvant at a volume ratio of 1:1 at a dose of 100 μg protein / mouse. After emulsification, mice were immunized by intraperitoneal injection. A second immunization was performed on day 14 after the second immunization. A third immunization was performed 7 days after the second immunization. Blood was collected from the eyeballs from day 7 to 35 after the third immunization and centrifuged to obtain antiserum.

10. The application of the recombinant foot-and-mouth disease virus 3Dpol protein or the polyclonal antibody against foot-and-mouth disease virus 3Dpol protein as described in claim 1 in the field of immunoassay.

Images