Bacillus subtilis engineering bacteria with high yield of extracellular vesicles and construction method thereof

Abstract

The application discloses a high-yield extracellular vesicle bacillus subtilis engineering bacterium and a construction method thereof. The application takes bacillus subtilis as a host, introduces MreB gene from bacillus subtilis to construct a recombinant strain, significantly improves the extracellular vesicle secretion amount through overexpression of the MreB gene, and the overexpression of the MreB gene does not interfere with normal proliferation of the bacterium, has no cytotoxicity, effectively solves the problem of low yield of extracellular vesicles of a wild-type strain, and has a wide application prospect in the fields of feed additives, medical carriers, agricultural biological control and large-scale preparation of microbial extracellular vesicles.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering, specifically relating to a high-yield extracellular vesicle-producing Bacillus subtilis engineered strain and its construction method. Background Technology

[0002] Bacillus subtilis, a recognized food-grade (GRAS) microorganism, boasts advantages such as simple culture conditions, rapid growth, and strong protein secretion capabilities, making it widely used in microbial fermentation and biopharmaceutical development. Bacterial extracellular vesicles (BEVs) are nanoscale membrane structures secreted by Bacillus subtilis into the extracellular space. These vesicles carry the strain's own proteins, nucleic acids, lipids, and other bioactive substances, possessing multiple functions including immunomodulation, drug delivery, antibacterial and antimicrobial activity, and growth promotion. They have significant application potential in feed additives, pharmaceutical carriers, and agricultural biological control.

[0003] However, the yield of extracellular vesicles naturally secreted by wild-type Bacillus subtilis is extremely low, and the vesicle yield per unit fermentation system is limited, resulting in high costs for subsequent extraction and purification, which severely restricts its industrial-scale production and practical application. Currently, methods to increase bacterial extracellular vesicle yield mainly focus on physical induction (such as ultrasound and high pressure) and chemical stimulation (such as adding inducers). These methods not only easily damage the membrane structure integrity of extracellular vesicles, affecting their biological activity, but also suffer from drawbacks such as complex operation, high cost, and difficulty in large-scale application.

[0004] Targeted genetic engineering is a highly efficient and stable method to increase the yield of microbial products. By regulating the expression of key genes, the biosynthesis and secretion pathways of products can be precisely controlled, achieving a targeted increase in product yield. The MreB gene, as a homolog of bacterial actin, has seen significant research progress. It is known to be a core scaffold protein of the bacterial elongasome, participating in the construction of the bacterial cytoskeleton, the synthesis of peptidoglycan in the cell wall, and the maintenance of cell morphology, playing an irreplaceable role in the morphogenesis of rod-shaped bacteria (Strahl H, Bürmann F, Hamoen LW. The actinhomologue MreB organizes the bacterial cell membrane. Nat Commun. 2014 Mar;5:3442). For example, CN116004690B discloses a method for engineering Shewanella vesicles to enhance extracellular electron transport. This method uses the CRISPR-dCas9 system to inhibit MreB gene expression, altering the cell morphology of Shewanella, thereby promoting the secretion of outer membrane vesicles and ultimately improving the efficiency of extracellular electron transport.

[0005] Bacillus subtilis contains three MreB homologs: MreB, mbl, and MreBH. These homologs can form mixed filaments and work together to maintain cell morphology. Deletion or mutation of the MreB gene causes Bacillus subtilis to change from a short rod-shaped to a spherical form, and also affects chromosome segregation. Currently, there are no reported studies on the role of the MreB gene in the secretion of exovesicles in Bacillus subtilis. Summary of the Invention

[0006] This invention provides a high-yield Bacillus subtilis engineered strain and its construction method. Using Bacillus subtilis as the host, this invention constructs a recombinant strain by introducing the MreB gene derived from Bacillus subtilis. Overexpression of the MreB gene significantly increases the amount of extracellular vesicles secreted.

[0007] The Bacillus subtilis engineered strain that produces high levels of extracellular vesicles described in this invention overexpresses the MreB gene derived from Bacillus subtilis in its genome.

[0008] Furthermore, the nucleotide sequence of the MreB gene is shown in SEQ ID No. 2.

[0009] The specific steps for constructing the above-mentioned high-yielding Bacillus subtilis engineered strain are as follows:

[0010] (1) Amplify the MreB gene fragment shown in SEQ ID No.2 and the backbone fragment of the Bacillus subtilis expression vector respectively. Then, use seamless cloning to assemble the MreB gene fragment and the backbone fragment of the Bacillus subtilis expression vector, transform Escherichia coli DH5α strain, and screen and verify the correct recombinant vector.

[0011] (2) The verified recombinant vector was introduced into Bacillus subtilis by chemical transformation, and Bacillus subtilis engineered bacteria with high production of extracellular vesicles were screened.

[0012] Further, in step (1), the Bacillus subtilis expression vector is the pMA09 vector, the insertion site of the MreB gene fragment is downstream of the HpaII site of the pMA09 vector, and the recombinant vector is pMA09-MreB.

[0013] Further, in step (1), the primer pair for amplifying the backbone fragment of the pMA09 vector is PMA09-gjM-F / PMA09-gjM-R, and the nucleotide sequences are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively; the primer pair for amplifying the MreB gene fragment is MreB-F / MreB-R, and the nucleotide sequences are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively.

[0014] Furthermore, in step (2), Bacillus subtilis is Bacillus subtilis 168, and the engineered Bacillus subtilis strain is Bacillus subtilis engineered strain BS168-MreB.

[0015] The present invention also provides a method for increasing the production of extracellular vesicles of Bacillus subtilis, specifically by overexpressing the MreB gene derived from Bacillus subtilis in the genome of Bacillus subtilis.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] (1) The present invention found that overexpression of the MreB gene in Bacillus subtilis can induce large-scale positive bulging of the cell membrane of the strain, drive a large number of vesicles to bud, and significantly increase the production of extracellular vesicles.

[0018] (2) The Bacillus subtilis engineered strain overexpressing the MreB gene constructed in this invention can produce a large number of extracellular vesicles. Moreover, the overexpression of the MreB gene does not interfere with the normal proliferation of the bacteria and has no cytotoxicity. It eliminates the interference of bacterial growth differences on the results of extracellular vesicle production, effectively solves the problem of low extracellular vesicle yield in wild-type strains, and has broad application prospects in feed additives, pharmaceutical carriers, agricultural biological control and large-scale preparation of microbial extracellular vesicles. Attached Figure Description

[0019] Figure 1 Schematic diagram of the pMA09-MreB and pMA09-DivIVA recombinant vectors;

[0020] Figure 2 Images of the extracellular vesicles of three bacterial strains stained with phosphotungstic acid under a transmission electron microscope (TEM).

[0021] Figure 3 The NTA particle size distribution curves of extracellular vesicles of the three strains are shown.

[0022] Figure 4 A columnar comparison of the average particle size of extracellular vesicles secreted by the three strains;

[0023] Figure 5 A bar chart comparing the total extracellular vesicle particle concentration of the three strains;

[0024] Figure 6 The optical density (OD) values ​​at 600 nm for the fermentation broth of the three strains. 600 The bar chart of the test results is used to characterize the bacterial biomass;

[0025] Figure 7 A bar chart comparing the yield of extracellular vesicles per unit of bacterial cell. Detailed Implementation

[0026] The technical solution of the present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the following embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or in accordance with the product manual.

[0027] Bacterial cell membrane curvature remodeling is a core prerequisite for driving the outward budding and release of extracellular vesicles from the cell body. Cell membrane curvature sensing / regulatory cytoskeleton proteins directly determine the efficiency of local cell membrane bulges, vesicle neck formation, and detachment. Two classes of membrane curvature regulating cytoskeleton proteins have been reported in Bacillus subtilis: the MreB family and DivIVA. Both classes of proteins possess biological functions such as binding to the cell membrane, altering membrane lipid tension, and remodeling membrane spatial morphology. The MreB family, including MreB, mbl, and MreBH, is mainly distributed spirally along the bacillus sidewalls and regulates the positive outward curvature of the cell membrane. DivIVA is a classic negative curvature recognition protein, enriched in the inwardly concave regions of the cell membrane, such as the bacterial poles and mitotic septa, stabilizing the negatively curved structure of the cell membrane. Therefore, this invention, while studying MreB gene overexpression strains, also constructed DivIVA overexpression strains as parallel controls to compare the actual vesicle secretion-promoting effects of the two types of membrane curvature proteins.

[0028] The amino acid sequence of the cytoskeletal protein MreB used in this invention is shown in SEQ ID No. 1, sourced from NCBI (GenBank: AF349769.1). Codon optimization was also performed, and the optimized nucleotide sequence of the MreB gene is shown in SEQ ID No. 2. The amino acid and nucleotide sequences of the control DivIVA protein are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0029] Example 1: Construction of engineered Bacillus subtilis strains overexpressing the MreB and DivIVA genes

[0030] Using plasmid pMA09 as the starting plasmid, primers were designed to amplify the target gene fragments MreB and DivIVA. Based on the characteristic that both proteins regulate membrane curvature, they were simultaneously selected as candidate high-yield genes. Using a seamless cloning method, the recombinant vector pMA09-MreB and the control vector pMA09-DivIVA were constructed by inserting the vectors downstream of the HpaII cloning site in the pMA09 vector. Colony PCR and sequencing were then performed for verification. The two verified recombinant vectors were transformed into Bacillus subtilis 168 to obtain the experimental group of engineered Bacillus subtilis BS168-MreB and the control group of engineered Bacillus subtilis BS168-DivIVA. The specific implementation is as follows:

[0031] 1. Construction of recombinant vectors pMA09-MreB and pMA09-DivIVA

[0032] (1) Using the Bacillus subtilis genome as a template, MreB was amplified using primers MreB-F / MreB-R and DivIVA was amplified using primers DivIVA-F / DivIVA-R. At the same time, the backbone fragment of plasmid pMA09 was amplified using primers PMA09-gjM-F / PMA09-gjM-R and PMA09-gj-DF / PMA09-gj-DR. Then, the two target gene fragments were assembled with the pMA09 backbone fragment using the seamless cloning method and transformed into Escherichia coli DH5α strain to obtain two recombinant vectors.

[0033] (2) Subsequently, colony PCR verification was performed, with the verification primers being PMA09-check-F / PMA09-check-R. The PCR-positive colonies were extracted and sequenced to verify that the MreB / DivIVA gene fragment was correctly inserted downstream of the designated cloning site of the pMA09 vector, and that the gene sequence had no mutations or frameshifts.

[0034] (3) Sequencing the fragments or vectors obtained from PCR verification to verify their correctness. The PCR system is shown in Table 1.

[0035] Table 1

[0036]

[0037] The PCR amplification procedure is shown in Table 2.

[0038] Table 2

[0039]

[0040] The sequences of the primers mentioned above are as follows:

[0041] PMA09-gjM-F:TTAAAGGTAAGACAAGATAAAGTCGAGCTCAAGCTAGCTT(SEQ ID No.5);

[0042] PMA09-gjM-R:CGGGCCCCGATTCCAAACATTAAATCGCTCCTTTTTAGGTGGCA(SEQ IDNo.6);

[0043] MreB-F:AGCGATTTAATGTTTGGAATCGGGGCC(SEQ ID No.7)

[0044] MreB-R:AAGCTAGCTTGAGCTCGACTTTATCTTTGTCTTACCTTTAAACAAGTGAATATGCT(SEQ IDNo.8);

[0045] PMA09-check-F:CTGTCCCTTGCTGATTTTTAAACG(SEQ ID No.9);

[0046] PMA09-check-R:AAGCTAGCTTGAGCTCGACT(SEQ ID No.10);

[0047] DivIVA-F:ACCTAAAAAGGAGCGATTTATGCCGCTCACTCCTAATGA (SEQ ID No.11);

[0048] DivIVA-R:AAGCTAGCTTGAGCTCGACTTTACTCTTTCTCTTCAAAAACAGCGT (SEQ IDNo.12);

[0049] PMA09-gjD-F:TTTTTGAAGAGAAAGAGTAAAGTCGAGCTCAAGCTAGCTT(SEQ ID No.13);

[0050] PMA09-gjD-R: TCATTAGGAGTGAGCGGCATTAAATCGCTCCTTTTTAGGTGGCA(SEQ IDNo.14)。

[0051] 2. Connect BS168-MreB to BS168-DivIVA

[0052] The verified transformants were then transformed into Bacillus subtilis 168 using the following method to obtain engineered Bacillus subtilis strains BS168-MreB and BS168-DivIVA, respectively. The specific transformation method is as follows:

[0053] Chemical transformation of Bacillus subtilis was performed using a modified Spizizen method, as follows: A single colony was picked and transferred to a test tube containing 2 mL of SP I medium, and incubated overnight at 37 °C and 200 rpm. 100 μL of seed culture was transferred to a test tube containing 5 mL of SP I medium, and incubated at 37 °C and 200 rpm for 4.5 h. 0.2 mL of the culture was transferred to 2 mL of SP II medium, and incubated at 37 °C and 200 rpm for 90 min. 20 μL of 10 mM EGTA was added, and the mixture was incubated again at 37 °C and 200 rpm for 10 min. The culture medium was dispensed into sterile EP tubes in 0.5 mL portions, and 1 μg of recombinant vectors pMA09-MreB and pMA09-DivIVA were added to each tube. The tubes were incubated at 37 ℃ and 200 rpm for 90 min. The bacterial culture was then spread onto screening plates containing suitable resistance. The tubes that passed the resistance screening were confirmed to be successfully transformed Bacillus subtilis engineered bacteria BS168-MreB and BS168-DivIVA.

[0054] The composition of each culture medium and reagent is as follows:

[0055] SP I medium (20 mL): 9.8 mL SP-A solution, 9.8 mL SP-B solution, 200 μL 50% glucose solution, 200 μL 100×CAYE solution, mix fresh before use.

[0056] SP ⅠI medium (6 mL): 5.88 mL SP Ⅰ medium, 60 μL 50 mM CaCl2 solution, 60 μL 250 mM MgCl2 solution, mix fresh before use.

[0057] SP-A solution: 4 g·L -1 (NH4)2SO4, 28 g·L -1 K2HPO4•3H2O, 12 g·L -1 KH2PO4, 2 g·L -1 Sodium citrate dihydrate.

[0058] SP-B solution: 0.4 g·L -1 MgSO4•7H2O.

[0059] Example 2: Preparation of engineered Bacillus subtilis extracellular vesicles MreB-EVs (MEVs)

[0060] Three groups of extracellular vesicles were prepared by simultaneous fermentation culture of engineered Bacillus subtilis strain BS168-MreB, control strain BS168-DivIVA, and wild-type BS168, using the same tangential flow process, as detailed below:

[0061] 1. Simultaneous fermentation culture of three strains

[0062] The engineered Bacillus subtilis strains BS168-MreB and BS168-DivIVA were transferred to test tubes containing kanamycin, and wild-type BS168 was screened for resistance. The bacteria were then incubated overnight at 37°C and 200 rpm, transferred to shake flasks, and fermented simultaneously at 37°C and 200 rpm for 30 h to eliminate interference from differences in culture time and environment.

[0063] The OD of each group of fermentation broth was measured using a UV spectrophotometer. 600 This reflects the level of bacterial cell proliferation. The results are as follows: Figure 6 As shown, three groups of OD 600 There was no significant difference (P>0.05), which proves that overexpression of MreB and divIVA does not affect normal bacterial growth, and the difference in growth does not interfere with the comparison of vesicle secretion capacity.

[0064] 2. Preparation of three groups of Bacillus subtilis extracellular vesicles

[0065] The fermentation broths of the three strains were simultaneously collected into centrifuge tubes and centrifuged at 7000 ×g, 4℃ for 10 min. The precipitate was the bacterial cells, which were discarded. The supernatant was collected into a new centrifuge tube and centrifuged at 12000 ×g, 4℃ for 15 min to further remove bacterial cells and impurities. The resulting supernatant was then filtered through a 0.45 μm filter to remove flagella, bacterial fragments, and large vesicles.

[0066] Most of the contaminating proteins in the supernatant were further removed using a tangential flow filtration system (300 kDa hollow fiber column), and the vesicle collection solution was concentrated. Specifically, a transmembrane pressure of 3 psi and a flow rate of 35 mL / min were maintained. The concentrated supernatant was replaced with 10 volumes of 1×PBS and finally concentrated to 15 mL. The vesicle collection solution was then centrifuged at 12000 × g at 4 °C for 10 min, and the supernatant was collected. Finally, the supernatant was filtered through a 0.22 μm filter to further remove impurities and bacteria, yielding engineered Bacillus subtilis extracellular vesicles (MEVs), DivIVA-EVs, and wild-type extracellular vesicles (WT-EVs). After aliquoting, they were stored at -80 °C.

[0067] Transmission electron microscopy was performed on the extracellular vesicles of Bacillus subtilis in each group after negative staining with phosphotungstic acid. The results are shown in Figure 2. It can be seen that WT-EVs had the fewest extracellular vesicles overall; DivIVA-EVs had a slightly increased number of vesicles compared to wild-type WT-EVs, but the increase was limited and only had a slight effect on yield; MEVs had a more dense number of vesicles, and the vesicles were spherical, regularly dispersed, and had intact membrane structures.

[0068] Nanoparticle tracking analysis (NTA) was used to detect the particle size distribution and total particle concentration of extracellular vesicles in the three groups. The continuous particle size distribution curves are shown in Figure 3. The particle size of all three groups of vesicles was concentrated around 100 nm. The statistical bar chart of the average particle size of the three groups of vesicles is shown in Figure 4. The average particle size of vesicles in the MreB group was significantly lower than that in the wild-type group (**, P<0.01), while there was no significant difference in the average particle size between the DivIVA group and the wild-type group. This indicates that overexpression of MreB protein slightly reduces the average particle size of vesicles, while overexpression of DivIVA protein does not change the basic size of vesicles. The quantitative results of total particle concentration are shown in Figure 5. The total particle concentration was ranked as follows: MEVs >> DivIVA-EVs > WT-EVs. The number of particles in the MreB group was significantly higher than that in the other two groups (****, P<0.001), while the number in the DivIVA group was only slightly higher than that in the wild-type group, indicating a weak increase in particle production.

[0069] In addition, the total particle concentration / OD 600 After eliminating the interference of bacterial concentration, the cyst-producing efficiency per unit bacterial cell was calculated, and the results are as follows: Figure 7 As shown in the figure. Quantitative results indicate that although overexpression of both types of membrane curvature proteins can slightly increase vesicle production, there is a significant difference in their production capacity. MreB, as a positive membrane curvature regulator, significantly outperforms DivIVA in vesicle production efficiency per cell. DivIVA, as a negative curvature sensing protein, only stabilizes cell division and the concave membrane structure at both poles, and can only slightly increase vesicle release, failing to achieve large-scale high-yield extracellular vesicle production. Qualitative electron microscopy images and quantitative NTA data confirm that MreB is the optimal gene for significantly increasing extracellular vesicle production by specifically reshaping the positive outward curvature of the cell membrane. While DivIVA, also a membrane curvature regulator, possesses some vesicle-promoting ability, its effect is extremely weak. This invention is the first to simultaneously screen two types of membrane curvature skeletal proteins as candidate genes in parallel control, and experimental verification clearly demonstrates MreB's unique advantage in regulating high-yield vesicle production.

[0070] In summary, the Bacillus subtilis engineered strain constructed in this invention can stably and efficiently express the MreB gene. By upregulating the abundance of intracellular MreB protein and extensively reshaping the local positive outward curvature of the cell membrane, it continuously provides structural driving force for cell membrane outward budding, significantly increasing the amount of extracellular vesicle secretion without damaging the structural integrity and biological activity of the vesicle membrane. As a control, under the same conditions, although overexpression of DivIVA can slightly increase the number of vesicles, the increase is extremely low and far less than that of the MreB overexpression strain.

Claims

1. A method for increasing the yield of extracellular vesicles in Bacillus subtilis, characterized in that, Specifically, this involves overexpressing Bacillus subtilis-derived genes in the Bacillus subtilis genome. MreB The amino acid sequence of the gene MreB is shown in SEQ ID No.

1.

2. The method according to claim 1, characterized in that, MreB The nucleotide sequence of the gene is shown in SEQ ID No.

2.

3. The method according to claim 2, characterized in that, The specific steps are as follows: (1) Amplify the contents shown in SEQ ID No.2 respectively. MreB Gene fragments and the backbone fragment of the Bacillus subtilis expression vector were then used to seamlessly clone... MreB The gene fragment and the backbone fragment of the Bacillus subtilis expression vector were assembled, transformed into Escherichia coli DH5α strain, and the correct recombinant vector was screened and verified. (2) The verified recombinant vector was introduced into Bacillus subtilis by chemical transformation, and Bacillus subtilis engineered bacteria with high production of extracellular vesicles were screened.

4. The method according to claim 3, characterized in that, In step (1), the Bacillus subtilis expression vector is the pMA09 vector. MreB The gene fragment was inserted downstream of the HpaII site in the pMA09 vector, and the recombinant vector was pMA09-MreB.

5. The method according to claim 4, characterized in that, In step (1), the primer pair for amplifying the backbone fragment of the pMA09 vector is PMA09-gjM-F / PMA09-gjM-R, and the nucleotide sequences are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively; the primer pair for amplifying the MreB gene fragment is MreB-F / MreB-R, and the nucleotide sequences are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively.

6. The method according to claim 3, characterized in that, In step (2), Bacillus subtilis is Bacillus subtilis BS168, and the engineered Bacillus subtilis strain is Bacillus subtilis engineered strain BS168-MreB.

Images