Application of argonaute1 gene and its dsrna in prevention and treatment of tomato leafminer

Abstract

The present application relates to the technical field of pest control, and more particularly to TaArgonaute1 gene and dsRNA in the application of preventing and treating tomato leaf tier, and the dsRNA of the core effect gene sequence of the insect RNAi channel is TaArgonaute1 gene of SEQ ID NO.1, and the preparation method and application thereof.The TaArgonaute1 gene of the tomato leaf tier is cloned and sequenced, and the gene of TaArgonaute1 is obtained, after the synthesis of dsTaArgonaute1, the specific TaArgonaute1 gene can be silenced after being injected into the tomato leaf tier, which leads to the normal development of the ovary and affects the reproduction of the adult in the subsequent development process of the tomato leaf tier, and provides a new idea and a new direction for formulating a green and sustainable control strategy of the tomato leaf tier.

Description

Technical Field

[0001] This invention relates to the field of pest control technology, and in particular to the application of the TaArgonaute1 gene and its dsRNA in the control of tomato leafminer. Background Technology

[0002] The tomato leafminer (Tuta absoluta (Meyrick), also known as the South American tomato leafminer, belongs to the order Lepidoptera and the family Diplodocidae. It is a highly destructive invasive alien pest worldwide and a key agricultural pest monitored in my country. Since its initial discovery in Xinjiang, my country in 2017, it has rapidly spread to 19 provinces, autonomous regions, and municipalities across the country, posing a serious threat to my country's major tomato-producing areas and the cultivation of solanaceous crops. Its extremely high reproductive rate and high egg production are the core reasons for its high susceptibility to large-scale outbreaks and the extreme difficulty in its control, representing a key challenge in current field pest management.

[0003] The tomato leafminer has a short reproductive cycle and significant generational overlap. A single female can lay over a hundred eggs at a time, accumulating hundreds throughout her lifetime. Its high egg production and hatching rate allow it to quickly form dense populations, rapidly invading tomato fields. The eggs are mostly laid in concealed locations such as the undersides of leaves and crevices in tender stems, making them difficult to eradicate precisely with conventional chemical pesticides. After hatching, the large number of eggs burrow into the plant to feed, rapidly damaging the plant's photosynthetic structure and bored into the fruit, resulting in reduced yields and deteriorated quality. Due to its extremely high reproductive capacity, this pest can spread rapidly, causing widespread infestations. In mild cases, it can significantly reduce tomato yields; in severe cases, it can lead to complete crop failure, causing huge economic losses to the agricultural industry. Therefore, developing green and precise control technologies targeting the tomato leafminer's strong reproductive and high egg-laying characteristics is crucial for curbing pest infestations and ensuring safe tomato production.

[0004] Traditional pesticides, with their broad-spectrum disinfecting properties, easily cause the death of natural enemies of pests in the field, disrupt the ecological balance of farmland, and result in significant pesticide residues and soil and water pollution problems, which are inconsistent with the concept of green agriculture. Furthermore, pests, long-term exposure to chemical agents leads to increasingly stronger pesticide resistance year by year, causing farmers to continuously increase the dosage and frequency of pesticide use, creating a vicious cycle of "the more pesticides used, the stronger the resistance," increasing planting costs and further exacerbating the risks to agricultural product quality and safety. Nucleic acid pesticides, relying on gene sequences, precisely target specific pests, interfering only with the gene expression of those pests, while remaining safe and harmless to non-target organisms such as humans, livestock, and natural enemies. Simultaneously, the active nucleic acid components can rapidly degrade in the natural environment, leaving no pesticide residues or ecological pollution, meeting the requirements of green pest control. Their targeted control characteristics can also delay the evolution of pesticide resistance in pests at the source, and with their short development cycle, convenient application methods, and significant cost-effectiveness advantages after mass production, they have become one of the optimal choices to replace traditional chemical pesticides and achieve precise green pest control.

[0005] Therefore, we designed the TaArgonaute1 gene and its dsRNA for the control of tomato leafminer, providing an alternative technical solution to the above-mentioned technical problems. Summary of the Invention

[0006] Therefore, it is necessary to address the aforementioned technical issues by providing the application of the TaArgonaute1 gene and its dsRNA in the control of tomato leafminer. This would solve the problems of traditional pesticides' broad-spectrum disinfecting properties, which easily lead to the death of natural enemies of pests in the field, ecological imbalance in farmland, and prominent issues of pesticide residues, soil and water pollution, which are inconsistent with the concept of green agricultural development.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] Any of the following applications of the TaArgonaute1 gene with the nucleotide sequence shown in SEQ ID NO.1:

[0009] Controlling tomato leafminer, or preparing formulations to control tomato leafminer;

[0010] To increase the rate of ovarian malformation in the tomato leafminer moth, or to prepare a formulation that increases the rate of ovarian malformation in the tomato leafminer moth.

[0011] Preferably, the application method is to silence the TaArgonaute1 gene or inhibit the expression of the TaArgonaute1 gene.

[0012] A dsRNA targeting and silencing the TaArgonaute1 gene, said dsRNA comprising the nucleotide sequence shown in SEQ ID NO.2 and its reverse complementary nucleotide sequence.

[0013] Any of the following applications of the dsRNA as described in claim 3:

[0014] Controlling tomato leafminer, or preparing formulations to control tomato leafminer;

[0015] To increase the rate of ovarian malformation in the tomato leafminer moth, or to prepare a formulation that increases the rate of ovarian malformation in the tomato leafminer moth.

[0016] A drug or agent for controlling or increasing the rate of ovarian malformation in tomato leafminer, wherein the drug or agent comprises the dsRNA as described in claim 3.

[0017] A method for controlling or reducing the ovarian malformation rate of tomato leafminer includes the following steps:

[0018] Apply the dsRNA as described in claim 3 or the drug or agent as described in claim 5 to the tomato leafminer or its habitat.

[0019] It is clear without a doubt that the technical problems to be solved by the present invention can be solved by the above-described technical solutions of the present invention.

[0020] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects:

[0021] The present invention relates to the application of the TaArgonaute1 gene and its dsRNA in the control of tomato leafminer. After the dsRNA of the TaArgonaute1 gene of tomato leafminer is injected into the body cavity of tomato leafminer, it can specifically silence the mRNA expression of TaArgonaute1 gene in tomato leafminer, resulting in a high mortality rate of tomato leafminer eggs and affecting the ovarian development and egg production of adults. This provides a new specific molecular target for pest control based on RNA interference and a new technical approach for pest control. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 A schematic diagram illustrating the effect of injecting the dsRNA synthesized in SEQ ID NO.2 into 3-day-old female pupae of the tomato leafminer of the present invention on the expression of TaArgonaute1 gene mRNA;

[0024] Figure 2 A schematic diagram illustrating the effect of injecting the dsRNA synthesized in SEQ ID NO.2 into 3-day-old female pupae of the tomato leafminer on the survival rate of the tomato leafminer according to the present invention;

[0025] Figure 3 A schematic diagram illustrating the effect of injecting the dsRNA synthesized by SEQ ID NO.2 into 3-day-old female pupae of the tomato leafminer on the emergence phenotype of adult tomato leafminers.

[0026] Figure 4 A schematic diagram illustrating the effect of injecting 3-day-old female pupae of the tomato leafminer with the dsRNA synthesized in SEQ ID NO.2 on the ovarian phenotype of the tomato leafminer. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0028] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0029] It should be noted that, unless otherwise specified, the embodiments and features and technical solutions in the present invention can be combined with each other.

[0030] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0031] The application of the TaArgonaute1 gene and its dsRNA in the control of tomato leafminer: The tomato leafminer population used was collected in May 2019 from Yuxi City, Yunnan Province (102.90°E, 24.82°N). It was continuously reared for more than ten generations at the Key Laboratory of Monitoring and Control of Invasive Alien Species in Guizhou Province. The rearing conditions were: temperature 26 ± 1°C, photoperiod 16L:8D, and relative humidity 60 ± 5%. Tomato leafminer larvae were reared on fresh tomato plants, and adults were fed 10% honey water. The instars of the tomato leafminer were standardized: prepupae to new tomato leaves were selected, and pupae developed to 3 days old were used for subsequent experiments.

[0032] Unless otherwise specified, the experimental methods in the following examples are conventional methods; the chemical and biological reagents used are conventional reagents in the art and are commercially available.

[0033] Example 1: Obtaining the open reading frame sequence and gene fragment of the TaArgonaute1 gene from the tomato leafminer.

[0034] Based on the transcriptome database of the tomato leafminer, the open reading frame (ORFF) sequence of the TaArgonaute1 gene from the tomato leafminer was obtained. Primers were designed using Primer Premier 5.0 software to validate the ORFF sequence, and the primers were sent to Shanghai Bioengineering Co., Ltd. for synthesis. Total RNA was extracted from the tomato leafminer using the Trizol method and processed according to HiScript. ®The 1st Strand cDNA Synthesis Kit (+gDNA wiper) reverse transcription kit instructions describe how to reverse transcribe the extracted RNA into first-strand cDNA. Using this cDNA as a template, and with the designed upstream and downstream primers, the open reading frame sequence of the TaArgonaute1 gene is amplified by PCR. The resulting product is purified, cloned, and transformed into *E. coli*, and then sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequence is SEQ ID NO.1, obtained through sequence alignment from the *Tomato Leafminer* transcriptome database. This sequence is 2781 bp in length and encodes 926 amino acids.

[0035] Example 2: Synthesis of dsRNA from the TaArgonaute1 gene of the tomato leafminer

[0036] 1) Design of dsRNA primers for the TaArgonaute1 gene of the tomato leafminer

[0037] Based on the sequence SEQ ID NO.1 of the TaArgonaute1 gene of the tomato leafminer obtained in Example 1, dsRNA primers were designed using Primer Premier 5.0 software. The primer sequences are SEQ ID NO.3 and SEQ ID NO.4, respectively, and both upstream and downstream primers carry the T7 promoter sequence. All primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0038] 2) Synthesis of dsRNA in the TaArgonaute1 gene of the tomato leafminer

[0039] Using the upstream and downstream primers of SEQ ID NO.3 and SEQ ID NO.4, PCR amplification was performed on the cDNA template from Example 1. The amplified PCR product, with the sequence of SEQ ID NO.2, was prepared as dsRNA (i.e., dsTaArgonaute1) according to the instructions of the TranscriptAid T7 High Yield Transcription Kit. It was stored at -80°C for later use.

[0040] Example 3: Lethal experiment of TaArgonaute1 gene dsRNA in tomato leafminer

[0041] 1) Injection of the TaArgonaute1 gene dsRNA into the tomato leafminer

[0042] Capillary tubes were prepared into injection needles using a PUL-1000 programmable horizontal microelectrode puller. Three-day-old pupae were collected for microinjection; the control and experimental groups were injected with 200 ng / µL of dsGFP and dsTaArgonaute1, respectively. Each group contained 30 larvae, with three biological replicates. Samples were collected at 24, 48, and 72 h after dsRNA injection. After injection, successfully emerged female larvae were selected and paired with uninjected male larvae. The oviposition period, total number of eggs laid, and hatching rate of each female adult were observed and recorded daily. Furthermore, the ovaries of successfully emerged two-day-old female adults were dissected under a stereomicroscope, and the length of the ovarian duct and the size of the ovarian granulocytes within the ovarian duct were measured and recorded using a VHX-2000 ultra-depth-of-field three-dimensional microscopic observation system.

[0043] 2) Detection of gene silencing in test insects after dsTaArgonaute1 treatment

[0044] Tomato leafminer pupae injected with dsGFP and dsTaArgonaute1 were collected at 24h, 48h, and 72h respectively for total RNA extraction and reverse transcription into first-strand cDNA. mRNA expression levels were detected using a CF×96 Real-Time PCR Detection System. The results showed that, compared with the control group, the expression of the dsTaArgonaute1 gene in the dsTaArgonaute1-injected group was significantly reduced at 24h, 48h, and 72h. Figure 1 (in P < 0.001).

[0045] 2) Detection of insect survival rate after dsTaArgonaute1 treatment

[0046] Survival rates of tomato leafminer were assessed 10 days after injection of dsGFP and dsTaArgonaute1. Results showed that, compared to the control group, the survival rate of the dsTaArgonaute1-injected test moths was significantly reduced by 50%. Figure 2 (in P < 0.001).

[0047] 3) Observation of the phenotype of tomato leafminer after injection of dsRNA

[0048] Five days after injection of dsGFP, the control group began to emerge, exhibiting normal morphology and vitality. After injection of dsTaArgonaute1, the test insects showed a death phenotype during molting, exhibiting developmental arrest and inability to detach from the pupal case. Figure 3 As shown, where Figure 3 The leftmost image shows the control group injected with dsGFP. Figure 3 The right side of the image shows the dsRNA synthesized by injecting SEQ ID NO.2, namely dsTaArgonaute1.

[0049] 3) Observation of the ovarian phenotype of the tomato leafminer moth after injection of dsRNA

[0050] Dissection of the ovaries of 2-day-old female worms showed that, compared with the normal group, the ovaries of the tested worms injected with dsTaArgonaute1 were more fragile and had uneven yolk deposition. Furthermore, no significant inhibitory effect was found on the average length of the ovarian duct and the size of the eggs. Figure 4 The left side shows the control group injected with dsGFP, and the right side shows the group injected with dsRNA synthesized by SEQ ID NO.2, namely dsTaArgonaute1.

[0051] In the above embodiments, the gene sequence listing is as follows:

[0052] SEQ ID NO.1 (TaArgonaute1 gene):

[0053]

[0054] SEQ ID NO.2 (dsTaArgonaute1 gene fragment):

[0055] CTCCAACCTCTGCCTCAAGATCAACGTGAAGCTGGGCGGCATCAACTCCATCCTCGTGCCCTCGCTGCGCCCCAAGGTGTTCAACGAGCCGGTGATATTCCTGGGCGTGGACGTGACGCACCCGCCGGCCGGCGACAACAAGAAGCCCTCCATCGCGGCCGTCGTCGGCTCCATGGACGCGCACCCCTCGCGCTACGCCGCCACCGTGCGCGTGCAGCAGCACCGAAAAGACTTC

[0056] SEQ ID NO.3 (dsTaArgonaute1 upstream primer):

[0057] TAATACGACTCACTATAGGGCTCCAACCTCTGCCTCAAGA

[0058] SEQ ID NO.4 (dsTaArgonaute1 downstream primer):

[0059] TAATACGACTCACTATAGGGAAGTCTTTTTCGGTGCTGCTG

[0060] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.

Claims

1. Any of the following applications of the TaArgonaute1 gene with the nucleotide sequence shown in SEQ ID NO.1: Controlling tomato leafminer, or preparing formulations to control tomato leafminer; To increase the rate of ovarian malformation in the tomato leafminer moth, or to prepare a formulation that increases the rate of ovarian malformation in the tomato leafminer moth.

2. The application according to claim 1, characterized in that, The application method is to silence the TaArgonaute1 gene or inhibit the expression of the TaArgonaute1 gene.

3. A dsRNA targeting and silencing the TaArgonaute1 gene, characterized in that, The dsRNA includes the nucleotide sequence shown in SEQ ID NO.2 and its reverse complementary nucleotide sequence.

4. Any of the following applications of the dsRNA as described in claim 3: Controlling tomato leafminer, or preparing formulations to control tomato leafminer; To increase the rate of ovarian malformation in the tomato leafminer moth, or to prepare a formulation that increases the rate of ovarian malformation in the tomato leafminer moth.

5. A drug or agent for controlling tomato leafminer or increasing the rate of ovarian malformation in tomato leafminer, characterized in that, The drug or pharmaceutical agent includes the dsRNA as described in claim 3.

6. A method for controlling or increasing the rate of ovarian malformation in tomato leafminer, characterized in that, Includes the following steps: Apply the dsRNA as described in claim 3 or the drug or agent as described in claim 5 to the tomato leafminer or its habitat.

Images