Application of GhSINA11A gene in improving salt tolerance of cotton

Abstract

The application discloses GhSINA11A The application belongs to the technical field of plant gene breeding and relates to application of a gene in improving salt tolerance of cotton. GhSINA11A The amino acid sequence coded by the gene is shown in SEQ ID NO: 2. GhSINA11A The application can significantly improve the salt tolerance of cotton by inhibiting the expression of the gene or reducing the activity of the GhSINA11A protein. GhSINA11A The application can obtain cotton plants with enhanced salt tolerance by using VIGS technology or CRISPR / Cas9 technology to inhibit the expression of the gene. The application provides efficient gene resources and operation methods for cotton salt-tolerant molecular breeding and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of plant gene breeding technology, specifically involving GhSINA11A Application of genes in improving the salt tolerance of cotton. Background Technology

[0002] Cotton, a widely cultivated economic crop, suffers from severe constraints due to soil salinization. Cotton salt tolerance is a complex quantitative trait regulated by multiple genes, involving various physiological processes such as ion segregation, osmotic regulation, reactive oxygen species scavenging, and signal transduction. For a long time, breeders have relied primarily on traditional breeding methods such as hybridization, backcrossing, and mixed selection to develop salt-tolerant cotton varieties. However, traditional breeding methods have inherent limitations, including long cycles, low efficiency, and limited germplasm resources. Currently, several cotton salt tolerance-related genes have been cloned and functionally identified; however, transgenic salt-tolerant cotton varieties are rarely used in production and are difficult to promote on a large scale. The main reason is that existing varieties have limited effectiveness in improving cotton salt tolerance and have low genetic transformation efficiency.

[0003] The ubiquitin-proteasome system is a highly conserved post-translational modification mechanism in eukaryotes, playing a central regulatory role in plant stress responses by specifically degrading key regulatory proteins. E3 ubiquitin ligases determine the substrate specificity of ubiquitination and are key enzymes in the ubiquitination regulatory network; their family members are widely involved in plant life activities such as drought resistance, salt tolerance, disease resistance, and growth and development. SINA (SEVEN IN ABSENTIA) is a subfamily of E3 ubiquitin ligases containing a ring finger domain, playing an important role in plant growth, development, and stress responses. Studies have shown that Arabidopsis SINA proteins participate in the ABA signaling pathway and regulate stomatal closure, thereby enhancing drought resistance; apple MdSINA2, induced by ABA, participates in plant responses to drought and other stresses; and tomato SISINA3 can regulate pathogen defense responses by ubiquitinizing and degrading the transcription factor SINAC1. In Brassica napus, researchers have identified 23 members of the BnaSINA family. Transcriptional expression analysis showed that most of them exhibited differential expression patterns under salt and osmotic stress, indicating that the SINA family has important functional potential in the abiotic stress response of oilseed crops. However, there are currently no publicly available reports on the biological functions of SINA family E3 ubiquitin ligase members in salt tolerance responses in upland cotton.

[0004] Therefore, cloning and identifying members of the SINA family from cotton and deeply analyzing their molecular mechanisms in salt stress response is of great theoretical and practical significance for enriching the theoretical understanding of the cotton salt tolerance regulatory network and providing new genetic resources and material basis for cotton salt tolerance molecular breeding. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide GhSINA11A Application of genes in improving the salt tolerance of cotton.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides GhSINA11A The application of genes in improving the salt tolerance of cotton, the application including: by inhibiting the growth of certain genes in cotton. GhSINA11A Gene expression enhances the salt tolerance of cotton; GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2; GhSINA11A The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0007] Preferably, the inhibition of cotton GhSINA11A Gene expression occurs through virus-induced gene silencing or CRISPR / Cas9 gene editing.

[0008] More preferably, the CRISPR / Cas9 gene editing includes using targeted... GhSINA11A The sgRNA of a gene.

[0009] More preferably, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 3.

[0010] The present invention also provides a method for improving the salt tolerance of cotton, comprising: inhibiting the salt content of cotton. GhSINA11A Gene expression; the aforementioned GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2; the nucleotide sequence of the GhSINA11A gene is shown in SEQ ID NO: 1.

[0011] The present invention also provides a method for silencing cotton. GhSINA11A A recombinant vector for silencing genes, the recombinant vector containing [a specific gene]. GhSINA11A The target nucleic acid fragment of the gene, the nucleotide sequence of which is shown in SEQ ID NO: 4.

[0012] Preferably, the skeletal vector of the recombinant vector is a pTRV2 vector.

[0013] The present invention also provides an Agrobacterium containing the recombinant vector.

[0014] Compared with the prior art, the present invention has the following advantages: (1) This invention is the first to disclose members of the SINA family of E3 ubiquitin ligases from upland cotton. GhSINA11AThe biological function of genes in negatively regulating cotton salt tolerance. This invention utilizes virus-induced gene silencing (VIGS) technology to... GhSINA11A After expression downregulation, the levels of reactive oxygen species and malondialdehyde accumulation in cotton plants under salt stress were significantly reduced, while chlorophyll content increased and root Na+ levels decreased. + / K + The ratio decreased, and both the fresh and dry weight of the plants were better than the control; while the one created using CRISPR / Cas9 technology... GhSINA11A Gene knockout cotton lines exhibited stronger growth advantages under salt stress, with less leaf wilting and a significantly higher survival rate. Conversely, overexpression of the gene led to increased sensitivity of cotton to salt stress. These results indicate that... GhSINA11A It is an ideal target gene for improving the salt tolerance of cotton.

[0015] (2) This invention also elucidates the mechanism of action of GhSINA11A, and for the first time confirms that it negatively regulates the salt tolerance response of cotton by ubiquitinizing and degrading the transcription factor GhMYB4A. This discovery provides new insights into the molecular mechanisms of plant SINA family E3 ubiquitin ligases in response to abiotic stress, and enriches the theoretical basis of the cotton salt tolerance regulatory network. Furthermore, this invention provides a variety of simple and efficient gene manipulation tools, including a VIGS silencing vector (containing the target fragment shown in SEQ ID NO: 4) and a CRISPR / Cas9 editing system (containing the sgRNA shown in SEQ ID NO: 3), which can be directly used for the rapid creation of salt-tolerant cotton germplasm. The above-mentioned technologies yield... GhSINA11A New cotton germplasm with gene knockout or silencing exhibits stable salt tolerance traits, providing valuable genetic resources and material basis for molecular breeding of cotton with salt tolerance. It has important application prospects for promoting increased and stable cotton production in saline-alkali land. Attached Figure Description

[0016] Figure 1 Phylogenetic analysis diagram of SINA gene family members in upland cotton and Arabidopsis thaliana.

[0017] Figure 2 A heatmap of transcriptome expression levels of SINA family genes in upland cotton under salt stress.

[0018] Figure 3 for GhSINA11A Gene structure analysis diagram.

[0019] Figure 4 for GhSINA11A Expression pattern analysis in different parts of the plant under salt treatment; Figure A shows the root expression pattern analysis results; B shows the stem expression pattern analysis results; C shows the leaf expression pattern analysis results; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level (p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0020] Figure 5 for GhSINA11A Expression pattern analysis under different salt concentrations and in different materials; Figure A shows the results of expression pattern analysis under different salt concentrations; Figure B shows the results of expression pattern analysis under different materials; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0021] Figure 6 This is a subcellular localization map of GhSINA11A in tobacco leaves, with a scale bar of 15 μm.

[0022] Figure 7 This is a subcellular localization map of GhSINA11A in Arabidopsis protoplasts, with a scale bar of 15 μm.

[0023] Figure 8 The image shows the Western Blot results for detecting the self-ubiquitination activity of GhSINA11A.

[0024] Figure 9 for GhSINA11A Identification of gene-silenced cotton; Figure A shows the albino phenotype of the positive control; Figure B shows the silencing efficiency test results; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01).

[0025] Figure 10 for GhSINA11A Phenotypic diagram of gene-silenced cotton under salt stress. In the diagram, Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0026] Figure 11 for GhSINA11A Results of reactive oxygen species (ROS) detection in gene-silenced cotton. In the figure, A represents the DAB staining phenotype of leaves; B represents the NBT staining phenotype of leaves; C represents the H2O2 content; and D represents the O2 content. - Content; data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01); scale bar is 10 mm; Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0027] Figure 12 for GhSINA11AMDA and chlorophyll content in gene-silenced cotton; A in the figure represents MDA content; B represents chlorophyll content; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0028] Figure 13 for GhSINA11A Na in gene-silenced cotton + and K + Ion content; A in the figure represents Na in different locations. + Content; B represents K from different parts + Content; C represents Na from different parts + / K + Data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0029] Figure 14 for GhSINA11A Plasmid map of heterologous expression vectors for Arabidopsis thaliana.

[0030] Figure 15 for GhSINA11A Semi-quantitative PCR analysis for the identification of heterologous Arabidopsis thaliana.

[0031] Figure 16 for GhSINA11A Heterologous expression of Arabidopsis thaliana phenotype; scale bar in figure is 5 mm; Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0032] Figure 17 for GhSINA11A Physiological parameters of heterologous expression of Arabidopsis thaliana; A in the figure represents root length; B represents fresh weight; C represents dry weight; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0033] Figure 18 for GhSINA11A Identification of cotton overexpression; Figure A shows semi-quantitative PCR analysis; Figure B shows... GhSINA11A Quantitative detection of overexpression in cotton; data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01).

[0034] Figure 19 for GhSINA11A Overexpression of cotton phenotype and dry / fresh weight; Figure A represents overexpression of cotton phenotype; B represents dry weight; C represents fresh weight; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0035] Figure 20 for GhSINA11A Detection of reactive oxygen species overexpression in cotton; Figure A shows the DAB staining phenotype of leaves; B shows the NBT staining phenotype of leaves; C shows the H2O2 content; D shows the O2 content. - Content; data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01); scale bar is 10 mm; Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0036] Figure 21 for GhSINA11A Overexpression of cotton MDA and chlorophyll content; A in the figure represents MDA content; B represents chlorophyll content; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0037] Figure 22 for GhSINA11A Overexpression of Na in cotton + and K + Ion content; A in the figure represents Na in different locations. + Content; B represents K from different parts + Content; C represents Na from different parts + / K + Data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0038] Figure 23 Identification of GhSINA11A gene knockout cotton; A in the figure shows the construction of the knockout vector; B shows the sequencing results of the knockout line; Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt treatment group.

[0039] Figure 24 for GhSINA11A Phenotypic and dry / fresh weight of gene knockout cotton; Figure A represents the phenotype of gene knockout cotton; B represents dry weight; C represents fresh weight; Data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0040] Figure 25 for GhSINA11A Detection of reactive oxygen species in gene knockout cotton; Figure A shows the DAB staining phenotype of leaves; B shows the NBT staining phenotype of leaves; C shows the H2O2 content; D shows the O2 content. - Content; data from three replicate experiments are expressed as mean ± SD, **indicating t The test reached a highly significant level ( p <0.01); scale bar is 10 mm; Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group.

[0041] Figure 26 for GhSINA11A MDA and chlorophyll content in gene-edited cotton; A in the figure represents MDA content; B represents chlorophyll content; data from three replicate experiments are expressed as mean ± SD, ** indicates t The test reached a highly significant level ( p <0.01); Mock represents the normal control group that did not receive salt treatment, and NaCl represents the salt-treated group. Detailed Implementation

[0042] This invention provides GhSINA11A The application of genes in improving the salt tolerance of cotton, including by inhibiting the growth of certain genes in cotton. GhSINA11A The expression of the gene or the reduction of the activity of the GhSINA11A protein can improve the salt tolerance of cotton under salt stress conditions, wherein... GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2, and its nucleotide sequence is shown in SEQ ID NO: 1. In the specific implementation of this invention, various methods can be used to inhibit... GhSINA11A Gene expression can be reduced or its encoded protein activity can be decreased, for example, through virus-induced gene silencing, CRISPR / Cas9 gene editing, RNA interference, antisense RNA, or homologous recombination. As a preferred implementation, virus-induced gene silencing technology is used to obtain... GhSINA11A The expression indicates a downgrade in cotton plants. Specifically, this is obtained from the CottonGen database. GhSINA11AThe coding sequence was determined, and specific primers GhSINA11A-QF and GhSINA11A-QR (SEQ ID NO: 9 and SEQ ID NO: 10) were designed for PCR amplification to obtain a specific silencing fragment of approximately 300 bp, the nucleotide sequence of which is shown in SEQ ID NO: 4. This fragment was cloned into the EcoRI and SacRI restriction sites of the pTRV2 vector to construct the recombinant vector pTRV2-GhSINA11A. The pTRV2 vector is a known virus-induced gene silencing vector in this field and can be obtained from public resources such as the Addgene plasmid platform. The recombinant vector was transformed into Agrobacterium GV3101 and resuspended in OD240. 600 =1.0, injected into cotton seedlings that had grown to full cotyledon expansion. After one day of incubation in the dark, they were transferred to normal growth conditions and cultured for another two weeks. The silencing efficiency was assessed by qRT-PCR. GhSINA11A The expression level decreased to about 30% of the control group. After 3 days of 200mM NaCl salt stress treatment, compared with the empty vector control, the silent plants showed significantly reduced leaf wilting, significantly lower levels of reactive oxygen species and malondialdehyde accumulation, significantly higher chlorophyll content, and reduced Na+ expression levels in roots, stems, and leaves. + / K + The ratios all decreased significantly, indicating GhSINA11A Downregulation of expression can significantly improve the salt tolerance of cotton.

[0043] As another preferred implementation method, CRISPR / Cas9 gene editing technology is used to knock out... GhSINA11A Genes. In GhSINA11A A single sgRNA was designed for the first exon region, with its target sequence shown in SEQ ID NO: 3. A CRISPR / Cas9 expression vector was constructed, containing an sgRNA expression cassette driven by the pGbU6 promoter, a Cas9 expression cassette driven by the pOsUbic promoter, and an NPTII selection marker. Cotton recipient material HM-1 was transformed using Agrobacterium-mediated transformation, and regenerated plants were obtained on a kanamycin-containing selection medium. Genomic DNA was extracted from the leaves of positive plants, the target region was amplified by PCR, and sequenced, yielding three independent knockout lines with -1bp deletion, -2bp deletion, or +2bp insertion at the target site, resulting in frameshift mutations. The knockout lines were subjected to 200mM NaCl salt stress for 3 days. Compared with the wild-type and empty vector control, the knockout lines showed significantly better growth, with leaves remaining green, less wilting, significantly increased dry and fresh weight, significantly reduced reactive oxygen species and malondialdehyde (ROS) content, and significantly increased chlorophyll content, indicating… GhSINA11A Gene knockout can also significantly enhance the salt tolerance of cotton. Furthermore, those skilled in the art should understand that, in addition to the two methods mentioned above, conventional RNA interference technology can also be used to design targeted... GhSINA11ABy modifying the hairpin RNA structure and transforming it into cotton, or by using antisense RNA technology, homologous recombination technology, etc., inhibition can be achieved. GhSINA11A The aim is to reduce gene expression or protein activity, thereby obtaining cotton plants with improved salt tolerance.

[0044] The present invention also provides a method for improving the salt tolerance of cotton, the method comprising inhibiting the salt content of cotton. GhSINA11A Gene expression or decreased activity of GhSINA11A protein, wherein GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO:2, and its nucleotide sequence is shown in SEQ ID NO:1. To achieve the above method, various gene expression inhibition techniques known in the art can be employed, including but not limited to virus-induced gene silencing, CRISPR / Cas9 gene editing, RNA interference, antisense RNA, or homologous recombination. As a specific implementation method, virus-induced gene silencing technology is used to... GhSINA11A Gene expression was downregulated. First, cDNA was cloned from upland cotton. GhSINA11A The gene was used as a template, and a 300bp specific silencing fragment with the nucleotide sequence shown in SEQ ID NO: 4 was amplified using forward primer (SEQ ID NO: 9) and reverse primer (SEQ ID NO: 10). This fragment was cloned into the EcoRI and SacRI sites of the pTRV2 vector to construct the recombinant vector pTRV2-GhSINA11A. The recombinant vector was transformed into Agrobacterium GV3101 and resuspended in OD. 600 =1.0 after injection into cotton seedlings with fully expanded cotyledons; cultured in the dark for 1 day, then cultured under normal conditions (28℃, 16h light / 8h dark) for 2 weeks, and confirmed by qRT-PCR detection. GhSINA11A When the expression level decreases to about 30% of the control group, it is considered to have achieved [the desired result]. GhSINA11A Cotton plants with suppressed salt expression were treated with a 200 mM NaCl solution for 3 days. This significantly improved salt tolerance, manifested by reduced leaf wilting, decreased accumulation of reactive oxygen species and malondialdehyde, increased chlorophyll content, and higher NaCl concentrations in roots, stems, and leaves. + / K + The ratio decreased.

[0045] As another preferred implementation method, CRISPR / Cas9 gene editing technology is used to knock out... GhSINA11A Genes. Targeted design GhSINA11AThe sgRNA of the first exon, with its nucleotide sequence shown in SEQ ID NO: 3, was used to construct a CRISPR vector containing both an sgRNA expression cassette and a Cas9 expression cassette. Cotton was transformed using Agrobacterium-mediated transformation, and regenerated plants were obtained through kanamycin selection. Genomic DNA was extracted from leaves, and the target region was amplified by PCR and sequenced. Homozygous knockout lines with frameshift mutations at the target site (e.g., -1bp deletion, -2bp deletion, or +2bp insertion) were screened. These knockout lines were then subjected to 200mM NaCl salt stress for 3 days, resulting in a phenotype with significantly enhanced salt tolerance. Furthermore, RNA interference technology can be used to construct expression cassettes. GhSINA11A A plant expression vector with a hairpin RNA structure was used to transform cotton, enabling... GhSINA11A Post-transcriptional gene silencing, or techniques such as antisense RNA and homologous recombination, can all achieve gene repression. GhSINA11A The purpose of this invention is to improve the salt tolerance of cotton by expressing or reducing the activity of the GhSINA11A protein. All of the above-described embodiments can achieve the technical effects of the method of this invention. Those skilled in the art can repeat the invention without creative effort based on the description in the specification. Therefore, the method of this invention is fully disclosed and can be implemented accordingly.

[0046] The present invention also provides a method for silencing cotton. GhSINA11A A recombinant vector for silencing genes, the recombinant vector containing [a specific gene]. GhSINA11A The target nucleic acid fragment of the gene, the nucleotide sequence of which is shown in SEQ ID NO: 4. As a preferred embodiment, the backbone vector of the recombinant vector is a pTRV2 vector. Upland cotton was obtained from the CottonGen database. GhSINA11AThe coding sequence of the gene was amplified by PCR using cotton seedling cDNA as a template and specific primers to obtain a target nucleic acid fragment of approximately 300 bp, the nucleotide sequence of which is shown in SEQ ID NO: 4. After purification and recovery of the PCR product by agarose gel electrophoresis, it was cloned into the EcoRI and SacI restriction sites of the pTRV2 vector using homologous recombination or double enzyme digestion ligation to construct the recombinant plasmid pTRV2-GhSINA11A. The specific ligation reaction system was as follows: 2 μL of the target fragment, 3 μL of pTRV2 vector linearized by double digestion with EcoRI and SacI, 5 μL of 2×ClonExpressMix, and ddH2O added to a final volume of 10 μL. The reaction was carried out at 50°C for 10 min. The ligation product was transformed into *E. coli* Mach-T1 competent cells, plated on LB agar plates containing kanamycin, and cultured overnight at 37°C. Escherichia coli Mach1-T1 competent cells were purchased from Coolaber Technology Co., Ltd., and are a commonly used cloning strain in this field. Single clones were selected for colony PCR verification and sequencing confirmation to obtain recombinant vectors with correct sequences. Subsequently, the recombinant vectors were transformed into Agrobacterium GV3101 competent cells, plated on LB agar plates containing kanamycin and rifampin, and cultured at 28°C for 48 h. Positive single clones were selected and inoculated into LB liquid medium containing the corresponding antibiotics, and cultured at 28°C with shaking at 200 rpm until OD. 600 =0.8-1.0, collect bacterial cells by centrifugation, and resuspend in resuspending buffer (containing 10mM MES, 200μM acetylsalicylic acid, and 10mM MgCl2) to OD. 600 =1.0, incubated at room temperature in the dark for 3 hours. MES was a 2-morpholine ethanesulfonic acid solution, prepared as follows: MES powder was dissolved in water to adjust the pH to 5.3, filtered for sterilization, aliquoted, and stored at -20℃. Cotton seedlings with fully expanded cotyledons were taken, and the resuspended bacterial solution was injected into the cotyledons from the hypocotyl using a syringe. After 24 hours of incubation in the dark, the seedlings were transferred to a normal light environment (28℃, 16 hours light / 8 hours dark) for further culture. Approximately two weeks later, plants injected with the positive control TRV:CLA showed typical albinism in their true leaves, indicating that the virus-induced gene silencing system was functioning correctly. At this time, total RNA was extracted from cotton leaves injected with pTRV2-GhSINA11A, and the expression level of GhSINA11A was detected by qRT-PCR. The results showed that compared with the control injected with the empty vector TRV:00, the experimental group plants showed significantly lower levels of GhSINA11A expression. GhSINA11A The expression level was significantly reduced by approximately 70%, indicating that the recombinant vector successfully achieved [the desired effect]. GhSINA11A Gene silencing.

[0047] The present invention also provides an Agrobacterium containing the recombinant vector.

[0048] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The experimental materials used in the following examples mainly include the upland cotton genetic standard line TM-1 ( Gossypium hirsutum L. TM-1), transgenic recipient material HM-1, HM-1 negative control without exogenous gene introduction, and previously constructed and stably inherited [materials / materials] in the laboratory. GhSINA11A Overexpression and gene knockout cotton lines were used. The Arabidopsis thaliana experiment used the Columbia ecotype (WT) as a wild-type control. Subcellular localization analysis was performed using Nicotiana benthamiana (Nicotiana benthamiana). Nicotiana benthamiana ( ) as a transient expression system. Among them, the transgenic receptor material HM-1 has been disclosed in the literature (Zhang Y, Ge Y, Sun K, et al. Identification and Application of the Heptad Repeat Domain in the CPR5 Protein for Enhancing PlantImmunity. Molecular Plant Pathology, 2025, 26(2):e70059.DOI:10.1111 / mpp.70059,PMCID:PMC11798864), and the public can obtain the material through this literature.

[0050] Example 1 GhSINA11A Bioinformatics analysis of genes 1. Experimental Methods The Arabidopsis SINA gene and protein sequences were obtained from the TAIR website (http: / / www.arabidopsis.org / ), and the cotton database was downloaded from the CottonGen website (https: / / www.cottongen.org / ). SINA members in cotton were identified based on the Arabidopsis protein sequences and the HMMER tool (https: / / www.ebi.ac.uk / Tools / hmmer / search / hmmscan). A phylogenetic tree was constructed using MEGA 7.0 software. GhSINA11A The prediction of gene structure was performed using the online server GSDS2.0 (Gene Structure Display server 2.0, http: / / gsds.gao-lab.org / ).

[0051] 2. Experimental Results Based on published Arabidopsis thaliana SINA gene family information, the results showed that in upland cotton ( Gossypium hirsutum The CCP identified 24 SINA Genes. To clarify their evolutionary relationships, a phylogenetic tree was constructed using these GhSINA proteins and Arabidopsis thaliana AtSINA proteins, and they were divided into two subgroups. Eight members of the upland cotton SINA family were assigned to group II, while the remaining SINA members were assigned to group I. Figure 1 To screen key elements of upland cotton that may be involved in salt stress response. SINA In this embodiment, transcriptome sequencing and analysis were performed on wild-type and upland cotton materials treated with 200 mM salt for 6 h. Figure 2 Differential expression analysis revealed that under salt stress, multiple... GhSINA Gene expression levels change, among which GhSINA11A The upregulation was most significant, suggesting it may play a key role in this stress response, therefore... GhSINA11A Further functional analysis will be conducted on these genes as key candidate genes related to salt stress.

[0052] To further clarify GhSINA11A Based on its characteristics, this embodiment conducted a gene structure analysis. Figure 3 Sequence analysis revealed that this protein possesses the typical architecture of SINA family E3 ubiquitin ligases, containing a ring finger domain and a SINA-type zinc finger domain. The ring finger domain confers ubiquitin ligase activity; the SINA-type zinc finger domain promotes its recognition and interaction with proteins; and the TRAF-like domain suggests its involvement in intracellular signal transduction. This compositional feature confirms that GhSINA11A belongs to the SINA-like ubiquitin ligase family.

[0053] Example 2 GhSINA11A Gene cloning and recycling 1. GhSINA11A Cloning of genes Obtain it from CottonGen (https: / / www.cottongen.org / ). GhSINA11A The coding sequence was obtained, and a primer pair GhSINA11A-F / GhSINA11A-R was designed using Oligo7 for sequence cloning. Primer sequences are shown in Table 1, amplification systems are shown in Table 2, and amplification programs are shown in Table 3.

[0054] Table 1 GhSINA11A Gene cloning primers

[0055] Table 2 GhSINA11A Gene cloning system

[0056] Table 3 GhSINA11 Gene cloning PCR program

[0057] 2. GhSINA11A Gene gel recovery (using the FlaPure Gel Purification Kit DNA gel recovery kit) (1) After the PCR amplification reaction, the amplification products were detected by agarose gel electrophoresis. The migration position of the Mark band was compared with that of the target gene fragment to determine whether the fragment length of the cloned product matched the target gene fragment. Under ultraviolet irradiation, the smallest possible target gene fragment was excised and placed in a 2 mL centrifuge tube in preparation for product recovery.

[0058] (2) Add 500 μL of Buffer GN (a component of the FlaPure Gel Purification Kit DNA Gel Recovery Kit) to the centrifuge tube containing the target band. If the gel block is large, add more Buffer GN as needed until the solution turns pale yellow.

[0059] (3) Place the centrifuge tube in a 65°C water bath for 5 minutes, and invert the centrifuge tube every 2 minutes until the gel block is completely dissolved and the solution in the tube is pale yellow.

[0060] (4) After dissolving, the solution is transferred to the adsorption column EC using a pipette, centrifuged at 12000×g for 60s, and the waste liquid is discarded.

[0061] (5) Add 600 μL Buffer W1 (washing buffer 1) to the EC adsorption column, centrifuge at 12000×g for 60s, and discard the waste liquid.

[0062] (6) Repeat the above step 5 to ensure that the adsorption column is thoroughly washed.

[0063] (7) Put the EC adsorption column back into the empty collection tube and centrifuge at 12000×g for 2 minutes to completely remove the washing liquid remaining on the adsorption column.

[0064] (8) Remove the EC adsorption column and place it on a clean 1.5 mL centrifuge tube. Let it stand at room temperature for 2 min with the cap open. Then, add 50 μL of preheated Elution Buffer to the central region of the adsorption membrane. After standing at room temperature for 2 min, centrifuge at 12000×g for 2 min. Store the recovered product in a -20℃ freezer for later use.

[0065] 3. Transformation of Escherichia coli Add 3 μL of the gel recovery product and 2 μL of pCE2 TA / Blunt-Zero Vector cloning vector (pCE2 TA / Blunt-Zero Vector is a commercial cloning vector, Vazyme) to a centrifuge tube, mix well by pipetting, and incubate at room temperature (28℃) for 10 min to construct the cloning vector. GhSINA11A The cloning vector is used for subsequent transformation of E. coli. The main steps are as follows: (1) The ligation product was added to Mach-T1 competent Escherichia coli cells using a pipette and incubated on ice for 30 min.

[0066] (2) 42℃ water bath for 45s, ice bath for 2min.

[0067] (3) Add 700 μL of antibiotic-free LB to the competent cells and incubate at 37℃ and 200 rpm for 1 h.

[0068] (4) Centrifuge at 6000 rpm for 1 min. Discard most of the supernatant, keep 40 μL of liquid to resuspend the bacteria, and spread it on LB solid medium containing the corresponding resistance.

[0069] (5) Incubate upside down in a 37℃ incubator for 12 hours.

[0070] 4. Bacterial culture PCR detection and sequencing (1) Select large, plump single colonies with their edges and inoculate them into LB liquid medium containing the corresponding resistance. Incubate at 37°C and 200 rpm for 10 h.

[0071] (2) Using bacterial culture as a template, primers are shown in Table 4, PCR amplification reaction is carried out. The PCR system and procedure are shown in Table 5 and Table 6.

[0072] (3) Select bacterial culture for sequencing. After the bacterial culture with correct sequencing is cultured, preserve the bacteria.

[0073] Table 4 Primer sequences for bacterial culture PCR

[0074] Table 5. Bacterial PCR amplification system

[0075] Table 6. Bacterial PCR Amplification Procedure

[0076] 5. Plasmid extraction (The plasmid extraction kit was purchased from Nanjing Novizan Biotechnology Co., Ltd. (FastPurePlasmid Mini Kit). Buffer P1, Buffer P2, and Buffer P3 are all components of this kit. Those skilled in the art can complete plasmid extraction by following the kit instructions.) (1) Take 2 mL of the bacterial culture that has been incubated overnight, centrifuge at 12000×g for 1 min, collect the bacterial precipitate, and remove as much supernatant as possible from the centrifuge tube.

[0077] (2) Add 250 μL of Buffer P1 reagent with added RNase A to the bacterial precipitate and resuspend the bacterial precipitate by vortexing until the bacterial clumps are completely dispersed and there are no obvious bacterial clumps remaining.

[0078] (3) Add 250 μL of Buffer P2 reagent and gently invert the centrifuge tube 6 times to fully lyse the bacterial cells and ensure that the lysis reaction is complete.

[0079] Add 350 μL of Buffer P3 reagent, and gently invert the centrifuge tube 6 times to ensure thorough mixing of the reagent and the system. Then centrifuge at 12000×g for 10 min.

[0080] (4) Carefully aspirate the supernatant after centrifugation and slowly transfer it to the adsorption column EC. Centrifuge at 12000×g for 60s and discard the waste liquid.

[0081] (5) Add 600 μL of Buffer W1 (washing buffer 1) reagent to the EC adsorption column, centrifuge at 12000×g for 60s, and discard the waste liquid.

[0082] (6) Repeat the washing operation in step 5 above to ensure that the impurities on the surface of the adsorption column are fully removed.

[0083] (7) Put the EC adsorption column back into the empty collection tube and centrifuge at 12000×g for 2 minutes to completely remove the washing liquid remaining on the adsorption column and avoid affecting the subsequent elution effect.

[0084] (8) Take out the adsorption column EC and place it on a clean 1.5 mL centrifuge tube. Open the cap and let it stand for 2 min at room temperature. Then, add 30 μL of preheated Elution Buffer to the central area of ​​the adsorption membrane. After standing at room temperature for 2 min, centrifuge at 12000×g for 2 min to complete the plasmid elution.

[0085] (9) The concentration of the eluted plasmid was detected. After the detection was completed, the plasmid was sealed and stored in a -20℃ refrigerator for subsequent experiments.

[0086] 6. Transformation of Agrobacterium (1) Take 1 μg of recombinant plasmid and add it to the thawed GV3101 competent cells. Gently shake the centrifuge tube to mix the plasmid with the competent cells thoroughly.

[0087] (2) The competent cells containing the recombinant plasmid were placed in an ice bath for 5 minutes, then frozen in liquid nitrogen for 5 minutes, then heat-shocked at 37°C for 5 minutes, and finally placed on ice for 5 minutes to complete the transformation process.

[0088] (3) Add 500 μL of antibiotic-free LB medium to the treated competent cells and place them in a shaker at 28°C and 200 rpm for 2 hours to achieve cell recovery.

[0089] (4) Take 50 μL of the revived Agrobacterium culture and spread it evenly on the surface of solid LB medium containing the corresponding antibiotic. Invert the medium and place it in a 28℃ incubator for 72 h.

[0090] (5) Select multiple single-clone colonies and inoculate them into liquid LB medium containing the corresponding resistance. Incubate them in a shaker at 28°C and 200 rpm until the bacterial solution becomes turbid.

[0091] (6) Use bacterial culture PCR technology to verify the positive results of the cultured bacterial culture. Store the qualified bacterial culture for subsequent experiments.

[0092] Example 3 Salt stress GhSINA11A Gene expression patterns 1. Experimental Methods Plump cotton seeds were selected, soaked, and germinated at 37℃ for 24 hours. They were then sown in vermiculite and cultured at 28℃ under 16 hours of light / 8 hours of darkness. When seedlings reached two leaves and a central bud, they were transferred to a hydroponic system and cultured in Hoagland's solution. A 200mM NaCl treatment was applied, and root, stem, and leaf samples were collected at 0h, 1h, 3h, 6h, and 12h. These samples were flash-frozen in liquid nitrogen and stored at -80℃. Total RNA was extracted using the MolPure® Plant RNA Kit, and after reverse transcription, it was... GhUBQ7 As an internal control, the expression level of GhSINA11A was detected by qRT-PCR. Primer sequences: GhSINA11A-QF (TTTCGATGACTTGCAGAACAAG (SEQ ID NO: 9)) and GhSINA11A-QR (GCAAGTTTCTCCAAAGCAAGAC (SEQ ID NO: 10)).

[0093] 2. Experimental Results The results are as follows Figure 4As shown, compared to the control group, the expression level of this gene in all tissues of the treatment group was upregulated with increasing treatment time, reaching a peak at 6 hours. Especially in leaves, after 6 hours of salt treatment, GhSINA11A The expression level was more than twice that under normal conditions. These results indicate that... GhSINA11A It was induced by salt stress and may have been involved in the cotton plant's response to salt stress.

[0094] To further determine GhSINA11A To investigate whether the cotton plant's response to salt stress was involved, cotton plants were treated with different salt concentrations. It was found that as the salt concentration increased, GhSINA11A The expression level also continued to increase, reaching a peak at around 200mM. Figure 5 (A). In this embodiment, three salt-tolerant cotton materials (Zhong I1435, Zhong 9806, Zhong 9807) and three salt-intolerant cotton materials (Zhong H117, Xinyan 96-48, Zhong S9612) obtained by the National Key Laboratory of Cotton Biobreeding and Comprehensive Utilization were treated with salt. It was found that the expression level of GhSINA11A was increased to varying degrees in the above materials compared with the wild type. Figure 5 (Middle B). Overall comparison revealed... GhSINA11A The expression level of the gene was significantly higher in salt-intolerant cotton than in salt-tolerant cotton. These results further demonstrate that... GhSINA11A It participated in the cotton plant's response to salt stress.

[0095] Example 4: GhSINA11A Subcellular Localization 1. Subcellular localization of GhSINA11A in tobacco leaves (1) Experimental methods The vector used was pCAMBIA2300-GFP, abbreviated as GFP. The vector's restriction enzyme sites are EcoRI and BamHI. Amplification primers were designed based on the vector's restriction enzyme sites and sequences, as shown in Table 7.

[0096] Table 7. Subcellular localization primer sequences for GhSINA11A

[0097] The GhSINA11A coding sequence was cloned into the pCAMBIA2300-GFP vector (with EcoRI and BamHI restriction sites) to construct the GhSINA11A-GFP fusion expression vector. After transformation into Agrobacterium GV3101, the vector was resuspended in OD240. 600 =1.0, incubate in the dark for 3 hours, and inject into tobacco leaves. Incubate in the dark for 16 hours, then in the light for another 16 hours, and observe under a laser confocal microscope.

[0098] (2) Experimental results The results showed that green fluorescence was detected in all organelles of tobacco leaf cells transformed with the empty vector under laser confocal microscopy, while only the nucleus and cytoplasm of tobacco cells injected with GhSINA11A-GFP emitted green fluorescence. Figure 6 This indicates that GhSINA11A is located in the nucleus and cytoplasm.

[0099] 2. Subcellular localization of GhSINA11A in Arabidopsis protoplasts (1) Experimental methods Transform Arabidopsis protoplasts with recombinant plasmids: Treat leaf filaments with enzymatic hydrolysate (containing 1.5% cellulase E1 and 0.3% analyte E2) for 3 hours, filter and collect protoplasts, centrifuge at 100g for 3 minutes, resuspend in CM culture medium, add plasmid and TP transformation solution, incubate at room temperature for 15 minutes, and observe after 16 hours of culture.

[0100] (2) Experimental results The constructed GhSINA11A-GFP recombinant plasmid was transformed into Arabidopsis protoplasts, with the empty vector plasmid serving as a control. Cellular observation was performed one day after exposure to light. The results were consistent with those observed in tobacco cells: green fluorescence was observed in all organelles of protoplasts transformed with only the empty vector, while in protoplasts transformed with GhSINA11A-GFP, green fluorescence was observed only in the nucleus and cytoplasm. Figure 7 The above results indicate that GhSINA11A is located in the nucleus and cytoplasm.

[0101] Example 5: Detection of E3 ubiquitin ligase activity of GhSINA11A 1. Experimental Methods GhMYB4A was cloned into the pET28a vector (BamHI and XhoHI), transformed into BL21(DE3), induced by IPTG expression, and purified with a His tag to obtain GhMYB4A-His protein. GhSINA11A was cloned into the pMAL-c2x vector (EcoRI and BamHI), transformed into BL21(DE3), induced by IPTG expression, and purified with an MBP tag to obtain GhSINA11A-MBP protein. The in vitro ubiquitination reaction system consisted of: 10×buffer 3 μL, 10×ATP 3 μL, 10×E1 (ubiquitin activator) 3 μL, 20×E2 (ubiquitin conjugate) 1.5 μL, 5×Ub (ubiquitin) 6 μL, MBP-GhSINA11A 5 μL, and ddH2O to a final volume of 50 μL. After incubation at 30°C for 3 h, Western blotting was performed using Ub antibody.

[0102] 2. Experimental Results The results showed that high molecular weight ubiquitinated bands could be detected when E1, E2, Ub, and GhSINA11A-MBP were present in the system; no bands were detected when any of the components were absent. Figure 8 This indicates that GhSINA11A possesses E3 ubiquitin ligase activity and can catalyze its own ubiquitination.

[0103] Example 6 Salt tolerance analysis of GhSINA11A gene-silenced (VIGS) cotton 1. GhSINA11A Gene silencing efficiency detection (1) Experimental methods Will GhSINA11A A 300bp specific fragment (obtained from the SGN-VIGS website) was cloned into the pTRV2 vector (with EcoRI and SacRI restriction sites) to construct TRV: GhSINA11A The recombinant vector, with homologous primers, is shown in Table 8. After transformation with Agrobacterium GV3101, the vector was resuspended and injected into cotton seedlings with fully expanded cotyledons. The cotton plants were divided into three groups, each treated with Agrobacterium injection. One group was injected with a TRV-containing vector. GhSINA11A One group was injected with bacterial suspension containing the empty vector TRV:00 as a negative control; another group was injected with bacterial suspension containing TRV:00 as a negative control; and a third group was injected with bacterial suspension containing TRV:00. CLA The bacterial suspension was used as a positive control. After injection, the seedlings were cultured in a dark environment for one day, and then transferred to normal culture conditions for further cultivation. Two weeks after bacterial injection, the true leaves of the cotton plants in the positive control group showed an albinism phenotype. RNA was extracted from leaves of both the experimental and control groups for silencing efficiency testing.

[0104] Table 8 GhSINA11A Constructing VIGS vector primer sequences

[0105] (2) Experimental results Fourteen days after bacterial injection, the leaves of the positive control plants showed typical whitening symptoms, confirming that the virus-induced silencing system was functioning normally. Figure 9 (A). Subsequently, TRV:00 and TRV: were detected by qRT-PCR. GhSINA11A The abundance of target gene transcripts in plants showed that in silenced plants... GhSINA11A The expression level was only 30% of that in the control group, indicating that the target gene was effectively suppressed. Figure 9 (B)

[0106] 2. GhSINA11A Salt tolerance analysis of gene-silenced cotton Further assessment GhSINA11ASalt tolerance phenotype of silent strains. Under 200 mM NaCl treatment, TRV:00 control plants and TRV: GhSINA11A The growth patterns of the silent strains showed significant differentiation: the former exhibited leaf wilting after three days of treatment, while the latter maintained relatively normal growth after the same treatment period, a highly significant difference. Under normal culture conditions, both types of materials showed consistent growth. Therefore, it can be inferred that... GhSINA11A Expressed silence can enhance cotton's ability to resist salt stress. Figure 10 ).

[0107] When plants are under stress, their normal physiological metabolic balance is disrupted, leading to a surge in reactive oxygen species (ROS). To further investigate the severity of stress in plants after gene silencing, we used DAB staining to detect H2O2 in cotton leaves and NBT staining to detect O2 in cotton leaves. - Staining was performed. Experimental results showed that, before salt treatment, TRV:00 and TRV: GhSINA11A There was no significant difference in leaf staining between the plants, but under 200mM NaCl treatment and DAB staining, TRV: GhSINA11A The leaves of this plant have less brown deposits compared to the TRV:00 plant. Figure 11 (A) indicates that it was subjected to less stress. Simultaneously, the H2O2 content in the leaves was measured, and it was found that after salt treatment, TRV: GhSINA11A Less H2O2 accumulated ( Figure 11 (C). NBT staining results showed TRV under salt stress: GhSINA11A The leaves of the plant showed less blue staining compared to the TRV:00 plant. Figure 11 (B), while also affecting O2 - Content testing revealed that under salt stress conditions, TRV: GhSINA11A Less O2 accumulated - ( Figure 11 (D). The above results indicate that, GhSINA11A Suppressing the expression enhanced the salt tolerance of cotton and reduced its susceptibility to salt stress.

[0108] To assess the degree of oxidative damage, the malondialdehyde (MDA) content in the leaves of each material was measured. This index is a commonly used physiological parameter characterizing membrane lipid peroxidation levels and plant stress resistance. Data showed that the MDA levels of the two plant groups were comparable before salt stress; after treatment with 200 mM NaCl, TRV: GhSINA11A The MDA accumulation in the strain was significantly lower than that in the TRV:00 control. Figure 12 (A) prompts silence. GhSINA11AIt can alleviate oxidative stress caused by salt stress. Furthermore, chlorophyll content was selected as the growth status, and under normal growth conditions, TRV:00 and TRV: GhSINA11A There was no significant difference in chlorophyll content among the plant leaves. Salt stress reduced the chlorophyll content in plant leaves, and the chlorophyll content of TRV:00 plants was significantly lower than that of TRV: GhSINA11A ,illustrate GhSINA11A Gene-silenced plants experienced less salt stress damage. Figure 12 (B)

[0109] Sodium excretion and potassium retention are the mechanisms by which most plants resist salt stress. Further research is needed. GhSINA11A The effect of ICP on the salt tolerance of cotton was investigated using the method to study TRV:00 and TRV: GhSINA11A Na in plant roots, stems and leaves + With K + The content was tested. The results showed that, under normal growth conditions, the Na content in the plant was... + The content was low, and the Na content in the roots, stems, and leaves of both groups of plants was low. + There was no significant difference in Na content in the three tissues of TRV:00 plants, but under salt stress conditions, the Na content was significantly different. + The accumulation of [something] is significantly higher than that of TRV. GhSINA11A plant ( Figure 13 (A) K + The content showed that K content in different parts of the two groups of plants was normal. + There was no significant difference in content, but TRV increased after salt treatment: GhSINA11A K in the roots and leaves of the plant + The K content in both were significantly higher than that in TRV:00 plants, and the K content in the stems was also significantly higher. + There was no significant difference in content. Figure 13 (B). We then analyzed the Na+ of the two groups of plants. + / K + Calculations were performed. It was found that under salt treatment conditions, the TRV (transient velocity) in roots, stems, and leaves was: GhSINA11A Na in plants + / K + All were significantly lower than TRV:00 plants ( Figure 13 The presence of C indicates that the TRV:00 plants suffered more severe salt poisoning, further suggesting... GhSINA11A The silence of the plant will enhance its salt tolerance.

[0110] Example 7 Salt tolerance analysis of Arabidopsis thaliana heterologously expressed with GhSINA11A 1. GhSINA11A Identification of heterologous expression in Arabidopsis In order to investigate GhSINA11A This embodiment constructs the functionality. GhSINA11A Overexpression vectors ( Figure 14 (), successfully using an Agrobacterium-mediated inflorescence infection strategy, to GhSINA11A Transformed into Arabidopsis thaliana, and T3 generation homozygous overexpression lines were obtained through screening. Three independent transformants (OE-1, OE-2, OE-3) and a wild-type control were selected, and genomic DNA was extracted from fresh leaves for PCR identification. AtUBQ5 The results of the detection of the internal reference showed that the internal reference gene was amplified consistently in all materials; GhSINA11A Specific bands were detected only in the transformed lines, and expression abundance varied between lines; no amplification signal was observed in the WT. Figure 15 The above results confirm that GhSINA11A It has been successfully integrated into the Arabidopsis genome and can be stably passed on to offspring.

[0111] 2. GhSINA11A Salt tolerance analysis of heterologous expression in Arabidopsis For evaluation GhSINA11A The effect of heterologous expression on salt tolerance in Arabidopsis thaliana was investigated. Wt and three other heterologous expression plants were inoculated onto normal MS medium and MS medium containing 100 mM NaCl, respectively. Phenotypic differences were observed after two weeks of germination culture. Results showed that under normal culture conditions, there was no significant differentiation in the growth status of the different lines; however, on the salt-stressed medium, the WT plants exhibited significantly better growth than the transgenic lines, with more pronounced taproot elongation. Figure 16 This phenomenon initially indicates that... GhSINA11A The introduction of this substance weakened Arabidopsis' tolerance to salt stress.

[0112] Further comparisons were made between root growth and biomass accumulation of different lines under normal and salt stress conditions. On conventional culture media, WT and three... GhSINA11A No significant difference was observed in root length among Arabidopsis thaliana overexpression lines; however, after treatment with 100 mM NaCl, the taproot elongation of WT plants was significantly better than that of transgenic lines. Figure 17 (A). Simultaneously, the fresh and dry weights of the plants were weighed and analyzed. The results showed that under normal culture conditions, there was no significant differentiation in biomass accumulation among the different lines; under salt stress, the fresh and dry weights of the overexpressing lines were significantly lower than those of the WT control (A). Figure 17 China B and Figure 17 (C). The above data collectively illustrate that, GhSINA11A Heterologous expression of the compound inhibited salt tolerance in Arabidopsis thaliana.

[0113] Example 8 GhSINA11A Construction of overexpression vectors and genetic transformation of cotton Will GhSINA11AThe coding sequence (SEQ ID NO: 1) was cloned into the pCAMBIA2300-GFP vector, the recombinant plasmid was transformed into Agrobacterium, and the cotton recipient material HM-1 was transformed by Agrobacterium-mediated transformation, as follows: (1) After removing the seed coat of upland cotton HM-1, sterilize the kernel with 75% ethanol for 1 min, then soak it in 0.1% mercuric chloride solution for 15 min, then rinse the seeds with sterile water six times, plant the sterile seedlings on germination medium, and incubate them in the dark at 28℃ for three days.

[0114] (2) Inoculate Agrobacterium strain into liquid LB medium and activate it to OD at 28°C and 200 rpm in a shaker. 600 The concentration was 0.6-0.8. The bacterial cells were collected at 10,000 rpm for 1 minute at room temperature and then resuspended in liquid co-culture medium.

[0115] (3) Under sterile conditions, cut the cotton hypocotyl into small segments of about 0.5 cm, put them into the above-mentioned resuspended bacterial cells, soak them for 1 hour, discard the bacterial solution, plant the hypocotyl segments on solid co-culture medium, and incubate them in the dark at 28°C for two days.

[0116] (4) Transfer the hypocotyl segment to the screening medium and incubate at 28°C for 15 days.

[0117] (5) Transfer the hypocotyl segment to the subculture medium and subculture once every two weeks. Select plants with kanamycin resistance and then transplant them after hardening off.

[0118] (6) Extract DNA and RNA from leaves and use PCR and qRT-PCR to further identify positive seedlings; T2 generation homozygous overexpression lines were obtained through multiple generations of self-pollination screening.

[0119] Example 9 GhSINA11A Analysis of salt tolerance of cotton overexpression 1. GhSINA11A Identification of cotton overexpression The results obtained in Example 8 GhSINA11A Molecular characterization of overexpressing cotton (T2 generation homozygous lines) was performed. Using the receptor HM-1 as the background material for empty vector transformation negative control (Null), three overexpressing lines (OE1-OE3) were selected. GhUBQ7 As an internal control gene, the expression level of the target gene was detected by semi-quantitative and real-time quantitative PCR. In the semi-quantitative electrophoresis image, the internal control gene was uniformly amplified in all materials, while the overexpression lines showed... GhSINA11A The bands are significantly brighter than those of WT and Null ( Figure 18 (A). Quantitative PCR data further showed that WT and Null... GhSINA11A There was no statistically significant difference in expression levels, but the expression levels of this gene in the three overexpression lines were all significantly higher than those in the control. Figure 18 (B). The above results confirm that in the selected overexpression lines... GhSINA11A It can achieve continuous and efficient expression, meeting the requirements of subsequent experimental materials.

[0120] 2. GhSINA11A Analysis of salt tolerance of cotton overexpression For further research GhSINA11A To investigate the role of cotton salt tolerance, stress experiments were conducted using three identified overexpression lines. WT, Null, and three... GhSINA11A Overexpressing cotton lines were cultured under normal conditions (Mock) and 200 mM NaCl stress. Under normal conditions, no identifiable differences were observed in seedling growth rate, plant height, or leaf morphology among the groups. However, under salt stress, the three overexpressing lines exhibited wilting phenotypes after two days, with leaves withering earlier compared to WT and Null. Figure 19 (A). Subsequently, the fresh and dry weights of cotton plants were measured. The results showed that under normal growth conditions, there were no significant differences in dry and fresh weights among WT, Null, and the three overexpression lines. However, after salt treatment, the dry and fresh weights of the overexpression lines were significantly lower than those of WT and Null. Figure 19 China B and Figure 19 (C) These results indicate overexpression GhSINA11A It will reduce the salt tolerance of cotton plants.

[0121] Subsequently, cotton leaves were stained and physiological parameters were measured. DAB staining results showed overexpression under salt treatment conditions. GhSINA11A The cotton leaves showed more brown staining marks, indicating that they were under more severe salt stress. Figure 20 (A). H2O2 content detection revealed no difference in H2O2 content among the Mock groups, while the H2O2 content in the overexpression leaves under salt treatment was higher than that in WT and Null ( Figure 20 (C). NBT staining also showed similar results, with overexpressing leaves showing more blue staining traces (C). Figure 20 (B), and its O2 - The content is also significantly higher than that of WT and Null ( Figure 20 (D).

[0122] The MDA and chlorophyll content of the leaves were further measured. The results showed that after salt stress treatment, GhSINA11A The overexpression lines had significantly higher MDA content than WT and Null, but significantly lower chlorophyll content than both. Figure 21 China A and Figure 21 (B); while under normal conditions, there were no significant differences in the above indicators among the materials in each group. These results further prove... GhSINA11AIt will weaken the cotton plant's salt tolerance and cause the cotton to suffer more oxidative damage.

[0123] Subsequently, the roots, stems, and leaves of two groups of cotton plants—one grown under normal conditions and the other under salt treatment—were subjected to Na+ treatment. + With K + The content was determined. Results showed that salt treatment reduced the amount of Na+ within the cotton tissue. + The content increases significantly, in roots, stems, and leaves. GhSINA11A The overexpression lines contained more Na than the WT lines. + ( Figure 22 (A) K + The content showed no significant difference between different tissues of the two groups of plants under both normal growth conditions and salt treatment conditions. Figure 22 (B), followed by its Na + / K + Calculations revealed that under normal growth conditions, the WT content in roots, stems, and leaves was... GhSINA11A Overexpression of plant Na + / K + There was no significant difference, but after salt treatment, the roots, stems, and leaves showed... GhSINA11A Overexpression of plant Na + / K + Significantly higher than WT ( Figure 22 (C) indicates that the overexpressing plants were affected by more Na. + The poisoning further demonstrates GhSINA11A It plays a negative regulatory role in the salt tolerance response of cotton plants.

[0124] Example 10 GhSINA11A Salt tolerance analysis of gene knockout (CRISPR / Cas9) cotton 1. GhSINA11A Identification of gene knockout cotton exist GhSINA11A A single sgRNA was designed from the first exon region (target sequence see SEQ ID NO: 3). A CRISPR / Cas9 expression vector was constructed, containing an sgRNA expression cassette driven by the pGbU6 promoter and a Cas9 expression cassette driven by the pOsUbic promoter, as well as an NPTII selection marker ( Figure 23 (A). Cotton recipient material HM-1 was transformed using Agrobacterium-mediated transformation, and regenerated plants were screened on kanamycin-containing medium. DNA was extracted from the leaves of positive plants, and the target region was amplified by PCR followed by sequencing. Sequencing results showed that three independent lines (SINA11A-1, SINA11A-2, and SINA11A-3) had -1bp, -2bp deletion, and +2bp (GC insertion) mutations at the target site, respectively, all resulting in frameshift mutations. Figure 23 (B). This result confirms that GhSINA11A Gene knockout material has been successfully obtained.

[0125] 2. GhSINA11A Salt tolerance analysis of gene knockout cotton Stress experiments were conducted using three identified gene knockout lines. WT, Null, and three... GhSINA11A Gene knockout cotton lines (KO-1, KO-2, KO-3) were cultured under normal conditions (Mock) and 200 mM NaCl stress, respectively. Under normal conditions, no identifiable differences were observed in the growth rate, plant height, or leaf morphology of the seedlings from each group. However, under salt stress, WT and Null lines exhibited wilting phenotypes after three days, with leaves withering earlier than the knockout lines. Figure 24 (A). Subsequently, the fresh weight and dry weight of cotton plants were measured. The results showed that under normal growth conditions, there was no significant difference in dry weight and fresh weight among WT, Null, and the three gene knockout lines. However, after salt treatment, the dry weight and fresh weight of the three gene knockout lines were significantly higher than those of WT and Null. Figure 24 (Middle B and 24 Middle C).

[0126] Subsequently, cotton leaves were stained and physiological parameters were measured. DAB staining results showed that salt treatment knocked out… GhSINA11A Cotton leaves showed fewer brown marks, indicating that they were less affected by salt stress. Figure 25 (A). Analysis of H2O2 content in leaves revealed no significant difference in H2O2 content among the groups under normal growth conditions, while the H2O2 content in the leaves of knockout cotton under salt treatment was significantly lower than that in WT and Null groups. Figure 25 (C). NBT staining showed similar results, with fewer blue traces appearing in the leaves of the knockout line. Figure 25 (B), and its O2 - The content is also significantly lower than that of WT and Null ( Figure 25 (Middle D). Continue to test the MDA and chlorophyll content of the leaves. After salt stress treatment, GhSINA11A The knockout strains had significantly lower MDA content than WT and Null, but significantly higher chlorophyll content. Figure 26 China A and Figure 26 (B); while under normal conditions, there were no significant differences in the above indicators among the materials in each group. These results further demonstrate that GhSINA11A weakens the salt tolerance of cotton plants, causing them to suffer more oxidative damage.

[0127] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. GhSINA11A The application of genes in improving the salt tolerance of cotton is characterized by, The application includes: inhibiting the growth of [substances] in cotton. GhSINA11A Gene expression enhances the salt tolerance of cotton; GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2; GhSINA11A The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The inhibition of cotton GhSINA11A Gene expression occurs through virus-induced gene silencing or CRISPR / Cas9 gene editing.

3. The application according to claim 2, characterized in that, The CRISPR / Cas9 gene editing includes the use of targeted... GhSINA11A The sgRNA of a gene.

4. The application according to claim 3, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

3.

5. A method for improving the salt tolerance of cotton, characterized in that, include: Inhibit cotton GhSINA11A Gene expression; the aforementioned GhSINA11A The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2; GhSINA11A The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

Images