Application of OsETR4 gene in regulating rice tolerance to alkali

CN122750752APending Publication Date: 2026-09-15HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611210081.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-11
Publication Date
2026-09-15

Smart Images

  • Figure CN122750752A_ABST
    Figure CN122750752A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and discloses OsETR4 Application of the gene in regulating the alkali tolerance of rice. OsETR4 The gene negatively regulates the tolerance of rice to alkali stress, and a loss-of-function mutation thereof can significantly enhance the alkali tolerance of rice. OsETR4 The application constructs a CRISPR / Cas9-OsETR4 vector for double-targeted knockout, targets the CDS sequence region of the gene, and obtains a mutant. etr4-ko The functional verification result shows that under the condition of alkali stress (pH 9.37), etr4-ko The chlorophyll a and chlorophyll b contents of the mutant are significantly higher than those of the wild type, the fresh weight of the aboveground part is significantly higher than that of the wild type, and the H2O2 accumulation amount is significantly lower than that of the wild type, and the mutant shows stronger alkali tolerance. The application provides a new gene target for breeding new alkali-tolerant rice varieties, and has important application value for genetic improvement of alkali-tolerant rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving OsETR4 Application of genes in regulating alkali tolerance in rice. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) is a staple crop in my country and many parts of the world, with a wide planting area. However, the effective utilization of saline-alkali land resources has long been limited by the salt tolerance of rice varieties. In rice production, abiotic stresses (such as drought, salinity, heavy metals, and low temperature) seriously affect its growth, development, and yield. Among these, saline-alkali stress is one of the major adverse factors restricting rice cultivation. Salinity-alkali stress includes not only high concentrations of sodium... + The resulting ion toxicity and osmotic stress are accompanied by secondary damage such as root damage and nutrient absorption obstruction caused by the high pH environment, which can lead to rice death in severe cases. Therefore, identifying and regulating key genes that regulate rice salt tolerance and creating salt-tolerant rice breeding materials are of great significance for rice breeding and the development and utilization of saline-alkali land.

[0003] Currently, some rice salt tolerance-related genes have been reported, but OsETR4 The function of the gene in regulating alkali tolerance is still unclear. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide... OsETR The application of four genes in regulating alkali tolerance in rice. This invention experimentally demonstrates... OsETR4 Genes that negatively regulate rice tolerance to alkaline stress were knocked out using CRISPR / Cas9 gene editing technology. OsETR4 Genes can significantly enhance the alkali resistance of rice.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for improving the alkali tolerance of rice, by using a CRISPR / Cas9 gene editing system to knock out the alkali tolerance of rice. OsETR4 Genes that enhance the alkali resistance of rice; OsETR4 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0006] Furthermore, the aforementioned OsETR4 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0007] Furthermore, the method of using the CRISPR / Cas9 gene editing system to knock out the gene in rice... OsETR4 The gene was generated by constructing a CRISPR / Cas9-OsETR4 vector.

[0008] Furthermore, the CRISPR / Cas9-OsETR4 vector contains a target for the OsETR4 The target sequence of the gene, wherein the target sequence is the nucleotide sequence shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] Furthermore, the nucleotide sequence of the sgRNA corresponding to the target sequence shown in SEQ ID NO.3 is shown in SEQ ID NO.5.

[0010] Furthermore, the nucleotide sequence of the sgRNA corresponding to the target sequence shown in SEQ ID NO.4 is shown in SEQ ID NO.6.

[0011] Secondly, the present invention also provides a method for knocking out rice OsETR4 Applications of genes, wherein the application is any of the following: A1) Application in improving the alkali resistance of rice; A2) Application in the preparation of alkali-tolerant rice; The OsETR4 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0012] Furthermore, the knockout of rice OsETR4 Gene editing is achieved through the CRISPR / Cas9 gene editing system.

[0013] Thirdly, the present invention also provides a method for knocking out rice OsETR4 Applications of gene-related biomaterials, wherein the application is any of the following: B1) Application in improving the alkali resistance of rice; B2) Application in the preparation of alkali-tolerant rice; The biomaterial is any one of the following C1) to C2): C1) contains the aforementioned CRISPR / Cas9-OsETR4 vector; C2) Recombinant Agrobacterium containing the above-mentioned CRISPR / Cas9-OsETR4 vector; The OsETR4 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention discloses and verifies for the first time OsETR4 The gene is a key gene that negatively regulates the alkali tolerance of rice. OsETR4 Loss-of-function mutations in genes can significantly enhance rice's tolerance to alkaline stress, specifically manifested in the following way: under alkaline stress conditions, etr4-ko The mutant showed significantly higher levels of chlorophyll a and chlorophyll b, significantly higher aboveground fresh weight, and significantly lower H2O2 accumulation than the wild type, indicating a milder degree of oxidative stress and stronger antioxidant capacity. These results suggest that... OsETR4 It can serve as a new target for the genetic improvement of alkali tolerance in rice, providing important genetic resources and molecular design breeding targets for the cultivation of new alkali-tolerant rice varieties. Attached Figure Description

[0015] Picture 1 for OsETR4 Schematic diagram of gene structure and mutation sites.

[0016] Picture 2 Wild type and under alkaline stress conditions etr4-ko Comparison of mutant plant phenotypes and physiological indicators; where A represents the plant phenotype after 5 days of alkali stress treatment; B and C represent the results of chlorophyll a and chlorophyll b content measurements, respectively; D and E represent the results of underground and aboveground fresh weight measurements, respectively; and F represents the results of H2O2 content measurements.

[0017] Picture 3 For wild type and etr4-ko A comparison of chlorophyll content in mutant plants; where A and B are the results of chlorophyll a and chlorophyll b content measurements, respectively. Detailed Implementation

[0018] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.

[0019] Example 1: Construction of CRISPR / Cas9-OsETR4 vector and OsETR4 Acquisition of mutants from OsETR OsETR4 Missing mutant rice.

[0020] The OsETR The amino acid sequence of the protein encoded by gene 4 is shown in SEQ ID NO.2().

[0021] 1. Constructing the CRISPR / Cas9-OsETR4 vector Using CRISPR / Cas9 gene editing technology, targeting OsETRTargets 1 (SEQ ID NO. 3, 5'-GCGGCAGTTCTTGGCGTCGGCGG-3') and 2 (SEQ ID NO. 4, 5'-CCAGCGCGTGAGCGACCTGCTCA-3') were designed in the CDS region of the four genes. The nucleotide sequence of sgRNA1 corresponding to target 1 is shown in SEQ ID NO. 5 (5'-CCGCCGACGCCAAGAACTGCCGC-3'), and the nucleotide sequence of sgRNA2 corresponding to target 2 is shown in SEQ ID NO. 6 (5'-TGAGCAGGTCGCTCACGCGCTGG-3').

[0022] The primer sequences designed based on target 1 and target 2 are as follows: BsF: AATAATGGTCTCAGGCCGGCGGCAGTTCTTGGCGTCGG (SEQ ID NO.7); F0: GCGGCAGTTCTTGGCGTCGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.8); R0: GCGCGTGAGCGACCTGCTCACGCTTCTTGGTGCC (SEQ ID NO.9); BsR: ATTATTGGTCTCTAAACGCGCGTGAGCGACCTGCTCA (SEQ ID NO. 10).

[0023] Using 2 ng / μL of pCBC-MT1T2 plasmid as a template, 4-primer PCR amplification was performed with 0.5 μmol / L F0 and R0, and 10 μmol / L BsF and BsR. The PCR product was purified and then subjected to enzyme digestion-ligation (system and reaction conditions are shown in Table 1) to obtain the CRISPR / Cas9-OsETR4 vector. The vector construction method followed that described in Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiple genome editing in plants. BMC Plant Biol. 2014 Nov 29;14:327.

[0024] Table 1 Enzyme digestion-ligation system and reaction conditions

[0025] Take 5 μL of the ligation product and transform it into competent E. coli cells. Screen on LB agar plates containing 50 μg / mL kanamycin. Identify single clones by colony PCR, select positive clones, extract plasmids, and send them for sequencing. The plasmid of the correctly sequenced positive clone is the CRISPR / Cas9-OsETR4 vector.

[0026] 2. Identification of CRISPR / Cas9-OsETR4 transformed rice callus and positive seedlings The correctly sequenced CRISPR / Cas9-OsETR4 vector was transformed into Agrobacterium competent cells GV3101 by electroporation. After colony PCR identification and verification, the bacteria were preserved for future use.

[0027] A single colony of correctly identified Agrobacterium GV3101 / CRISPR / Cas9-OsETR4 was inoculated into 2-3 mL of liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampin, and cultured overnight at 28°C with shaking. The next day, it was transferred to a large volume of liquid medium containing antibiotics and cultured with shaking. After several transfers, the bacterial cells were collected and resuspended at OD. 600 The value was between 0.8 and 1.0. Agrobacterium-mediated transformation of rice cultivar Handao 11 was performed using GV3101 / CRISPR / Cas9-OsETR4. Immature embryos were infected with Agrobacterium tumefaciens GV3101. The embryos infected with Agrobacterium tumefaciens GV3101 were placed on a selective medium for multiple screenings to obtain resistant callus. The resistant callus was then regenerated into seedlings, yielding the T0 generation of transformed seedlings. The Agrobacterium transformation method for rice was based on the methods described in Zhao, W., Zheng, S. & Ling, HQ. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivar Handao 297. Plant Cell Tiss Organ Cult 106, 475–483 (2011). 3. OsETR4 Identification of mutant T0 generation plants DNA was extracted from leaves of T0 generation transgenic rice plants. Genomic DNA was used as a template for PCR amplification and sequencing, with Zhonghua 11 as a control. The sequenced amplified products were compared with the Zhonghua 11 sequence to identify effective mutant lines, which were named... etr4-ko ( OsETR4 (Gene-edited plants). etr4-ko The mutant adds a T base in the target site 1 region ( Picture 1 This causes a frameshift mutation.

[0028] Example 2: OsETR4 Verification of alkali tolerance in gene-edited plants 1. Experimental material: Seeds of Zhonghua 11 (WT) etr4-ko Mutant seed.

[0029] 2. Test treatment (1) The culture was carried out in a greenhouse using hydroponic culture medium. The greenhouse temperature was controlled at 28±2°C and the daytime was 12 h / nighttime.

[0030] (2) After soaking and germinating the seeds, the seeds with white sprouts are evenly placed in the germination device and cultivated in a greenhouse.

[0031] (3) The seedlings were cultured in normal nutrient solution for 10 days and then the nutrient solution was changed. They were subjected to stress treatment with 10 mM Na2CO3 and 40 mM NaHCO3 (pH=9.37) for 5 days.

[0032] 3. Results and Analysis like Picture 2 As shown in A, after 5 days of alkali stress treatment, etr4-ko The mutant's growth was significantly better than the wild type. Further measurements were taken of its chlorophyll content, biomass, and hydrogen peroxide (H2O2) content under alkaline stress. Picture 2 B in Picture 2 As shown in C, after alkali stress treatment, etr4-ko The mutant had significantly higher levels of both chlorophyll a and chlorophyll b than the wild type. For example... Picture 2 D in Picture 2 As shown in E, regarding the fresh weight of the aboveground part, etr4-ko The mutant was significantly taller than the wild type, indicating a less stunted growth of its aboveground parts, while there was no significant difference in the fresh weight of its underground parts. Picture 2 As shown in F, etr4-ko The mutant had a significantly lower H2O2 content than the wild type, indicating that it experienced less oxidative stress and had stronger antioxidant capacity.

[0033] The above results indicate that, compared to the wild type, etr4-ko The mutants showed stronger tolerance to alkaline stress, specifically in the following ways: less yellowing of leaves, higher content of chlorophyll a and chlorophyll b, higher fresh weight of aboveground parts, and less H2O2 accumulation.

[0034] Example 3: OsETR4 Validation of alkali tolerance of gene-edited plants in a Tris-HCl buffer system 1. Experimental material: Seeds of Zhonghua 11 (WT) etr4-ko Mutant seed.

[0035] 2. Test treatment (1) The culture was carried out in a greenhouse using hydroponic culture medium. The greenhouse temperature was controlled at 28±2°C and the daytime was 12 h / nighttime.

[0036] (2) After soaking and germinating the seeds, the seeds with white sprouts are evenly placed in the germination device and cultivated in a greenhouse.

[0037] (3) The seedlings were cultured in normal nutrient solution for 10 days and then the nutrient solution was changed. Tris-HCl+NaOH (pH=9.37) stress treatment was carried out for 3 days.

[0038] 3. Results and Analysis To clarify OsETR4 The regulatory role of genes in rice tolerance to alkali stress was investigated by subjecting the rice to short-term (3-day) alkali stress treatment in a Tris-HCl buffer system (pH 9.37), and the results were measured for wild-type (WT) and wild-type (WT) rice. etr4-ko Chlorophyll content of mutants.

[0039] The results showed that after 3 days of alkali stress treatment with Tris-HCl (pH 9.37), etr4-ko The mutant had higher levels of both chlorophyll a and chlorophyll b than the wild type. Picture 3 This result is consistent with the trend under Na2CO3 / NaHCO3 alkaline stress treatment, further confirming that... OsETR4 Gene mutations help maintain chlorophyll homeostasis in rice under alkaline conditions.

[0040] The results of Example 2 show that OsETR4 It is a negative regulator of rice's tolerance to alkali stress; its deficiency can enhance the plant's ability to adapt to alkali stress. OsETR4 It can serve as a potential target for genetic improvement of alkali tolerance in rice.

Claims

1. A method for improving the tolerance of rice to alkaline stress, characterized in that, Knockout genes in rice by using CRISPR / Cas9 gene editing system to improve the salt tolerance of rice OsETR4 The CDS sequence of the gene is shown as SEQ ID NO.

1. OsETR4 ​ 2. The method of claim 1, wherein, The OsETR4 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

2.

3. The method of claim 1, wherein, The CRISPR / Cas9 gene editing system is used to knock out the OsETR4 The gene is achieved by constructing a CRISPR / Cas9-OsETR4 vector.

4. The method according to claim 3, characterized in that, The CRISPR / Cas9-OsETR4 vector comprises a target sequence targeting the OsETR4 gene, the target sequence being the nucleotide sequence shown in SEQ ID NO. 3 and SEQ ID NO.

4.

5. The method of claim 4, wherein, The nucleotide sequence of the sgRNA corresponding to the target sequence shown in SEQ ID NO.3 is shown in SEQ ID NO.

5.

6. The method of claim 4, wherein, The nucleotide sequence of the sgRNA corresponding to the target sequence shown in SEQ ID NO.4 is shown in SEQ ID NO.

6.

7. Use of a gene knockout in rice OsETR4 characterized in that The application is any one of the following: A1) Application in improving the alkali resistance of rice; A2) Application in the preparation of alkali-tolerant rice; The OsETR4 The CDS sequence of the gene is shown as SEQ ID NO.

1.

8. The application according to claim 7, characterized in that, The knocking out of the genes in rice is achieved by a CRISPR / Cas9 gene editing system. OsETR4 The knocking out of the genes in rice is achieved by a CRISPR / Cas9 gene editing system.

9. Use of a biological material related to the knock-out of a gene in rice OsETR4 characterized in that it comprises the step of The application is any one of the following: B1) Application in improving the alkali resistance of rice; B2) Application in the preparation of alkali-tolerant rice; The biomaterial is any one of the following C1) to C2): C1) contains the CRISPR / Cas9-OsETR4 vector as described in any one of claims 3 to 6; C2) contains recombinant Agrobacterium tumefaciens containing the CRISPR / Cas9-OsETR4 vector in C1); The OsETR4 The CDS sequence of the gene is shown as SEQ ID NO. 1.