A method for biosynthesis of l-threitol from d-meritol and its application

Abstract

The present application belongs to the field of microbial fermentation engineering and synthetic biology, and particularly relates to a method for biosynthesis of L-threonic acid from D-erythritol and application thereof. Specifically, the present application designs a new pathway for synthesis of L-threonic acid from D-erythritol. First, an engineered strain of Gluconobacter oxydans is used to convert D-erythritol into L-erythrulose. Then, a new pathway for synthesis of L-threonic acid from L-erythrulose is constructed, and its feasibility is verified in vitro. Subsequently, an engineered strain of Escherichia coli which does not consume L-threonic acid is obtained through metabolic engineering, and the above-mentioned pathway for synthesis of L-threonic acid from L-erythrulose is introduced, thereby constructing a L-threonic acid production strain. With D-erythritol as the substrate, the combination of the engineered strain of Gluconobacter oxydans and the above-mentioned metabolically engineered strain of Escherichia coli is used for L-threonic acid production, thereby providing a feasible strategy for realizing industrialized biological production of L-threonic acid.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation engineering and synthetic biology, specifically relating to a method and application of biosynthesizing L-threonic acid using D-erythritol. Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] L-threonic acid, also known as (2 R ,3 S L-2,3,4-Trihydroxybutyric acid is a naturally occurring chiral hydroxy fatty acid with good water solubility, chelation and biocompatibility. Compared with optical isomers such as D-threonic acid, L-threonic acid has higher biological activity and application value, and has broad application prospects in food, medicine, cosmetics, agriculture and other fields.

[0004] Currently, the main methods for producing L-threonic acid include chemical synthesis and microbial fermentation. Traditional chemical synthesis typically uses acrolein as a raw material, requiring multiple reaction steps (such as hydrogen cyanide addition, esterification, bromination, hydrolysis, and catalytic oxidation), ultimately yielding dL-threonic acid via recrystallization. This method has a low overall yield and is complex. Another method uses L-ascorbic acid as a raw material, preparing it through ring-opening via hydrogen peroxide oxidation. While this simplifies the process, it requires excessive oxidants and metal hydroxides, increasing the difficulty of separation and purification, and easily causing environmental pollution, which contradicts the principles of green chemistry. Microbial fermentation synthesis using glucose as a substrate generally yields extremely low quantities, making industrial-scale production difficult. Summary of the Invention

[0005] To address the problems existing in the prior art, the present invention aims to provide a method and application for the biosynthesis of L-threonic acid using D-erythritol. Specifically, the present invention designs a novel pathway for the synthesis of L-threonic acid using D-erythritol as a substrate. First, an engineered strain of *Glucosamine oxidase* converts D-erythritol into L-erythritol. Subsequently, a novel pathway for the synthesis of L-threonic acid using L-erythritol as a substrate is constructed, and its feasibility is verified in vitro. Then, through metabolic engineering of *Escherichia coli*, an engineered strain that does not consume L-threonic acid is obtained, and the aforementioned pathway for the synthesis of L-threonic acid using L-erythritol as a substrate is introduced, thus constructing an L-threonic acid-producing strain. Using D-erythritol as a substrate, the combined use of engineered *Glucosamine oxidase* and the aforementioned metabolically engineered *Escherichia coli* for L-threonic acid production provides a feasible strategy for the industrial-scale bioproduction of L-threonic acid. Based on the above research results, the present invention is thus completed.

[0006] Specifically, the technical solution of the present invention is as follows: A first aspect of the present invention provides a system for producing L-threonic acid using D-erythritol as a substrate, the system comprising at least the following three modules: (a1) A regioselective oxidation module configured to oxidize the secondary alcohol hydroxyl group of D-erythritol to a carbonyl group to generate L-erythritol; (a2) A stereoselective reduction module configured to reduce the carbonyl group of L-erythritol to L-threitol under the catalysis of a reductase; (a3) A continuous oxidation module, which is configured to oxidize the primary hydroxyl group of L-threitol to an aldehyde group under the action of an oxidase to generate L-threose; the aldehyde group of L-threose is further oxidized by an oxidase to generate L-threonic acid.

[0007] A second aspect of the present invention provides the application of the above-described system in the industrial production of L-threonic acid.

[0008] A third aspect of the present invention provides a method for the industrial production of L-threonic acid, the method comprising producing L-threonic acid using D-erythritol as a substrate based on the above-described system.

[0009] A fourth aspect of the present invention provides applications of the above-described system and industrial production method in the fields of agriculture, food, chemical and pharmaceutical industries.

[0010] The beneficial technical effects of one or more of the above technical solutions are as follows: The above-mentioned technical solution uses D-erythritol, which is widely available and inexpensive, as a starting substrate, significantly reducing production costs. Simultaneously, a novel biosynthetic pathway for L-threonic acid was designed and validated, and highly efficient L-erythritol-producing strains and L-threonic acid-producing strains were constructed using a modular strategy. Experimental results showed that the engineered strain of *Gluconobacter oxysporum* produced L-erythritol with a yield of 102.26 g / L, a yield of 0.9 g / g, and a production efficiency of 3.19 g / L / h. The engineered strain of *Escherichia coli* produced L-threonic acid through whole-cell catalysis of L-erythritol, with a yield of 7.11 g / L, a yield of 0.71 g / g, and a production efficiency of 0.15 g / L / h. Furthermore, the in vitro enzyme catalysis system also demonstrated high conversion efficiency (based on 6.1 g / L L-erythritol, it produced 5.1 g / L L-threonic acid, with a yield of 0.84 g / g and a production efficiency of 0.21 g / L / h). The above-mentioned technical solutions employ whole-cell catalysis or in vitro enzyme catalysis, with mild reaction conditions that avoid the use of toxic chemical reagents, conforming to the concept of green manufacturing, and therefore have good practical application value. Attached Figure Description

[0011] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0012] Figure 1 The plasmid pACYCDuet- constructed in this invention NsTDH-OpFDH and pETDuet- ScAldO-UtCAT A schematic diagram of the spectrum. Detailed Implementation

[0013] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0014] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0015] As mentioned earlier, producing L-threonic acid from L-ascorbic acid is currently a feasible method for high-yield L-threonic acid production, but the substrate for this method is expensive, making large-scale industrial production difficult. Producing L-threonic acid from glucose is currently the only biological method for obtaining L-threonic acid, but the yield is extremely low. D-erythritol is inexpensive and readily available, making it suitable as a substrate for large-scale production. E. coli It has a short growth cycle, high spatial and temporal yield, clear genetic background, and is relatively easy to genetically modify; the whole-cell catalysis method is simple to operate, has mild conditions, and can adapt to different production environments.

[0016] In view of this, in a typical embodiment of the present invention, a system for producing L-threonic acid using D-erythritol as a substrate is provided, the system comprising at least the following three modules: (a1) A regioselective oxidation module configured to oxidize the secondary alcohol hydroxyl group of D-erythritol to a carbonyl group to generate L-erythritol; (a2) A stereoselective reduction module configured to reduce the carbonyl group of L-erythritol to L-threitol under the catalysis of a reductase; (a3) A continuous oxidation module, which is configured to oxidize the primary hydroxyl group of L-threitol to an aldehyde group under the action of an oxidase to generate L-threose; the aldehyde group of L-threose is further oxidized by an oxidase to generate L-threonic acid.

[0017] Specifically, the regional selective oxidation module can be implemented using engineered *Glucobacterium oxytoxidans* bacteria, specifically, the engineered *Glucobacterium oxytoxidans* bacteria is wild-type. G. oxydans The starting strain, 621H, inhibits the expression of the polyol dehydrogenase GOX1068 gene and / or the membrane-bound alcohol dehydrogenase GOX0854 gene. In this invention, gene expression inhibition can be achieved through CRISPR / Cas gene editing tools, ClosTron class II intron-mediated gene inactivation, and homologous recombination techniques, thereby mediating gene knockdown, deletion (removal), or insertion. For details on the construction method of this genetically engineered bacterium, please refer to Chinese Patent CN109097314A.

[0018] The stereoselective reduction module and continuous oxidation module, which produce L-threonic acid from L-erythritol as a substrate, can be achieved through in vitro enzymatic catalysis or whole-cell catalytic synthesis.

[0019] Specifically, the in vitro enzyme catalysis process includes: using an in vitro enzyme catalysis system comprising L-threitol dehydrogenase, formate dehydrogenase, aldose oxidase and catalase to catalyze the production of L-threonic acid from L-erythritol.

[0020] Furthermore, the in vitro enzyme catalysis system also includes sodium formate and NADH, etc., which are not specifically limited here.

[0021] Specifically, the whole-cell catalytic synthesis process includes at least one engineered Escherichia coli strain that can produce L-threonic acid using L-erythritol as a substrate.

[0022] In another specific embodiment of the present invention, the engineered Escherichia coli is obtained by metabolic engineering modification of wild-type Escherichia coli, wherein the metabolic engineering modification includes any one or two of the following: (b1) Blocking the endogenous L-threonine metabolic pathway in wild-type Escherichia coli; (b2) A pathway for the synthesis of L-threonic acid from non-natural L-erythritolose.

[0023] In (b1), blocking the endogenous L-threonine metabolic pathway in *E. coli* specifically includes inhibiting further catabolism of L-threonine. Further, it may involve inhibiting the expression of one or more coding genes involved in L-threonine degradation in the originating bacterium, including L-threonine metabolism-related genes. ygbJ , ygbM ,glxR , ygbL and ygbJ isozyme gene ldhA , dld , lldD .

[0024] As mentioned earlier, gene expression can be suppressed through CRISPR / Cas gene editing tools, ClosTron class II intron-mediated gene inactivation and homologous recombination, thereby mediating the knockdown, deletion (knockout) or insertion of related genes, without specific limitations here.

[0025] In (b2), a non-natural pathway for the synthesis of L-threonic acid from L-erythritol is introduced. Specifically, the gene encoding one or more enzymes that can convert L-erythritol into L-threonic acid is overexpressed in the starting bacteria or the substrate bacteria obtained after treatment (b1), said enzymes including L-threitol dehydrogenase, formate dehydrogenase, aldose oxidase, and catalase.

[0026] In another specific embodiment of the present invention, the L-threitol dehydrogenase may specifically be derived from... Nostoc sp. L-threitol dehydrogenase NsTDH (its nucleotide sequence is shown in SEQ ID NO.1) is derived from Rhizonema L-threitol dehydrogenase RsTDH (its nucleotide sequence is shown in SEQ ID NO.2) of sp. is derived from Leptolyngbyaceae cyanobacterium L-threitol dehydrogenase LcTDH (its nucleotide sequence is shown in SEQ ID NO.3).

[0027] In another specific embodiment of the present invention, the formate dehydrogenase may be derived from... Ogataea parapolymorpha The formate dehydrogenase OpFDH of DL-1 (its nucleotide sequence is shown in SEQ ID NO.4) is derived from... Candida boidinii Formate dehydrogenase CbFDH (its nucleotide sequence is shown in SEQ ID NO. 5), and derived from Pseudomonas Formate dehydrogenase PsFDH of sp. 101 (its nucleotide sequence is shown in SEQ ID NO. 6).

[0028] In another specific embodiment of the present invention, the alditol oxidase may be derived from... Thermopolyspora flexuosa The alditol oxidase TfAldO (its nucleotide sequence is shown in SEQ ID NO.7) is derived from... Ardenticatenaceae bacterium The aldose alcohol oxidase AbAldO (its nucleotide sequence is shown in SEQ ID NO. 8) is derived from... Streptomyces coelicolorThe alditol oxidase ScAldO of A3 (its nucleotide sequence is shown in SEQ ID NO. 9) and three mutants of ScAldO: AldO-M4 (its nucleotide sequence is shown in SEQ ID NO. 10), mAldO (its nucleotide sequence is shown in SEQ ID NO. 11), and eAldO (its nucleotide sequence is shown in SEQ ID NO. 12).

[0029] In another specific embodiment of the present invention, the catalase may be derived from... Gluconobacter oxydans The catalase GoCAT (whose nucleotide sequence is shown in SEQ ID NO.13) is derived from... Bacillus subtilis The catalase BsCAT (whose nucleotide sequence is shown in SEQ ID NO.14) is derived from... E. coli The catalase EcCAT (whose nucleotide sequence is shown in SEQ ID NO.15) is derived from... Ureibacillus thermosphaericus The catalase UtCAT (whose nucleotide sequence is shown in SEQ ID NO.16).

[0030] This invention demonstrates through experiments that the use of the above-mentioned enzymes can ensure the successful completion of the non-natural L-threonine synthesis pathway.

[0031] In another specific embodiment of the present invention, the recombinant expression vector is constructed by linking the encoding genes of the above enzymes to a vector and introducing it into the starting bacteria or the chassis bacteria obtained after treatment (b1).

[0032] In this invention, the wild-type Escherichia coli can be Escherichia coli Nissle 1917 (DE3).

[0033] In this invention, the vector can be a plasmid vector, specifically an Escherichia coli plasmid vector, and more specifically pACYCDuet-1 and / or pETDuet-1, without any specific limitation.

[0034] In another specific embodiment of the present invention, the recombinant expression vector may be two or more.

[0035] The first recombinant expression vector can be pACYCDuet- NsTDH-OpFDH It can simultaneously express L-threonate dehydrogenase NsTDH and formate dehydrogenase OpFDH. (Gene) NsTDH and OpFDHThe multiple cloning sites 1 (with BamHI and HindIII restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively.

[0036] The plasmid pACYCDuet- NsTDH-OpFDH The diagram is as follows Figure 1 As shown.

[0037] The second recombinant expression vector can be pETDuet- ScAldO-UtCAT It can simultaneously express aldose alcohol oxidase ScAldO and catalase UtCAT. (Gene) ScAldO and UtCAT The multiple cloning sites are located at multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) of the vector pETDuet-1, respectively.

[0038] Furthermore, the second recombinant expression vector of the plasmid can be pETDuet- ScAldO-UtCAT The map is as follows Figure 1 As shown.

[0039] In another specific embodiment of the present invention, the application of the above system in the industrial production of L-threonic acid is provided.

[0040] In another specific embodiment of the present invention, a method for industrial production of L-threonic acid is provided, the method comprising producing L-threonic acid using D-erythritol as a substrate based on the above-described system.

[0041] In another specific embodiment of the present invention, the above-described system and industrial production method are provided for application in the fields of agriculture, food, chemical industry and pharmaceutical industry.

[0042] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials, reagents, instruments, and methods used in the following examples are all conventional materials, reagents, instruments, and methods in the art and are commercially available.

[0043] All techniques not mentioned in the following examples are conventional techniques in the field, and the strains, vectors pETDuet-1 and pACYCDuet-1, DNA purification kits, plasmid extraction kits, and other materials used are all commercially available products. The CRISPR-Cas9 gene editing technology used in this invention includes two knockout vectors: pEcCas and pEcgRNA.

[0044] E. coliThe activation medium for both the strains and the derived strains was Luria-Bertani medium (LB): 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl. An additional 2% (w / v) agar powder was added to the solid medium. Culture conditions: 37°C, 180 rpm. During the construction of the engineered E. coli strains, the final antibiotic concentrations used, based on the resistance requirements of the introduced plasmid, were: kanamycin, 50 μg / mL; spectinomycin, 50 μg / mL; ampicillin, 100 μg / mL; and chloramphenicol, 40 μg / mL.

[0045] Loading buffer (Buffer A, 1L): 5.54 g dodecahydrate and disodium hydrogen phosphate, 29.25 g sodium chloride, 1.3616 g imidazole, pH adjusted to 7.4 with phosphate.

[0046] Elution buffer (Buffer B, 1L): 5.54 g dodecahydrate and disodium hydrogen phosphate, 29.25 g sodium chloride, 34.04 g imidazole, pH adjusted to 7.4 with phosphate.

[0047] 10×SDS-PAGE electrophoresis buffer (1L): 30 g Tris, 144 g glycine, 10 g SDS.

[0048] 100 mM potassium phosphate buffer (pH 7.0): 14.04 g / L dipotassium hydrogen phosphate trihydrate, 5.24 g / L potassium dihydrogen phosphate, 2.92 g / L sodium chloride, pH adjusted to 7.4 with 5 M sodium hydroxide solution.

[0049] GMM Inorganic Salt Medium (1L): 1.5 g glutamic acid, 0.21 g isoleucine, 0.175 g glycine, 0.2 g glutamine, 2 g ammonium sulfate, 0.2 g magnesium sulfate heptahydrate, 2.2 g potassium dihydrogen phosphate, 0.2 g disodium hydrogen phosphate, 0.005 g triacetic acid, 0.03 g EDTA, 0.011 g ferrous sulfate heptahydrate, 0.009 g zinc sulfate heptahydrate, 0.0006 g cobalt chloride hexahydrate, 0.002 g manganese chloride tetrahydrate, 0.0006 g copper sulfate pentahydrate, 0.009 g calcium chloride dihydrate, 0.00008 g sodium molybdate dihydrate, 0.001 g boric acid, 0.0002 g potassium iodide, 0.0005 g calcium pantothenate, 0.0004 g nicotinic acid, 0.0004 g p-aminobenzoic acid, pH=6.

[0050] YS medium (1L): 80 g D-sorbitol, 24 g yeast extract, 5 g ammonium sulfate, 2 g potassium dihydrogen phosphate, 5 g magnesium sulfate heptahydrate, pH=6.

[0051] TSB buffer: 10% (w / v) PEG8000, 10% (v / v) glycerol, 5% (v / v) DMSO, 20 mM MgSO4, dissolved in LB medium, pH adjusted to 6.1 with hydrochloric acid solution, autoclaved at 121 °C for 20 min.

[0052] Electroporation buffer: 10% (v / v) glycerol, autoclaved at 121 °C for 20 min.

[0053] Determination methods for L-threonic acid, D-erythritol and intermediate products.

[0054] D-erythritol, L-erythritol, L-threitol, L-threose, and L-threonic acid were quantitatively determined using HPLC (LC-2050 Plus, Shimadzu, Japan). The detection conditions for D-erythritol and L-erythritol were as follows: Shodex SP0810 sugar column (300×7 mm, Showa Denko Corporation); a refractive index detector (RID); mobile phase ddH2O; flow rate 1.0 mL / min; column temperature 30 ℃; injection volume 10 μL; and analysis time 35 min.

[0055] The detection conditions for L-threitol, L-threose, and L-threonic acid were as follows: Aminex HPX-87H ion-exchange column (300 × 7.8 mm, Bio-Rad, USA); a refractive index detector (RID); 10 mM H₂SO₄ as the mobile phase; a flow rate of 0.4 mL / min; a column temperature of 30 ℃; an injection volume of 10 μL; and an analysis time of 35 min. The concentration of the target product could be calculated by converting the HPLC peak area into the concentration of the target product using an external calibration curve.

[0056] Example 1: Production of L-erythritol from D-erythritol by fermentation 1.1 Production of L-erythritol from D-erythritol by Shake-Flavor Fermentation Activation of wild-type in YS medium G. oxydans 621H, G. oxydans ΔGOX1068 G. oxydans ΔGOX0854 and G. oxydans ΔGOX0854 and ΔGOX1068 were inoculated at a ratio of 1% into GMM medium containing 20 g / L D-erythritol and cultured in shake flasks at 30 ℃ and 180 rpm. OD values ​​were measured during the culture process. 600nm The consumption of D-erythritol and the accumulation of L-erythritol were detected by HPLC.

[0057] The results show thatG. oxydans The ΔGOX1068 strain exhibited the best performance, with a significantly faster increase in OD value compared to other strains, a shorter time to reach the stationary phase, and a significantly higher synthesis of L-erythritol than the original strain. G. oxydans 621H and other knockout strains were compared to determine that this strain was the optimal production strain for subsequent fermentation experiments.

[0058] 1.2 Production of L-erythritol from D-erythritol in a fermenter G. oxydans Scale-up culture of ΔGOX1068 was carried out in a 5 L fermenter containing 3 L of fermentation medium. The strain was first activated in shake tubes for one generation, and then transferred at a 2% (v / v) inoculum to 500 mL Erlenmeyer flasks containing 100 mL of YS liquid medium. After 12 h of culture, the strain, having been activated for two generations, was transferred to the aforementioned 5 L fermenter. Fermentation conditions were: temperature 30℃, initial stirring speed 300 rpm, aeration rate 1 vvm, stirring speed correlated with dissolved oxygen, dissolved oxygen controlled at 30%, pH set at 6.0 ± 0.1, and initial D-erythritol concentration 120 g / L. Fermentation samples were taken at 3 h intervals to measure cell density, D-erythritol consumption, and L-erythritol production. During fermentation, 10 M NaOH was automatically added using an alkali pump to stabilize the medium pH at around 6.0. After the reaction was completed, the fermentation broth was centrifuged at 7000 rpm for 20 min, and the supernatant was collected as the substrate for subsequent reactions.

[0059] When fermentation reached 32 h, the total consumption of D-erythritol was 113.37 g / L, the production of L-erythritol reached 102.26 g / L, the product yield was 0.9 g / g, and the production efficiency was 3.19 g / L / h.

[0060] The in vitro enzyme catalysis system is flexible in design, has a fast reaction rate, high yield, and is easy to operate.

[0061] Example 2: In vitro enzymatic catalysis of L-erythrenolium to L-threonic acid 2.1 Construction of overexpression strains The genes encoding L-threitol dehydrogenase, formate dehydrogenase, aldose oxidase, and catalase have been processed. E. coli The optimized codons were synthesized by General Biotechnology (Anhui) Co., Ltd., and then cloned into the expression vector pETDuet.

[0062] 2.2 Protein purification After two generations of activation in LB shake tubes, the overexpressing strain was transferred to a 300 mL shake flask containing 50 mL of LB medium and cultured for 6–8 h. Then, at a 2% inoculum rate, it was transferred to a 5 L shake flask containing 1 L of LB medium and cultured at 37 ℃ and 180 rpm until OD (exponential growth rate) was reached. 600nm =0.8, add 0.5 mM IPTG for induction, and incubate overnight at 16 ℃ and 160 rpm. Collect bacterial cells by centrifugation at 6000 rpm for 10 min, wash the bacterial cells twice with PBS buffer, and resuspend in Buffer A to OD. 600nm =30, add PMSF to a final concentration of 0.5 mM, and use a high-pressure homogenizer to break up the bacterial cells to obtain crude enzyme solution. Centrifuge the crude enzyme solution at 4 ℃ and 11000 rpm for 45 min, collect the supernatant and filter it through a 0.22 μm filter membrane.

[0063] The above proteins were isolated and purified using an AKTA Basic 10 rapid protein purification system equipped with HisTrap HP (5 mL). Impurities were eluted with 5% Buffer B, and the target protein was eluted with 60% Buffer B. The target protein eluent was concentrated using an ultrafiltration concentrator, resuspended in potassium phosphate buffer, and concentrated again. This process was repeated three times. The desalted target protein was then concentrated again using an ultrafiltration concentrator, flash-frozen in liquid nitrogen, and then placed in a suitable environment. Keep it in an 80℃ refrigerator for later use.

[0064] SDS-PAGE was used to analyze the expression and purification of the target protein. The purified protein sample was mixed with 2×SDS loading buffer at a 1:1 ratio, heated at 105 °C for 7 min, and briefly centrifuged. 10 μL of the supernatant was then used for SDS-PAGE analysis. The protein gel consisted of a 3.75% stacking gel and a 13% separating gel. The electrophoresis program consisted of two stages: first, running at 80 V for 15 min; then adjusting the voltage to 120 V and running for 80 min. After electrophoresis, the protein gel was removed, stained with rapid protein staining solution for 30 min, and then destained with water.

[0065] 2.3 Enzyme activity assay L-Threitol Dehydrogenase Activity Assay: The activity of L-threitol dehydrogenase in response to L-erythritol was determined by detecting changes in the absorbance of NADH. A 200 μL reaction mixture contained 50 mM L-erythritol, 1 mM NADH, 10 µL L-threitol dehydrogenase, and 100 mM potassium phosphate buffer (pH 7.4). Enzyme activity units (U) are defined as the amount of enzyme required to consume 1 µmol of NADH per minute.

[0066] Formate dehydrogenase activity assay: The activity of formate dehydrogenase in relation to sodium formate was determined by detecting changes in the absorbance of NADH. A 200 μL reaction system contained 20 mM sodium formate and 2 mM NAD. + 10 µL formate dehydrogenase and 100 mM potassium phosphate buffer (pH 7.4). Enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 µmol NADH per minute.

[0067] Aldolipid oxidase activity assay: The oxidative activities of different aldolipid oxidases on L-threitol and L-threose were determined using O2 as the electron acceptor. A 500 μL reaction system contained 50 mM L-threitol or L-threose, 10 µL aldolipid oxidase, and 100 mM oxygen-saturated potassium phosphate buffer (pH 7.4). Oxygen consumption rates were recorded at 1-second intervals over the first 30 seconds using a Clark oxygen electrode at 30 °C. One unit of enzyme activity (U) was defined as the amount of enzyme required to consume 1 µmol of O2 per minute.

[0068] Catalase activity assay: A 200 μL reaction system contained 10 µL catalase, 10 mM H2O2, and 100 mM potassium phosphate buffer (pH 7.4). The change in light absorbance at 240 nm was measured using a SpectraMax Plus 384 microplate reader. One unit of relative activity (U) is defined as: the amount of A... 240 The amount of enzyme required to reduce the absorbance value by 0.1.

[0069] 2.4 Construction of in vitro enzyme catalytic system 2.4.1 In vitro coupled catalytic production of L-threitol from L-erythrenose The system contained 50 mM L-erythritol, 0.4 mg / mL NsTDH, 0.8 mg / mL OpFDH, 2 mM NADH, 60 mM sodium formate, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was carried out at 30 °C with shaking at 150 rpm for 3 h. During the reaction, a 100 μL sample was taken and 100 μL of 200 mM H₂SO₄ was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC.

[0070] After 3 h of reaction, L-erythritol was completely consumed, producing 49.52 mM L-threitol, with a yield of 99.04%.

[0071] 2.4.2 In vitro catalytic production of L-threitol from L-threitol to L-threonic acid The experiment was conducted in two groups: one with UtCAT and one without. The catalytic system in the group containing UtCAT consisted of 50 mM L-threitol, 0.4 mg / mL ScAldO, 90 U / mL UtCAT, and 100 mM potassium phosphate buffer (pH 7.4). The catalytic system in the group without UtCAT consisted of 50 mM L-threitol, 0.4 mg / mL ScAldO, and 100 mM potassium phosphate buffer (pH 7.4). Both catalytic systems were reacted at 30 °C with shaking at 150 rpm for 12 h. During the reaction, a 100 μL sample was taken and 100 μL of 200 mM H₂SO₄ was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC.

[0072] In the single ScAldO catalytic system, 15.23 mM L-threose and 30.91 mM L-threonic acid were generated within 12 h, with an L-threonic acid yield of 61.8%; in the reaction system with the introduction of UtCAT, 7.88 mM L-threose and 39.35 mM L-threonic acid were generated within 12 h, with an L-threonic acid yield of 78.8%.

[0073] 2.4.3 In vitro catalytic production of L-threonic acid from L-erythrenose Based on substrate source, the reaction was divided into two groups: commercially available L-erythritolose and L-erythritolose obtained from the above fermentation process. The catalytic system contained 50 mM L-erythritolose, 0.4 mg / mL NsTDH, 0.8 mg / mL OpFDH, 0.4 mg / mL ScAldO, 90 U / mL UtCAT, 2 mM NADH, 60 mM sodium formate, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was carried out at 30 °C with shaking at 150 rpm for 24 h. During this period, a 100 μL sample was taken and 100 μL of 200 mM H₂SO₄ was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC.

[0074] In both systems, the substrates were completely consumed, and no intermediate product L-threitol accumulated. Specifically, when commercially available L-erythritol was used as the substrate, 8.53 mM L-threose and 38.08 mM L-threonic acid were generated after 24 h, resulting in a calculated L-threonic acid yield of 76%. When the experimentally prepared L-erythritol was used as the substrate, 8.96 mM L-threose and 37.48 mM L-threonic acid were generated after 24 h, resulting in an L-threonic acid yield of 0.75%.

[0075] Example 3: In vitro enzymatic production of L-threonic acid from methanol Based on the above pathway for the synthesis of L-threonic acid from L-erythritolose, a methanol-coupled pathway for the synthesis of L-erythritolose can be achieved, using methanol as a substrate for the synthesis of L-threonic acid. The pathway for the synthesis of L-erythritolose from methanol is as follows: methanol can be converted to formaldehyde under the catalysis of alcohol oxidase; formaldehyde is then converted to 1,3-dihydroxyacetone under the catalysis of formaldehyde condensase; 1,3-dihydroxyacetone and formaldehyde are then converted to L-erythritolose under the action of D-fructose-6-phosphate aldolase.

[0076] alcohol oxidase can be derived from Phanerochaete chrysosporium alcohol oxidase PcAOX, derived from Pichia pastoris alcohol oxidase PpAOX, derived from Infundibulicybe gibba Oxidoreductases, derived from Moniliophthora roreri MCA 2997 alcohol oxidase MrAOX.

[0077] Formaldehyde condensase can be derived from Pseudomonas fluorescens benzaldehyde lyase FLS from biovar I, the FLS mutant FLS-M3 (FLS-I28L / T90L / N283H), and those derived from... Pseudomonas putida Benzoylformate decarboxylase mutant Formolase BFD-M6 (W86R / N87T / L110E / A460M / H281Y / S26F / G109S).

[0078] D-fructose-6-phosphoaldolase can be derived from... E. coli D-fructose-6-phosphate aldolase FSA and its mutant FSA A129S .

[0079] 3.1 Construction of overexpression strains The genes encoding alcohol oxidase, formaldehyde condensase, and D-fructose-6-phosphate aldolase were passed through E. coli The optimized codons were synthesized by General Biotechnology (Anhui) Co., Ltd., and then cloned into the expression vector pETDuet.

[0080] 3.2 Protein purification The protein purification process is shown in 2.2.

[0081] 3.3 Enzyme activity assay Alcohol oxidase activity assay. The oxidative activity of alcohol oxidase on different substrates was determined using O2 as the electron acceptor. A 500 μL reaction system contained 20 mM methanol, 10 µL alcohol oxidase, and 100 mM oxygen-saturated potassium phosphate buffer (pH 7.4). Oxygen consumption rates were recorded at 1-second intervals over the first 30 seconds using a Clark oxygen electrode at 30 °C. Enzyme activity units (U) were defined as the amount of enzyme required to consume 1 µmol of O2 per minute.

[0082] Formaldehyde condensate activity assay. The activity of formaldehyde condensate in catalyzing the oxidation of formaldehyde to dihydroxyacetone was determined by coupling with galactose oxidase. A 500 μL coupling reaction system contained 50 mM formaldehyde and 2.5 mg / mL... 1 Formaldehyde condensase, 0.1 mg / mL 1 Galactose oxidase, 0.5 mM TPP, 5 mM MgCl2, and 100 mM oxygen-saturated potassium phosphate buffer (pH 7.4) were used. The reaction was initiated by adding 50 mM formaldehyde, and the oxygen consumption rate was recorded at 1-second intervals over the first 30 seconds at 30 °C using a Clark oxygen electrode.

[0083] D-fructose-6-phosphate aldolase activity assay. The activity of D-fructose-6-phosphate aldolase was determined by HPLC detection of L-erythritol production. A 500 μL reaction system contained 50 mM formaldehyde, 50 mM 1,3-dihydroxyacetone, and 2 mg / mL... 1 D-fructose-6-phosphate aldolase, 5 mM MgCl2, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was initiated by adding 50 mM formaldehyde and terminated by adding 200 mM H2SO4 after 10 min. The amount of L-erythritol produced was analyzed by HPLC. One unit of enzyme activity (U) is defined as the amount of enzyme required to catalyze the production of 1 µmol of L-erythritol per minute.

[0084] 3.4 Construction of in vitro enzyme catalytic system 3.4.1 In vitro catalytic production of L-erythritol from formaldehyde The catalytic system contains 50 mM formaldehyde and 3 mg / mL formolase. BFD-M6 0.5 mg / mL FSA A129S The reaction mixture consisted of 90 U / mL L-CAT, 0.5 mM TPP, 5 mM MgCl2, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was carried out at 30 °C with shaking at 150 rpm for 18 h. During this period, a 100 μL sample was taken and 100 μL of 200 mM H2SO4 was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC. After 18 h of reaction, formaldehyde was completely consumed, yielding 8.3 mM L-erythritolose, with a yield of 66.4%.

[0085] 3.4.1 In vitro catalytic production of L-erythritol from methanol The catalytic system contains 50 mM methanol, 0.1 mg / mL PcAOX, and 3 mg / mL Formolase. BFD-M6 0.5 mg / mL FSA A129S The reaction mixture consisted of 90 U / mL UtCAT, 0.5 mM TPP, 5 mM MgCl2, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was carried out at 30°C with shaking at 150 rpm for 18 h. During this period, a 100 μL sample was taken and 100 μL of 200 mM H2SO4 was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC. After 18 h of reaction, methanol was completely consumed, yielding 6.5 mM L-erythritolose, with a yield of 52%.

[0086] 3.4.1 In vitro catalytic production of L-threonic acid from methanol The catalytic system contains 50 mM methanol, 0.1 mg / mL PcAOX, and 3 mg / mL Formolase. BFD-M6 0.5 mg / mL FSA A129S The reaction mixture consisted of 0.4 mg / mL NsTDH, 0.8 mg / mL OpFDH, 0.4 mg / mL ScAldO, 90 U / mL UtCAT, 2 mM NADH, 0.5 mM TPP, 5 mM MgCl2, 60 mM sodium formate, and 100 mM potassium phosphate buffer (pH 7.4). The reaction was carried out at 30 °C with shaking at 150 rpm for 24 h. During this period, 100 μL of the mixture was taken and 100 μL of 200 mM H2SO4 was added to terminate the reaction. Substrate consumption and product formation were detected by HPLC. After 24 h of reaction, methanol was completely consumed, yielding 4.8 mM L-threonic acid, with a yield of 38.4%.

[0087] E. coli It has a short growth cycle, high spatiotemporal yield, clear genetic background, and is relatively easy to genetically modify.

[0088] Example 4: E. coli Using BL21 Nissle1917 (DE3) as the starting strain, a chassis strain for producing L-threonine was constructed. strain E. coli The BL21 Nissle1917 (DE3) endogenous L-threonate degrading enzyme degrades L-threonate in whole-cell catalytic systems, resulting in the loss of the product L-threonate. This invention reduces L-threonate loss by directly knocking out the relevant coding gene for L-threonate degradation.

[0089] 4. Knockout of L-threonate degradation-related genes 4.1 L-Threonate dehydrogenase geneygbJ Knockout The L-threonine degradation gene was edited using CRISPR-Cas9 gene editing technology. Further, this was used to construct a strain. E. coli BL21 Nissle1917 (DE3)-Δ ygbJ As an example, this demonstrates the degradation gene. ygbJ The basic procedure for knocking out.

[0090] Construction strain E. coli BL21 (DE3)-Δ ygbJ The basic procedure is as follows: Preparation of chemically competent cells The starting strain E. coli After BL21 (DE3) was activated for one generation in LB, it was transferred to a new LB and cultured to OD. 600nm The concentration was 0.5–0.6; then, 1 mL of bacterial culture was centrifuged at 4 °C and 6000 rpm for 10 min; the supernatant was discarded and the bacterial cells were resuspended in 50 μL of TSB solution to prepare chemically transformed competent cells.

[0091] Import pEcCas knockout vector The knockout vector pEcCas was extracted according to the extraction procedure of the plasmid extraction kit, and then pEcCas was transformed into plasmid using a heat shock method. E. coli BL21 Nissle1917 (DE3) was transformed into competent cells to obtain E. coli BL21Nissle1917 (DE3)-pEcCas strain.

[0092] Preparation of dsDNA-N20- ygbJ Excerpt Use https: / / chopchop.cbu.uib.no / for online website design ygbJ The N20 sequence of the gene was used to design reverse complementary primers for gRNA based on the screened N20 sequence. ygbJ -F and gRNA- ygbJ -R, anneal the two primers to form dsDNA-N20- ygbJ Excerpt.

[0093] Annealing system: 25 μL ddH2O, 5 μL T4 ligase buffer, 10 μL gRNA- ygbJ -F, 10 μL gRNA- ygbJ -R (primer concentration is 10 µM).

[0094] Annealing procedure: The annealing system was incubated at 95 °C for 5 min, and then the reaction temperature was gradually reduced to 16 °C by programmed cooling and held at 16 °C for 10 min.

[0095] Construction of the knockout vector pEcgRNA-dsDNA-N20- ygbJ Extract the knockout vector pEcgRNA according to the extraction procedure of the plasmid extraction kit, and use... BsaI Linear vector pEcgRNA was obtained after single enzyme digestion; subsequently, it was combined with dsDNA-N20- ygbJ The fragments were ligated using T4 DNA ligase to obtain pEcgRNA-dsDNA-N20- ygbJ .

[0096] T4 DNA ligation system: 6 µL dsDNA-N20- ygbJ Fragment (diluted 200-fold), 1 µL linear pEcgRNA vector, 1 μL T4 ligase buffer, 1 μL T4 DNA ligase, 1 μL ddH2O.

[0097] The T4 DNA ligation system was transformed into [a specific DNA ligation system] using a heat shock method. E. coli DH5α competent cells were spread onto solid plates containing spectinomycin and incubated upside down. Finally, single colonies were picked from the plates and cultured in LB broth (containing spectinomycin) for further incubation. After centrifugation to collect the bacterial cells, the plasmid pEcgRNA-dsDNAN20- was extracted according to the plasmid extraction kit procedure. ygbJ The obtained plasmid was Store frozen at 20°C.

[0098] Build ygbJ Gene knockout donor fragment by E. coli Using the BL21 Nissle1917 (DE3) genome as a template, uf -ygbJ / ur -ygbJ PCR amplification of genes using primers ygbJ Upstream homologous arm fragment; using df -ygbJ / dr -ygbJ PCR amplification of genes using primers ygbJ Downstream Homologous arm fragments; the upstream and downstream homologous arms were overlapped in PCR, and the fragments were recovered from the gel to obtain... ygbJ The fusion fragment of upstream and downstream homologous arms of a gene ygbJ The donor fragment for gene knockout. Among them, the amplified gene. ygbJ The primer design for knocking out the donor fragment is as follows: uf-ygbJ :cgcccgtttcaccgtgactttatc ur -ygbJ :ctgctctccttgttaatttaagtgatat df -ygbJ :cttaaattaacaaggagagcagtcaagattggcgttatcgccgatgat dr -ygbJ :ttgagagcatgaaccggagagcac preparation E. coli Electrocompetent cells of BL21 Nissle1917 (DE3)-pEcCas Will E. coli The BL21 Nissle1917 (DE3)-pEcCas strain was activated in LB for 12 h and then transferred at a 1% inoculum to a shake flask containing 50 mL of LB (10 mM arabinose induced λRed recombinant protein expression). The shake flask was then incubated at 37 ℃ and 180 rpm until the strain showed OD. 600nm When the bacterial culture temperature reaches 0.5–0.6, remove the shake flask and incubate on ice for 10 min. Then, centrifuge at 4 °C and 6000 rpm for 10 min using a low-temperature high-speed centrifuge, discarding the supernatant. Wash the bacterial cells twice with ddH2O in an ice bath, and then once with 10% (v / v) glycerol in an ice bath. Finally, resuspend the bacterial cells in 150 μL of 10% glycerol in an ice bath to obtain the desired bacterial culture. E. coli BL21 Nissle1917 (DE3)-pEcCas electroporation of competent cells; competent cells can be placed in... Store frozen at 80°C.

[0099] Construction strain E. coli BL21 Nissle1917 (DE3)-Δ ygbJ Knockout vector pEcgRNA-dsDNA-N20- ygbJ (approximately 200 ng) and ygbJ Gene knockout donor fragment (approximately 400 ng) and electrocompetent cells E. coli BL21 Nissle1917 (DE3)-pEcCas were mixed together; then transferred to a 2 mm electroporation cuvette and incubated on ice for 3 min; the mixture was then transferred into competent cells using an electroporator. E. coliIn BL21 (DE3)-pEcCas; after electroporation, immediately add 1 mL LB broth to the electroporation vessel to resuspend the bacterial cells and transfer to a new 1.5 mL centrifuge tube, incubate at 37 °C and 960 rpm for 1 h; finally, centrifuge the bacterial culture at 6000 rpm for 2 min, discard the supernatant, and streak all remaining bacterial cells onto double-antibiotic LB solid selection medium (kanamycin + spectinomycin). After single colonies grow on the double-antibiotic plate, pick them and culture them in a new LB medium, using primers uf -ygbJ / dr -ygbJ Perform bacterial culture PCR verification.

[0100] PCR-verified single clones were transferred to new LB tumblers (10 mM rhamnose + kanamycin) and incubated at 37 °C and 180 rpm for 12–16 h. Subsequently, the clones were streaked onto new LB agar plates (kanamycin) using a sterile spreader and incubated until new single clones formed. Next, new single clones were picked up with a sterile toothpick and spotted sequentially onto new LB agar plates containing spectinomycin and then onto LB agar plates containing kanamycin, inverted for incubation. Finally, single clones that grew on kanamycin plates but not on spectinomycin plates were considered to have successfully eliminated pEcgRNA-dsDNA-N20-. ygbJ strains.

[0101] The above successfully eliminated pEcgRNA-dsDNA-N20- ygbJ The single clones were transferred to new LB shakers and cultured at 37°C and 180 rpm for 12–16 h. Then, they were streaked onto LB agar plates containing 10% sucrose using a sterile spreader and cultured until new single clones formed. Similarly, new single clones were picked up with a sterile toothpick and spotted onto new LB agar plates containing kanamycin and then onto antibiotic-free LB agar plates, and cultured upside down. Finally, the single clones that grew on antibiotic-free LB agar plates but could not grow on kanamycin plates were the strains that successfully eliminated pEcCas.

[0102] This will simultaneously eliminate pEcgRNA-dsDNA-N20- ygbJ Single clones of pEcCas were transferred to fresh LB medium, and their genomes were extracted according to the procedure of the genome extraction kit, using primers uf -ygbJ / dr -ygbJ Perform final temperature gradient validation (temperature gradient validation range: 50–70 °C); select mutant strains with correctly sized electrophoretic bands. E. coli BL21 (DE3)-Δ ygbJ Transfer and store in 15% glycerol.

[0103] 4.2 2-O-3,4-dihydroxybutyrate isomerase ygbM Knockout Similarly, genes ygbM The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. ygbM The primer design for knocking out the donor fragment is as follows: uf -ygbM :ggcccaaccatttcccccggcgtg ur-ygbM:tgcattaactccttaattccgcaat df -ygbM :attgcggaattaaggagttaatgcattcgctcaatccctaattacaacgt dr -ygbM :tatcgcttaattttgtcgcgccttcc 4.3 3-Oxo-2,4-dihydroxybutyrate kinase glxR Knockout Similarly, genes glxR The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. glxR The primer design for knocking out the donor fragment is as follows: uf -glxR :tcgcggcgttgaatttatgttccc ur- glxR :AATTAACCTCTTTTAAATTTCGCTTTT df -glxR :AAAAGCGAAATTTAAAAGAGGTTAATTTACCCGCAATAAAAATGGCCGAT dr -glxR :GAAATCGCCCAAATCGCCATACCGC 4.4 3-O-2,4-dihydroxybutyrate-4-phosphate decarboxylase ygbL Knockout Similarly, genes ygbL The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. ygbL The primer design for knocking out the donor fragment is as follows: uf -ygbL ctggctcgcttacagcaagagggc ur- ygbL :gataaaaactctctttgggctcgtgaa df -ygbL :acgagcccaaagagagtttttatctgcaatgcctcgttttgcagc dr -ygbL :aattagcgccaggcgtcaaaccagc 4.5 L-threonate dehydrogenase isoenzyme D-lactate dehydrogenase gene ldhA Knockout Similarly, genes ldhA The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. ldhA The primer design for knocking out the donor fragment is as follows: uf -ldhA :gcggctgattttcaaacgcggcg ur- ldhA :aagactttctccagtgatgttgaatcacatt df -ldhA :attcaacatcactggagaaagtctttcttgccgctcccctgcattcca dr -ldhA :tgggtagggtgtgccgctttattgttg 4.6 L-threonate dehydrogenase isoenzyme D-lactate dehydrogenase gene dld Knockout Similarly, genes dld The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. dld The primer design for knocking out the donor fragment is as follows: uf -dld :gtagcgatctgccggacttttaccct ur- dld :tttccactccttgtggtggcgaaaaaa df -dld :TTTTCGCCACCACAAGGAGTGGAAATAATTACGGATGGCAGAGTATCGC dr -dld :ggagatgaaaggggtctattcgcgcg 4.7 L-Threonate dehydrogenase isoenzyme L-lactate dehydrogenase gene lldD Knockout Similarly, genes lldD The construction and knockout steps of the knockout vector can be referenced from the above gene... ygbJ This is accomplished through a knockout procedure, in which gene amplification is performed. lldD The primer design for knocking out the donor fragment is as follows: uf -lldD :tccttaatgattgttttacccagacgc ur- lldD :gcgtttttctccctcgaatgctca df -lldD :tgagcattcgagggagaaaaacgcgggttagacgaatatctgctatcct dr -lldD :ctcggcaatattgaagttgggcgc Finally, a chassis strain that does not consume L-threonine was obtained. E. coli BL21 Nissle1917 (DE3)-Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD .

[0104] Example 5: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0105] In this embodiment, the L-threonate dehydrogenase encoding gene NsTDH and formate dehydrogenase encoding gene OpFDH Multiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0106] The gene encoding alditol oxidase is expressed ScAldO and catalase encoding gene UtCAT The multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7Promoter.

[0107] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. NsTDH - OpFDH and pETDuet- ScAldO - UtCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD An engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0108] Example 6: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains 6.1 Plate activation: Take an appropriate amount from the glycerol tube. E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- NsTDH - OpFDH + pETDuet- ScAldO - UtCAT The bacterial suspension was streaked onto new ampicillin + chloramphenicol solid plates using a sterile spreader; and incubated at 37 °C until single clones were generated on the plates.

[0109] 6.2 Shake tube activation: Pick single clones from the above ampicillin + chloramphenicol solid plate, transfer them to LB shake tubes, and incubate at 37 ℃ and 180 rpm for 12 h.

[0110] 6.3 Shake flask activation: The seed culture activated by shaking tube was transferred to a shake flask containing 100 mL LB medium at an inoculation rate of 1%, and activated and cultured at 37 ℃ and 180 rpm for 12 h.

[0111] 6.4 Cultivation of engineered strains: At an inoculum rate of 2% (v / v), the seed culture activated in the shake flask was inoculated into a shake flask containing 1 LLB of medium and cultured at 37 ℃ and 180 rpm until OD... 600nmThe expression of key proteins was induced by adding IPTG (working concentration 0.5 mM) at 0.6-0.8 ℃ and 160 rpm for 12 h.

[0112] 6.5 Preparation of Resting Cells: Collect the bacterial culture after 12 h of induction and centrifuge at 4 ℃ and 6000 rpm for 10 min using a low-temperature high-speed centrifuge, discarding the supernatant. Resuspend the bacterial cells in 30 mL of 0.85% physiological saline, transfer the culture to a 50 mL centrifuge tube, and centrifuge again at 4 ℃ and 6000 rpm for 10 min using a low-temperature high-speed centrifuge, discarding the supernatant; repeat the above operation once. Store the collected bacterial slurry at 4 ℃ for later use.

[0113] 6.6 Whole-cell catalysis: The conditions for whole-cell catalysis are as follows: the catalytic system is 10 mL, and the cell density is OD. 600nm =20, temperature controlled at 30 ℃, rotation speed controlled at 150 rpm, substrate was 90 mM sodium formate and 83 mM L-erythritol obtained by fermentation of *Gastrospermum oxysporum*, buffer was 100 mM potassium phosphate buffer (pH 7.4).

[0114] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- NsTDH - OpFDH + pETDuet- ScAldO - UtCAT After 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 52.62 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 63.4%, and the production efficiency was 0.15 g / L / h.

[0115] Example 7: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0116] In this embodiment, the L-threonate dehydrogenase encoding gene RsTDH and formate dehydrogenase encoding gene PsFDHMultiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0117] The gene encoding alditol oxidase is expressed TfAldO and catalase encoding gene GoCAT The multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0118] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. RsTDH - PsFDH and pETDuet- TfAldO - GoCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD An engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0119] Example 8: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains The relevant steps can be found in Embodiment 6 of this invention.

[0120] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- RsTDH - PsFDH + pETDuet- TfAldO - GoCATAfter 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 42.55 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 51.3%, and the production efficiency was 0.12 g / L / h.

[0121] Example 9: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0122] In this embodiment, the L-threonate dehydrogenase encoding gene LcTDH and formate dehydrogenase encoding gene CbFDH Multiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0123] The gene encoding alditol oxidase is expressed AbAldO and catalase encoding gene BsCAT The multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0124] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. LcTDH - CbFDH and pETDuet- AbAldO - BsCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD An engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0125] Example 10: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains The relevant steps can be found in Embodiment 6 of this invention.

[0126] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3)- Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- LcTDH - CbFDH + pETDuet- AbAldO - BsCAT After 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 47.68 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 57.4%, and the production efficiency was 0.14 g / L / h.

[0127] Example 11: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0128] In this embodiment, the L-threonate dehydrogenase encoding gene NsTDH and formate dehydrogenase encoding gene CbFDH Multiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0129] The gene encoding alditol oxidase is expressed mAldO and catalase encoding gene EcCAT The multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0130] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. NsTDH - CbFDH and pETDuet- mAldO - EcCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldDAn engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0131] Example 12: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains The relevant steps can be found in Embodiment 6 of this invention.

[0132] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- NsTDH - CbFDH + pETDuet- mAldO - EcCAT After 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 27.32 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 32.9%, and the production efficiency was 0.08 g / L / h.

[0133] Example 13: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0134] In this embodiment, the L-threonate dehydrogenase encoding gene NsTDH and formate dehydrogenase encoding gene OpFDH Multiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0135] The gene encoding alditol oxidase is expressed eAldO and catalase encoding gene UtCAT The multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0136] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. NsTDH - OpFDH and pETDuet- eAldO - UtCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD An engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0137] Example 14: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains The relevant steps can be found in Embodiment 6 of this invention.

[0138] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- NsTDH - OpFDH + pETDuet- eAldO - UtCAT After 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 17.39 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 21%, and the production efficiency was 0.05 g / L / h.

[0139] Example 15: Introducing a biological pathway for the synthesis of L-threonic acid from L-erythritol into chassis strains Construct an engineered strain for producing L-threonic acid based on plasmids.

[0140] In this embodiment, the L-threonate dehydrogenase encoding gene NsTDH and formate dehydrogenase encoding gene OpFDH Multiple cloning site 1 (with BamHI and HindIII restriction sites) and multiple cloning site 2 (with BglII and XhoI restriction sites) are located in the vector pACYCDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0141] The gene encoding alditol oxidase is expressed AldO-M4 and catalase encoding gene UtCATThe multiple cloning sites 1 (with BamHI and SalI restriction sites) and 2 (with BglII and XhoI restriction sites) are located in the vector pETDuet-1, respectively, and both use the P promoter. T7 Promoter.

[0142] L-threonine was converted to plasmid pACYCDuet- via TSB chemical transformation. NsTDH - OpFDH and pETDuet- AldO-M4 - UtCAT Simultaneously, chassis strains modified through a series of metabolic engineering processes were introduced. E. coli BL21Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD An engineered strain of *Escherichia coli* capable of producing L-threonine using plasmids was obtained.

[0143] Example 16: Production of L-threonic acid from L-erythritol via whole-cell catalysis by engineered Escherichia coli strains The relevant steps can be found in Embodiment 6 of this invention.

[0144] Whole-cell catalysis results showed that the engineered strain E. coli BL21 Nissle1917 (DE3) - Δ ygbJ -Δ ygbM -Δ glxR -Δ ygbL- Δ ldhA -Δ dlD- Δ lldD (pACYCDuet- NsTDH - OpFDH + pETDuet- AldO- M4 - UtCAT After 48 h of whole-cell catalysis, L-erythritol was completely consumed, producing 37.41 mM L-threonic acid with no L-threitol accumulation. The yield of L-threonic acid was 45.1%, and the production efficiency was 0.11 g / L / h.

[0145] The nucleotide sequence information involved in this invention includes: 1. Sequence characteristics Length: 804 bp Source: Candida genus ( Nostoc sp. ) L-threitol dehydrogenase encoding gene NsTDH Nucleic acid sequence information ATGACGGCAAAAGCAACTTATCAGTTTGCAGGTAAGACGATCCTAATTACTGGCGGTGCAGGAGATATTGGCAAGGCAACCGCACACCGTTTTGCGTCTAATGGCGCAGGAATAGCCCTGCTAGATTTGAATGAACCGAAGATGGCAGATGTGGCTGGGGAACTAAAAGGTTACAACGTTCCAGTTGGCACGTTTCGCTGTGATGTTACAGCTAGTCATGATGTTGTCAAAGCTTTTACCGACGCTGTAAAGCAGTTTGGGCGGATTGACTATGTATTTAATAATGCAGGTTATCAAGGAGTGTTTGCCAAAACTGACGAATATCCTGAACACGACTTTCAAAAGGTGATTAACATTAACGTTGTCGGTGTTTTCCAAATTCTCAAGGCGGCTGCACAACAATTACGCGATGCAGGTGGAGGTGCGATCGTTAATATGGCCAGTTATGCAGGGGTGGTTGGGCCACCAAATATGTTGGCTTATGCCGCTTCAAAGTTTGCTGTCATTGGAATTACTCAAACAGCAGCAAAAGACTTAGCACCTTACGGCATTCGCGTGAATGCGCTCTCGCCTGCGTTGATTGGCCCTGGTTTTATGTGGACAAGACAAACCGAATTACAAGCAGCAGTAGGATCGCAATACTTTGATGCCGATCCCAAGGTGGTTGAGCAACAGATGATCGATTCAGTGCCAATGCGGCGTTTAGGAAGCCTGGAAGAGGTGGCAAATGGAGTAGCGTTTTTGATGAGCGAAGAGGCAAGCTACATTACTGGGTTTAACTTGGAGGTTACTGGGGGAGAATAG 2. Sequence characteristics Length: 804 bp Source: Cyanobacterium ( Rhizome sp.) L-threitol dehydrogenase coding gene RsTDH Nucleic acid sequence information ATGACTGCAATTGCAACCTATCAGTTTGCAGGTAAAACTATCTTGATCACGGGTGGTGCGGGAGATATTGGCAAGGCAACGGCACACCGTTTTGCCGCTAACGGGGCAGGTGTAGCCTTGCTAGATTTGAATGAACAGAAGATGGCAGATGTGGCTTCTGAACTAAAAAGTTACGATGTTCCCGTCGGCACATTTCATTGTGATGTTACGGCTGCTGATGATGTTGCCAAAGCTTTTAGTGGTGCAGTAGAGCAGCTTAGGCGGATCGACTATGTCTTTAACAACGTAGGCTATCAAGGAGCGTTTGCGAAGACGGATGAATATCCTTCAGACGACTTTCAAAAGGTGATTAACATTAATGTCGTTGGCGTTTTTCACGTTCTGAAGGCGGCTGCACAGCACCTGCGTAATGCAGGTGGAGGCGTTATTGTCAACACGGCTTCTTACGCTGGGGTGGTTAGTCCCCCAAATATGCTGGCATATGGCGCTTCAAAGTTTGCTGTCATTGGTATGACTCAGACGGCAGCCAAAGATTTGGCTCCCTACGGCATTCGGGTGAATGCGCTCTCTCCGGCGCTGATCGGGCCTGGTTTTATGTGGACACGGCAAACAGAATTGCAGGCAGCAGTGGGATCGCAGTACTTTGATGCCGATCCTAAGGTAGTTGAGCAACAGATGATTAATTCAGTAGCGATGCGGCGTTTAGGAAGCTTGGAAGAGGTGGCGAATGGAGTAGCATTTCTGATGAGCGACGAAGCAAGCTACATGACTGGGTTTAACTTGGAGGTGACTGGAGGGATCTAG 3. Sequence Characteristics Length: 805 bp Source: Cyanobacterium of Leptolyngbyaceae ( Leptolyngbyaceae cyanobacterium ) L-threitol dehydrogenase coding gene LcTDH Nucleic acid sequence information ATGGACTGCTAGAGCAACCTATGATTTTGCTGGCAAGACAATTCTGATTACAGGCGGTGCAGGAGATATTGGTCAAGCCACTGCTCATCGCTTTGCTAACAATGGTGCTGCTGTCGCGCTTGTGGACTTAAACGAAGCGAAAATGGCAGACGTTGCTCAAGAACTAGAGGAGTACAACGTTCCAATCGGCGCTTTTCGCTGTGATGTTACTGCTTATGATGACGTTGCTAAAGCTTTTGCTGGCGCTGTGGAGCAGTTTGGGGGGATCAACTATGTCTTTAACAACGCGGGCTATCAAGGAGCGTTTGCCAAAACCGACGAGTATCCCGAAGAAGACTTTCAAAAGGTCATCAACATCAACGTTGTAGGCGTTTTTCACGTTCTTAAGGCTGCGGCACAGCATCTACGCGATTCGGGTGGAGGAGCAATAGTCAATATGGCAAGCTATGCGGGTGTGGTTGGTCCTCCTAATATGCTCGCCTACTCCGCTTCAAAGTTTGCGGTAATTGGAATCACTCAGACGGCAGCGAAAGACTTGGCTCCCTACGGCATCAGGGTGAATTCGCTCTCGCCTGCGTTGATTGGTCCCGGCTTTATGTGGACGCGGCAGACCCAATTGCAAGCCGCTGTAGGGTCACAGTATTTTGATGCCGATCCTAATGTGGTCGAGCAACAGATGATCGATTCAGTACCGATGAGCCGTTTGGGAAGCCTTGAAGAGGTGGCTAATGGGGTAGCATTTCTCATGAGCCAGGAGGCAAGCTACATTACGGGGTTTAACTTGGAAATTACTGGCGGACAATAG 4. Sequence Characteristics Length: 1089 bp Source: Ogataea parapolymorpha ( O. parapolymorpha DL-1) Formate dehydrogenase encoding gene OpFDH Nucleic acid sequence information 5. Sequence characteristics Length: 1095 bp Source: Candida botrytis cinerea ( Candida boidinii ) Formate dehydrogenase encoding gene CbFDH Nucleic acid sequence information 6. Sequence characteristics Length: 1206 bp Source: Pseudomonas ( Pseudomonas sp. 101) Formate dehydrogenase encoding gene PsFDH Nucleic acid sequence information 7. Sequence characteristics Length: 1287 bp Source: Curvularia polyspora ( Thermopolyspora flexuosa ) Aldolipid oxidase encoding gene TfAldO Nucleic acid sequence information 8. Sequence characteristics Length: 1269 bp Source: Streptomyces (family Streptomyces) Ardenticatenaceae bacterium ) Aldolipid oxidase encoding gene AbAldO Nucleic acid sequence information 9. Sequence characteristics Length: 1257 bp Source: Streptomyces azureense ( Streptomyces coelicolor A3) Aldolipid oxidase encoding gene ScaldO Nucleic acid sequence information 10. Sequence characteristics Length: 1257 bp Source: Streptomyces azureense ( Streptomyces coelicolor A3) Aldolipid oxidase encoding gene AldO-M4 Nucleic acid sequence information 11. Sequence characteristics Length: 1257 bp Source: Streptomyces azureense ( Streptomyces coelicolor A3) Aldolipid oxidase encoding gene bad Nucleic acid sequence information 12. Sequence characteristics Length: 1257 bp Source: Streptomyces azureense ( Streptomyces coelicolor A3) Aldolipid oxidase encoding gene eAldO Nucleic acid sequence information 13. Sequence characteristics Length: 2106 bp Source: Staphylococcus oxidans ( Gluconobacter oxidans ) catalase encoding gene GoCAT Nucleic acid sequence information 14. Sequence characteristics Length: 2061 bp Source: Bacillus subtilis ( Bacillus subtilis ) catalase encoding gene BsCAT Nucleic acid sequence information 15. Sequence characteristics Length: 2262 bp Source: Escherichia coli ( Escherichia coli ) catalase encoding gene EcCAT Nucleic acid sequence information 16. Sequence characteristics Length: 1503 bp Source: Ureaplasma thermophila ( Ureabacillus thermosphaericus ) catalase encoding gene UtCAT Nucleic acid sequence information The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A system for producing L-threonic acid using D-erythritol as a substrate, characterized in that, The system comprises at least the following three modules: A regioselective oxidation module is configured to oxidize the secondary alcohol hydroxyl group of D-erythritol to a carbonyl group, generating L-erythritol; A stereoselective reduction module is configured to reduce the carbonyl group of L-erythritol to L-threitol under the catalysis of a reductase. A continuous oxidation module is configured such that the primary hydroxyl group of L-threitol is oxidized to an aldehyde group by an oxidase to generate L-threose; the aldehyde group of L-threose is further oxidized by an oxidase to generate L-threonic acid.

2. The system as described in claim 1, characterized in that, The regionally selective oxidation module is implemented using engineered *Glucobacterium oxynitrate* bacteria; furthermore, the engineered *Glucobacterium oxynitrate* bacteria is wild-type. G. oxydans The starting strain was 621H, which inhibited the expression of the polyol dehydrogenase GOX1068 gene and / or the membrane-bound alcohol dehydrogenase GOX0854 gene.

3. The system as described in claim 1, characterized in that, The stereoselective reduction module and continuous oxidation module are used to produce L-threonic acid from L-erythritol as a substrate through in vitro enzyme catalysis or whole-cell catalytic synthesis.

4. The system as described in claim 3, characterized in that, The specific method of the in vitro enzyme catalysis process includes: catalyzing the production of L-threonic acid from L-erythritol using an in vitro enzyme catalysis system comprising L-threitol dehydrogenase, formate dehydrogenase, alditol oxidase and catalase; Furthermore, the in vitro enzyme catalytic system also includes sodium formate and NADH.

5. The system as described in claim 3, characterized in that, The whole-cell catalytic synthesis process includes at least one engineered Escherichia coli strain, which enables the production of L-threonic acid using L-erythritol as a substrate. The engineered Escherichia coli strain is obtained by metabolic engineering of wild-type Escherichia coli, wherein the metabolic engineering includes any one or two of the following: (b1) Blocking the endogenous L-threonine metabolic pathway in wild-type Escherichia coli; (b2) A pathway for the synthesis of L-threonic acid from non-natural L-erythritolose.

6. The system as described in claim 5, characterized in that, In (b1), blocking the endogenous L-threonine metabolic pathway in *E. coli* specifically includes inhibiting further degradation and metabolism of L-threonine; further, it includes inhibiting the expression of one or more coding genes involved in L-threonine degradation in the originating bacteria, including L-threonine metabolism-related genes. ygbJ , ygbM , glxR , ygbL and ygbJ isozyme gene ldhA , dld , lldD ; In (b2), a non-natural pathway for the synthesis of L-threonic acid from L-erythritol is introduced; specifically, the gene encoding one or more enzymes that convert L-erythritol into L-threonic acid is overexpressed in the starting bacteria or the substrate bacteria obtained after treatment (b1), the enzymes including L-threitol dehydrogenase, formate dehydrogenase, aldose oxidase and catalase.

7. The system as described in claim 6, characterized in that, The L-threitol dehydrogenase specifically comes from... Nostoc sp. L-threitol dehydrogenase NsTDH (its nucleotide sequence is shown in SEQ ID NO.1) is derived from Rhizonema L-threitol dehydrogenase RsTDH (its nucleotide sequence is shown in SEQ ID NO.2) of sp. is derived from Leptolyngbyaceae cyanobacterium L-threitol dehydrogenase LcTDH (its nucleotide sequence is shown in SEQ ID NO.3); Alternatively, the formate dehydrogenase is derived from... Ogataea parapolymorpha The formate dehydrogenase OpFDH of DL-1 (its nucleotide sequence is shown in SEQ ID NO.4) is derived from... Candida boidinii Formate dehydrogenase CbFDH (its nucleotide sequence is shown in SEQ ID NO. 5), and derived from Pseudomonas Formate dehydrogenase PsFDH of sp. 101 (its nucleotide sequence is shown in SEQ ID NO. 6); Alternatively, the alditol oxidase is derived from... Thermopolyspora flexuosa The alditol oxidase TfAldO (its nucleotide sequence is shown in SEQ ID NO.7) is derived from... Ardenticatenaceae bacterium The alditol oxidase AbAldO (its nucleotide sequence is shown in SEQ ID NO. 8) is derived from... Streptomyces coelicolor The alditol oxidase ScAldO of A3 (its nucleotide sequence is shown in SEQ ID NO. 9) and three mutants of ScAldO: AldO-M4 (its nucleotide sequence is shown in SEQ ID NO. 10), mAldO (its nucleotide sequence is shown in SEQ ID NO. 11), and eAldO (its nucleotide sequence is shown in SEQ ID NO. 12). Alternatively, the catalase is derived from... Gluconobacter oxydans The catalase GoCAT (whose nucleotide sequence is shown in SEQ ID NO.13) is derived from... Bacillus subtilis The catalase BsCAT (whose nucleotide sequence is shown in SEQ ID NO.14) is derived from... E. coli The catalase EcCAT (whose nucleotide sequence is shown in SEQ ID NO.15) is derived from... Ureibacillus thermosphaericus The catalase UtCAT (its nucleotide sequence is shown in SEQ ID NO.16); Furthermore, the wild-type Escherichia coli is Escherichia coli Nissle 1917 (DE3).

8. The application of the system according to any one of claims 1-7 in the industrial production of L-threonic acid.

9. A method for the industrial production of L-threonic acid, characterized in that, The method includes producing L-threonic acid using D-erythritol as a substrate, based on the system of any one of claims 1-7.

10. The application of the system according to any one of claims 1-7 and the industrial production method according to claim 9 in the fields of agriculture, food, chemical and pharmaceutical industries.

Images