A uranium ion detection probe based on bioluminescence resonance energy transfer and application

Abstract

The application belongs to the technical field of biological detection, and specifically discloses a uranium ion detection probe based on bioluminescence resonance energy transfer and application.The detection probe is composed of a 39E deoxyribozyme chain coupled with a Nanoluc luciferase fusion protein and an RNA substrate chain modified by a Cy3 fluorophore; the substrate chain contains a specific cleavage site and can be hybridized with the two side binding arms of the deoxyribozyme chain, so that the Cy3 acceptor and the luciferase donor are close to each other and high-efficiency BRET occurs.The deoxyribozyme can specifically recognize the uranium ion and catalyze the cleavage of the substrate chain, so that the Cy3 is separated from the donor region, the BRET signal is significantly reduced, and high-sensitivity and high-specificity quantitative detection of the uranium ion can be realized.The probe does not need an external excitation light source, can effectively eliminate background fluorescence interference, is simple to operate, and can provide a reliable technical means for on-site rapid screening and quantitative analysis of uranium pollution in detection substrates such as environmental water samples.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, and in particular to a uranyl ion detection probe based on bioluminescence resonance energy transfer and its application. Background Technology

[0002] Uranium is a heavy metal widely found in the Earth's crust, and uranyl ions (UO2) 2+ Uranium ions (URIs) are the most stable and common form of uranium in the aquatic environment. They possess chemical toxicity primarily characterized by nephrotoxicity and can enter the human body through the food chain, causing serious health damage. Therefore, rapid and highly sensitive on-site detection of uranium ions in environmental water bodies is crucial.

[0003] Traditional detection methods such as inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS), while highly sensitive, rely on expensive large-scale equipment, specialized operators, and complex sample pretreatment processes, limiting their application in rapid on-site screening in resource-constrained environments. Fluorescence sensing methods have attracted attention due to their ease of operation and rapid response. Among them, deoxyribonuclease-based fluorescent probes utilize the cleavage activity of uranyl ion-specific deoxyribonucleases on RNA substrates, achieving selective response to uranyl ions. However, existing fluorescent nucleic acid probes mostly use external light sources to excite fluorophores, inevitably generating background fluorescence and scattered light interference, reducing the signal-to-noise ratio and sensitivity.

[0004] Therefore, there is an urgent need to develop new uranyl ion detection technologies to achieve rapid on-site quantitative analysis of uranyl pollutants in environmental water bodies with high signal-to-noise ratio and high sensitivity. Summary of the Invention

[0005] This invention aims to address the shortcomings of existing uranyl ion detection technologies, such as strong background interference, reliance on external excitation light sources, and inconvenience in on-site detection. It provides a uranyl ion detection probe based on the bioluminescent resonance energy transfer (BRET) principle, enabling real-time, highly sensitive, and highly specific quantitative detection of uranyl ions.

[0006] The probe of this invention is based on the BRET principle, utilizing the energy of luciferase catalyzing substrate luminescence as a donor. It requires no external excitation light source, fundamentally avoiding autofluorescence and excitation light scattering, and significantly improving the detection signal-to-noise ratio. Specifically, this invention utilizes a novel, engineered luciferase, Nanoluc, which possesses outstanding advantages such as small molecular weight, high luminescence intensity, and a narrow emission spectrum. Its donor emission peak is located at approximately 460 nm, which has sufficient spectral overlap with the absorption peak of Cy3 dye (~550 nm), enabling effective BRET. This invention cleverly couples the Nanoluc-Cy3 BRET pair with a uranyl ion-specific deoxyribonuclease to construct a homogeneous detection probe with a high signal-to-noise ratio and no excitation light source, providing an innovative technical means for the rapid on-site quantitative analysis of uranyl pollutants in environmental water bodies.

[0007] This invention also provides a method for preparing a uranyl ion detection probe.

[0008] The present invention also provides a method and kit for detecting uranyl ions.

[0009] In a first aspect, the present invention provides a BRET-based uranyl ion detection probe comprising: a conjugate formed by Nanoluc luciferase and 39E deoxyribonuclease, and an RNA substrate chain modified with a Cy3 fluorescent group.

[0010] The 39E deoxyribonuclease is a DNA enzyme with uranyl ion-dependent RNA cleavage activity; the RNA substrate chain contains at least one ribonucleotide cleavage site and hybridizes complementaryly with the substrate recognition arm region of the 39E deoxyribonuclease, so that the Cy3 fluorescent group and Nanoluc luciferase are adjacent to each other to generate a BRET signal.

[0011] The probe of this invention is used for the detection of uranyl ions. When uranyl ions are present in the system, the 39E deoxyribonuclease specifically recognizes uranyl ions and catalyzes the cleavage of the RNA substrate chain at the ribonucleotide site, causing the Cy3 fluorescent group to move away from Nanoluc, resulting in a decrease in the ratio of Cy3 acceptor emission intensity to Nanoluc donor emission intensity (i.e., the BRET ratio). Based on the degree of decrease in the BRET ratio signal, the quantitative detection of uranyl ions can be achieved.

[0012] According to some embodiments of the present invention, the Nanoluc luciferase and 39E deoxyribonuclease form a conjugate through covalent or affinity linkage.

[0013] According to some embodiments of the present invention, the linkage is selected from at least one of HaloTag-chloroalkanes and biotin-streptavidin.

[0014] According to some preferred embodiments of the present invention, the Nanoluc luciferase and 39E deoxyribozyme are directionally linked via a HaloTag fusion protein to a chlorohexane-modified deoxyribozyme; this linkage method ensures that the catalytic core region of the deoxyribozyme remains unaffected.

[0015] According to some embodiments of the present invention, the Nanoluc luciferase is provided in the form of a fusion protein, the fusion protein comprising Nanoluc luciferase and a tag domain for linking with 39E deoxyribozyme.

[0016] According to some embodiments of the present invention, the tag structure field includes HaloTag.

[0017] According to some embodiments of the present invention, in the RNA substrate chain, the ribonucleotide cleavage site is adenine ribonucleotide (rA) and is located at the position corresponding to the catalytic core region of 39E deoxyribonuclease.

[0018] According to some embodiments of the present invention, the Cy3 fluorescent group is labeled at the 5' end of the RNA substrate strand.

[0019] According to some embodiments of the present invention, the 39E deoxyribozyme includes a substrate-binding arm and a catalytic core sequence complementary to the RNA substrate strand.

[0020] According to some embodiments of the present invention, the nucleic acid sequence of the 39E deoxyribozyme comprises the sequences shown in SEQ ID NO:3 and SEQ ID NO:4; the nucleic acid sequence of the RNA substrate chain is shown in SEQ ID NO:5.

[0021] According to some embodiments of the present invention, in the nucleic acid sequence of the 39E deoxyribozyme, SEQ ID NO:3 and SEQ ID NO:4 are connected by a flexible connector; the flexible connector includes a C3 spacer.

[0022] According to some embodiments of the present invention, the probe indicates the uranyl ion concentration by detecting changes in the ratio of Cy3 acceptor emission signal to Nanoluc donor emission signal.

[0023] A second aspect of the present invention provides a method for preparing a uranyl ion detection probe as described in the first aspect of the present invention, comprising the following steps:

[0024] The 39E deoxyribonuclease, cross-linked with Nanoluc luciferase fusion protein and HaloTag ligand, was added to a buffer solution and mixed. After incubation, the conjugate was prepared, purified, diluted, and then an RNA substrate chain modified with Cy3 fluorescent group was added. After incubation, the uranyl ion detection probe was obtained.

[0025] A third aspect of the present invention provides a method for detecting uranyl ions, comprising the following steps:

[0026] S1. The uranyl ion detection probe described in the first aspect of the present invention and the sample to be tested are added to a buffer solution and mixed and incubated.

[0027] S2. Add the substrate that excites Nanoluc luciferase, collect the fluorescence signal, and calculate the BRET signal ratio;

[0028] S3. Determine the presence and concentration of uranyl ions in the sample to be tested based on the degree of reduction of the BRET signal relative to the control without uranyl ions;

[0029] The BRET signal ratio is the ratio of the emission intensity of the Cy3 receptor to the emission intensity of the Nanoluc donor.

[0030] According to some embodiments of the present invention, the detection process is carried out in a homogeneous buffer solution without the need to separate free RNA substrate chains or cleavage fragments.

[0031] According to some embodiments of the present invention, the substrate for activating Nanoluc luciferase is furimazine.

[0032] According to some embodiments of the present invention, the range of the collected fluorescence signal is 400~700nm.

[0033] According to some embodiments of the present invention, the Cy3 receptor signal range is 555~575nm, and the Nanoluc donor signal range is 440~460nm.

[0034] A fourth aspect of the present invention provides a kit for the detection of uranyl ions, comprising: the uranyl ion detection probe described in the first aspect of the present invention, a buffer solution, a uranyl ion standard, and a NanoLuc luciferase luminescent substrate.

[0035] According to some embodiments of the present invention, the buffer solution contains 30-70 mM of 2-morpholinoethanesulfonic acid and 200-300 mM of NaCl.

[0036] The beneficial effects of this invention are:

[0037] 1) Based on the bioluminescence excitation-free characteristics and BRET ratio signal output characteristics, this invention significantly reduces the interference from autofluorescence and excitation light scattering from the sample matrix, resulting in a high signal-to-noise ratio;

[0038] 2) The Nanoluc and Cy3 used in this invention form a highly efficient BRET pair, which, combined with the uranyl ion-specific 39E deoxyribonuclease, can achieve detection sensitivity down to the nanomolar level.

[0039] 3) When the probe of the present invention is used for detection, it has the advantages of homogeneous detection and convenient operation. It does not require separation of free fragments or washing steps, and is especially suitable for rapid on-site quantitative analysis of matrices such as environmental water samples.

[0040] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0042] Figure 1 This is a schematic diagram illustrating the application of the probe based on the bioluminescence resonance energy transfer principle of this invention.

[0043] Figure 2 This is a plasmid map of the cpHNLuc fusion protein in Example 1 of the present invention;

[0044] Figure 3 This is an SDS-PAGE image of the purified cpHNLuc fusion protein mutant from Example 1 of this invention.

[0045] Figure 4 This is the RP-HPLC chromatogram of the DNAzyme sequence covalently coupled with the HaloTag ligand molecule in Example 2 of the present invention;

[0046] Figure 5 This is an FPLC chromatogram of the cpHNLuc fusion protein mutant coupled with DNAzyme in Example 3 of the present invention;

[0047] Figure 6 Figure 4 shows the detection results of the bioluminescent deoxyribonuclease probe in Example 4 of the present invention; wherein, Figure a is the emission spectrum of the detection probe in response to different uranyl ions, Figure b shows the linear range of the detection probe in response to different uranyl ions, and Figure c shows the selectivity of the detection probe for different ions. Detailed Implementation

[0048] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0049] The His-tagged protein purification kit used in these examples was purchased from Beyotime Biotechnology Co., Ltd., product number P2226.

[0050] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0051] In the following embodiments, the more structurally stable circularly arranged Nanoluc luciferase (cpHNLuc, i.e., circularly permuted HaloTag-NanoLuc) was used as a representative donor protein for verification. It should be understood that other Nanoluc variants or engineered luciferases with luminescent activity are also applicable to the technical solutions of the present invention.

[0052] A schematic diagram of the probe application based on the bioluminescence resonance energy transfer principle of this invention is shown below. Figure 1 As shown.

[0053] Example 1

[0054] This embodiment provides the expression and purification of the Nanoluc luciferase (cpHNLuc) fusion protein.

[0055] The expression plasmid for the cpHNLuc fusion protein used in this embodiment is pET28a-cpHNLuc, as shown in the figure. Figure 2 As shown; specifically, this plasmid encodes a multi-domain artificial fusion protein: Halo1-Nlucb-Nlucf-Halo2, which contains Halo1, Nlucb, Nlucf, and Halo2 domains sequentially from the N-terminus to the C-terminus, and is connected via (glycine-glycine-glycine-serine). n

[0056] The above plasmids were transformed into BL21(DE3) competent cells, plated, and cultured overnight at 37°C. Single colonies were picked from the plates and cultured overnight at 37°C. Then, they were transferred to new medium diluted 1:100 and cultured until the OD value was in the range of 0.6 to 0.8. IPTG was added to a final concentration of 1 mM and incubated overnight at 21°C to induce protein expression.

[0057] The cpHNLuc fusion protein mutant was purified using a His-tagged protein purification kit: 50 mL of bacterial cells were collected, 3 mL of non-denaturing lysis buffer was added, and the cells were sonicated (9.9 s on 9.9 s off, 80% power) for 2 min. The supernatant (cell lysis buffer) was separated from the precipitate by centrifugation at 13000 rcf for 30 min at 4 °C. 1 mL of BeyoGold™ His-Tag Purification Resin packing was added to an empty affinity chromatography column, and the packing was rinsed with 3 mL of non-denaturing lysis buffer to equilibrate it. Then, 3 mL of filtered cell lysis buffer was added. The column was washed 6 times with 1 mL of non-denaturing wash buffer, followed by elution with 0.5 mL of non-denaturing elution buffer 4-5 times, collecting the protein stock solution. 20 μL of all the above flow-through was collected, and the protein purification effect was detected by 12% SDS-PAGE (e.g., ...). Figure 3 (as shown) Figure 3 In the diagram, M represents the protein marker, F represents the cell lysis supernatant, W1-3 represent washing buffers for 1-3 washes respectively, and E1-3 represent elution buffers for 1-3 elutions respectively. This indicates that the target protein was successfully expressed with a purity higher than 95%.

[0058] The eluted protein was concentrated by ultrafiltration using a 30 kDa ultrafiltration tube: each time, the protein stock solution was added to the inner tube of the ultrafiltration tube to a volume of 500 μL, followed by centrifugation at 8000 rcf for 5 min at 4 °C in a refrigerated centrifuge. This process was repeated until the sample was completely concentrated. Then, DPBS (Dubor's phosphate buffer) was added to a volume of 500 μL and centrifuged again. This washing process was repeated 5 times to obtain a pure cpHNLuc protein sample. The UV absorbance of the sample at 280 nM was measured, and the molar extinction coefficient was found to be 83800 L / (mole·cm). The product concentration could be calculated using Beer-Lambert's law.

[0059] Example 2

[0060] In this embodiment, deoxyribonuclease chain 39E was modified with chloroalkane.

[0061] The sequence of the natural 39E deoxyribonuclease chain is shown in SEQ ID NO:2, and the sequence is (5'-3'): CATCTCTTCAGTCGGGTAGTTAAACCGACCTTCAGACAAGTGAT; The sequence of the 39E deoxyribonuclease chain used in this embodiment is (5'-3'): CACGTCCATCTCTTCAGTCGGGTAGTTAAACCGA / icpc3 / CCTTCAGACATAGTG (where / icpc3 / indicates that the inserted C3Spacer (a flexible connector) is located at position A20 (the insertion site of the linker is located between position 20 A and position 21 C in the catalytic core region), which can improve the response performance of the deoxyribonuclease). The sequence before the C3 Spacer is shown in SEQ ID NO:3, and the sequence after the C3 Spacer is shown in SEQ ID NO:4. In addition, the 39E enzyme chain used in this embodiment has a longer binding arm region than the wild type, which can better match the complementary RNA substrate chain. The RNA substrate chain sequence corresponding to the 39E deoxyribonuclease chain is shown in SEQ ID NO:5, with the sequence (5'-3'): ACGATGAAACATCGTCCCACTATrAGGAAGAGATGGACGTG (rA represents the adenine ribonucleotide cleavage site). The two can partially complement each other to form a stable enzyme-substrate complex. The 5' end of the RNA substrate chain is modified with a Cy3 fluorescent group.

[0062] The HaloTag ligand molecule used in this embodiment was synthesized using existing techniques, and its structure is as follows: ;

[0063] 3 mg of DCC (N,N-dicyclohexylcarbodiimide) and 6 mg of sulfo-NHS (N-hydroxythiosuccinimide) were dissolved in 200 μL of DMF, and 2.5 μL of 6-chlorohexanoic acid was added. The mixture was activated by shaking at 200 rpm for 3 h at room temperature. 39E deoxyribonuclease (synthesized by Shanghai Sangon Biotech Co., Ltd.) modified with an amino group at its 3' end was dissolved in 200 μL of borate buffer (50 mM Sodium Borate, pH=8.5). The two solutions were mixed thoroughly and reacted overnight at 180 rpm in a shaker at 37 °C. 1000 μL of ice-cold ethanol and 40 μL of 3M NaCl were added to the reaction mixture, and the mixture was frozen at -20 °C for 3 h to precipitate the DNA under a low-temperature, high-salt environment. The reaction mixture was then centrifuged at 10000 rcf for 30 min at 4 °C in a refrigerated centrifuge, the supernatant was removed, and 200 μL of 0.1 M NaCl was added. TEAA (triethylammonium acetate) was used to dissolve and precipitate the DNAzyme and HaloTag ligand cross-linked products.

[0064] The product was characterized and purified by RP-HPLC, and the chromatogram is shown below. Figure 4 As shown, the HaloTag ligand reduces the polarity of the DNAzyme to a certain extent, making its retention time longer than that of the unmodified DNAzyme, proving that it is successfully cross-linked with the HaloTag ligand. The UV absorption of the purified product at 260 nM was measured, and the molar extinction coefficient of the sequence was found to be 514950 L / (mole·cm). The concentration can be calculated according to Beer-Lambert's law.

[0065] Example 3

[0066] This embodiment provides the preparation of a bioluminescent deoxyribonuclease probe.

[0067] The DNAzyme cross-linking product obtained in Example 2 and the luciferase protein purified in Example 1 were mixed in a 1:2 molar ratio in reaction buffer (50 mM HEPES, 100 mM NaCl, pH 7.4) and incubated at room temperature for 2 h to obtain the cpHNLuc-DNAzyme conjugate. The obtained product was characterized and purified using a Cytiva ÄKTA start™ chromatography system with a HiTrap Q HP anion exchange column. The chromatogram is shown below. Figure 5 As shown.

[0068] The cpHNLuc coupled with DNAzyme showed a significant increase in electronegativity and a significantly longer retention time compared to the unreacted cpHNLuc, which proves that DNAzyme and HaloTag ligand were successfully cross-linked.

[0069] The prepared CpHNLuc-DNAzyme conjugate was diluted to 50 nM with reaction buffer (50 mM MES, 250 mM NaCl, pH 6.0), and a Cy3-modified RNA substrate strand (sequence shown in SEQ ID NO: 5) was added to a final concentration of 100 nM. The mixture was incubated at room temperature for 1 h to obtain a bioluminescent deoxyribonuclease probe.

[0070] Example 4

[0071] This embodiment provides performance verification of the bioluminescent deoxyribonuclease probe.

[0072] Different concentrations of uranyl ion standard solutions (0-500 nM) were added to the working solution of the bioluminescent DNAzyme probe, and the reaction was carried out at room temperature for 10 min. Alternatively, a quenching reaction could be added: EDTA was added to a final concentration of 2 mM to fully react with the uranyl ions to form a complex, preventing 39E from further catalyzing the cleavage of the RNA substrate. 1 μL of 1 μg / mL furimazine luminescent substrate was added to the reaction solution, and the bioluminescence emission spectrum was then measured using a fluorescence spectrometer. The excitation source was turned off, the excitation slit width was 0 nm, the emission slit width was 10 nm, and the emission signal scanning range was from 400 mM to 700 nm.

[0073] The results are as follows Figure 6 As shown in Figure a, with increasing uranyl ion concentration, the luminescence intensity at 450 nM increases, while the luminescence intensity at 565 nM decreases, exhibiting a certain linear relationship. The calculated detection limit is 1.91 nM (e.g., ...). Figure 6 As shown in Figure b), it achieves ultra-high sensitivity at the nanomolar level.

[0074] In the selective experiment, Cu 2+ Cd 2+ Ca 2+ Co 2+ Fe 3+ Zn 2+ Pb 2+ As a control, the responses of the bioluminescent deoxyribonuclease probes to these ions at 1 μM were investigated. The results are as follows: Figure 6 As shown in Figure c, only uranyl ions can cause a significant change in the luminescence signal, proving that this probe has good selectivity for uranyl ions.

[0075] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A uranyl ion detection probe based on bioluminescent resonance energy transfer, characterized in that, It contains: a conjugate formed by Nanoluc luciferase and 39E deoxyribonuclease, and an RNA substrate chain modified with the Cy3 fluorescent group; The 39E deoxyribonuclease is a DNA enzyme with uranyl ion-dependent RNA cleavage activity; the RNA substrate chain contains at least one ribonucleotide cleavage site and hybridizes complementaryly with the substrate recognition arm region of the 39E deoxyribonuclease, so that the Cy3 fluorescent group and Nanoluc luciferase are adjacent to each other and generate a bioluminescent resonance energy transfer (BRET) signal.

2. The uranyl ion detection probe according to claim 1, characterized in that, The Nanoluc luciferase and 39E deoxyribonuclease form a conjugate through covalent or affinity linkage.

3. The uranyl ion detection probe according to claim 2, characterized in that, The linker is selected from at least one of HaloTag-chloroalkanes and biotin-streptavidin.

4. The uranyl ion detection probe according to any one of claims 1 to 3, characterized in that, The nucleic acid sequence of the 39E deoxyribozyme includes the sequences shown in SEQ ID NO:3 and SEQ ID NO:4; the nucleic acid sequence of the RNA substrate chain is shown in SEQ ID NO:

5.

5. The method for preparing the uranyl ion detection probe according to any one of claims 1 to 4, characterized in that, Includes the following steps: The 39E deoxyribonuclease, cross-linked with Nanoluc luciferase fusion protein and HaloTag ligand, was added to a buffer solution and mixed. After incubation, the conjugate was prepared, purified, diluted, and then an RNA substrate chain modified with Cy3 fluorescent group was added. After incubation, the uranyl ion detection probe was obtained.

6. A method for detecting uranyl ions, characterized in that, Includes the following steps: S1. The uranyl ion detection probe according to any one of claims 1 to 4 and the sample to be tested are added to a buffer solution and mixed and incubated. S2. Add the substrate that excites Nanoluc luciferase, collect the fluorescence signal, and calculate the BRET signal ratio; S3. Determine the presence and concentration of uranyl ions in the sample to be tested based on the degree of reduction of the BRET signal relative to the control without uranyl ions; The BRET signal ratio is the ratio of the emission intensity of the Cy3 receptor to the emission intensity of the Nanoluc donor.

7. The method for detecting uranyl ions according to claim 6, characterized in that, The detection process is performed in a homogeneous buffer solution, without the need to separate free RNA substrate chains or cleavage fragments.

8. The method for detecting uranyl ions according to claim 6, characterized in that, The substrate for activating Nanoluc luciferase is furimazine.

9. A kit for the detection of uranyl ions, characterized in that, It comprises: the uranyl ion detection probe, buffer solution, uranyl ion standard, and NanoLuc luciferase luminescent substrate as described in any one of claims 1 to 4.

10. The kit for uranyl ion detection according to claim 9, characterized in that, The buffer solution contains 30-70 mM of 2-morpholinoethanesulfonic acid and 200-300 mM of NaCl.

Images