Cretohold-mediated chain displacement-based cret aptamer sensor for triggering cDNA cycle and application thereof
Patent Information
- Application Number
- CN202610878664.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-17
- Publication Date
- 2026-09-15
Smart Images

Figure CN122750818A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosensor technology, specifically to a CRET aptamer sensor based on Toehold-mediated strand displacement triggering cDNA cycling and its applications. Background Technology
[0002] Kanamycin (KAN) is an aminoglycoside antibiotic produced by the fermentation of *Streptomyces kanamycin*, and it has significant therapeutic effects on infections caused by Gram-positive or Gram-negative bacteria. However, excessive KAN residues in animal-derived foods may cause various adverse effects on human health, including intestinal flora imbalance, nephrotoxicity, ototoxicity, and allergic reactions. Given its potential risks, the European Union and China have set maximum residue limits for KAN in milk at 150 μg / kg and 200 μg / kg, respectively.
[0003] Currently, various methods have been developed for detecting KAN, such as rapid test strips (colloidal gold / aptamer chromatography), immunoassay, fluorescence / luminescence methods, HPLC-MS / MS, and electrochemical sensors. Each method has its advantages and disadvantages: rapid test strips, immunoassay, and fluorescence methods typically require chemical labeling with thiol groups, antibodies, fluorescent dyes, quantum dots, or electrochemiluminescence substrates, resulting in complex material synthesis and purification steps and high costs. HPLC-MS / MS methods generally suffer from limitations such as complex sample pretreatment, long detection times, expensive equipment, and high operator skill requirements, and are difficult to meet the needs of on-site, real-time detection.
[0004] Based on the specific biorecognition of aptamers and KAN, electrochemical, colorimetric, and fluorescent aptamer sensors have been developed in recent years. Most reported methods rely on nanomaterials, enzyme tools, or fluorescently labeled probes. However, the synthesis and modification of nanomaterials are complex, and their stability is not ideal. For example, AuNPs exhibit non-specific adsorption to signal molecules, affecting detection accuracy. Enzymes are expensive to synthesize, require harsh reaction conditions, and are susceptible to environmental factors that reduce their activity, further impacting amplification capacity. Labeled probes are complex and expensive to synthesize and modify, and large fluorophores may hinder nucleic acid hybridization. While electrochemical sensors have made significant progress in sensitivity, most rely on complex nanomaterial systems. While achieving lower detection limits, this also increases reagent costs, system complexity, and operational requirements, and they are easily affected by food matrices. Therefore, developing a novel enzyme-free, label-free, low-cost, and highly sensitive aptamer sensing method is of great significance for achieving rapid on-site screening and accurate quantification of KAN residues.
[0005] G4 (G-quadruplex) is an atypical nucleic acid secondary structure formed by the folding of guanine (G)-rich DNA or RNA sequences. Its basic structural unit is the G-quartet: four guanine atoms linked by Hoogsteen hydrogen bonds to form a ring-like planar structure. Multiple G-quartets stack π-π to form a stable four-stranded helical structure. Its stability stems from the π-π stacking of planar guanine tetradules through Hoogsteen hydrogen bond interactions. G4 can bind to heme to form G4 / heme DNAase, which exhibits peroxidase-like activity. This enzyme can catalyze chromogenic substrates such as TMB, o-phenylenediamine, and ABTS, as well as luminescent substrates such as luminol, and is therefore widely used in aptamer sensor development. However, the catalytic activity of G4 / heme DNase is highly dependent on factors such as ion concentration, buffer system, pH, and temperature, making it difficult to guarantee stability in complex sample matrices. The non-covalent binding between G4 and heme results in insufficient affinity, often requiring excess heme to maintain coordination. Furthermore, G4 exhibits various topological structures, each with different coordination abilities towards heme, leading to unstable catalytic activity. In addition, G4 has poor binding selectivity, lacks specific recognition of porphyrin molecules, and is easily interfered with by non-specific planar molecules. These factors collectively limit the stability and reliability of G4 / heme DNase in biosensing.
[0006] In 2024, Liu et al. reported the first non-G4 aptamer (Hem1-2T) capable of selectively binding hemin (GU L, DING Y, ZHOU Y, et al. Selective Hemin Binding by a Non-G-quadruplex Aptamer with Higher Affinity and Better Peroxidase-like Activity [J]. Angewandte Chemie International Edition, 2024, 63(6): e202314450). Hem1-2T does not interact with other porphyrins. The difference between non-G4 aptamers and G4 aptamers is that G4 aptamers are rich in guanine G and spontaneously fold to form a G-quadruplex spatial structure, binding to targets via the G4 backbone; non-G4 aptamers lack the G-quadruplex structure and rely on conventional nucleic acid secondary structures such as stem-loops, hairpins, double strands, and bent loops for binding. This non-G4 structure not only effectively avoids interaction with G4 ligands, but also exhibits a higher affinity for heme compared to the classic G4 aptamer PS2.M. Its dissociation constant (Kd=43 nM) is approximately five times that of PS2.M, indicating a significant advantage in heme recognition. Studies have shown that Hem1-2T-based biosensors can achieve more efficient signal amplification, thereby effectively improving detection sensitivity. However, research on aptamer sensors based on non-G4 / heme DNAase for signal transduction is still relatively limited, and related explorations are in their early stages, warranting further in-depth exploration of their application value in highly sensitive bioanalysis.
[0007] Chemiluminescent resonance energy transfer (CRET) refers to the nonradiative resonance energy transfer that occurs from a chemiluminescent donor to an acceptor molecule when they are sufficiently close. It is a highly efficient method for detecting minute changes in distance between the chemiluminescent donor and acceptor. Typically, a chemiluminescent substrate generates a high-energy intermediate upon stimulation by a chemiluminescent reaction. When this intermediate releases energy in the form of photons, it triggers luminescence. In this case, if the distance between the acceptor with a suitable absorption wavelength and the chemiluminescent substrate is less than 10 nm, the substrate's emission light will either excite the acceptor or be quenched by it. Compared to fluorescence resonance energy transfer (FRET), CRET does not require an excitation source, effectively reducing photobleaching, avoiding non-specific signals common in fluorescence-related methods, and exhibiting higher sensitivity.
[0008] Toehold-mediated strand displacement (TMSD) is a core reaction mechanism in DNA nanotechnology and dynamic molecular systems, widely used in biosensing, molecular computing, drug delivery, and nanodevice regulation. Its simplicity and precise response have led to its widespread application in the construction of biosensors. A toehold is a specific single-stranded nucleic acid fragment that can specifically recognize and bind to a target nucleic acid sequence, subsequently triggering cascade hybridization and exponentially amplifying the product. This provides an efficient pathway for regulating DNA hybridization and amplifying target binding signals. The TMSD reaction relies on a single-stranded fragment (the "toehold") protruding from the end or interior of one strand of a DNA double helix as a "starting site." The reaction process consists of three key stages: 1. Initial binding: The invading strand binds to the toehold region in the target double helix through base pairing. 2. Branching and migration: The energy released after binding drives the gradual dissociation of the double helix, with the invading strand replacing the original complementary strand base by base. 3. Product formation: Ultimately, a more stable double-stranded structure is formed, releasing the replaced strand. This process requires no enzyme catalysis, can be carried out under isothermal conditions, and is highly programmable.
[0009] Currently, most signal amplification aptamer sensors rely on nucleic acid cascade amplification strategies such as catalytic hairpin assembly (CHA) and hybridization chain reaction (HCR). Although they can enhance the signal, they generally suffer from drawbacks such as complex probe design, long optimization cycle, and easy generation of non-specific background signals, which affect the accuracy and reproducibility of detection. Summary of the Invention
[0010] The purpose of this invention is to address the above-mentioned problems by providing a Toehold-mediated strand displacement-triggered cDNA cycling CRET aptamer sensor and its application.
[0011] To achieve its objective, the present invention employs the following technical solution:
[0012] The first aspect of the present invention provides a CRET aptamer sensor for kanamycin (KAN) detection based on Toehold-mediated strand displacement-triggered cDNA cycling, comprising an aptamer, cDNA, AuNPs-H1, splitting aptamers HA and HB, heme, luminol, and H2O2; wherein the AuNPs-H1 is obtained by loading a hairpin probe H1 onto the surface of gold nanoparticles AuNPs; the base sequence of the aptamer is shown in SEQ ID NO.1, the base sequence of the cDNA is shown in SEQ ID NO.3, the base sequence of the hairpin probe H1 is shown in SEQ ID NO.37, the base sequence of the splitting aptamer HA is shown in SEQ ID NO.50, and the base sequence of the splitting aptamer HB is shown in SEQ ID NO.62.
[0013] The CRET aptamer sensor of the present invention has an aptamer that can specifically recognize the target KAN, and the cDNA is the complementary strand of the aptamer; the non-thiolized hairpin probe H1 is coupled to the surface of AuNPs through the terminal adenine, and the aptamer and cDNA complement each other to form a double strand.
[0014] When KAN is absent, the cleavage aptamers HA and HB in the system form Non-G4 / heme DNase with heme, which catalyzes luminol to produce a chemiluminescent signal. Since the Non-G4 / heme DNase is not enriched on the surface of AuNPs at this time and is far away from AuNPs, the CRET process will not occur, so the chemiluminescent signal is high.
[0015] When KAN is present, it competitively binds to the aptamer, releasing cDNA complementary to the aptamer. The cDNA opens the hairpin probe H1 on AuNPs-H1 and hybridizes with it to form dsDNA. The toehold site at the other end of the hairpin probe H1 is exposed, and then hybridizes with the binding regions at the ends of HA and HB, resulting in a strand displacement reaction. The released cDNA then binds again to the unopened H1 on the surface of AuNPs, realizing cDNA cycling. H1 forms a complex with HA, HB, and heme. At this time, due to the shortened distance between AuNPs and Non-G4 / heme DNAase, a CRET reaction occurs, resulting in a decrease in the chemiluminescent signal, thus enabling sensitive detection of KAN.
[0016] The preparation method of AuNPs-H1 includes the following steps: mixing AuNPs with hairpin probe H1 solution, evaporating the resulting mixed solution in a 90°C constant temperature metal bath, reconstituted with pure water, centrifuged, washed to remove excess DNA, and resuspended in ultrapure water to prepare AuNPs-H1.
[0017] A second aspect of the present invention is to provide the application of the above-described CRET aptamer sensor in the detection of kanamycin.
[0018] A third aspect of the present invention is to provide a method for detecting kanamycin using the above-mentioned CRET aptamer sensor, comprising the following steps:
[0019] S1. Incubate the aptamer with cDNA to bind it;
[0020] S2. After step S1, kanamycin standard solution is added and incubated. KAN competitively binds to the aptamer and releases cDNA complementary to the aptamer. AuNPs-H1, HA and HB are added and reacted. Then heme is added and incubated. Subsequently, luminol and H2O2 are added to obtain the chemiluminescence sensor system. The chemiluminescence intensity of the system is detected and a standard curve is plotted.
[0021] S3. Prepare the sample solution to be tested. Replace the kanamycin standard solution with the sample solution to be tested. Repeat steps S1 and S2 to prepare the chemiluminescence sensor system and measure its chemiluminescence intensity. Based on the standard curve and the chemiluminescence intensity results of the sample solution to be tested, perform quantitative analysis of the kanamycin contained in the sample solution to be tested.
[0022] Specifically,
[0023] S1. Incubate the aptamer and cDNA at 15-25 ℃ for 10-20 min;
[0024] S2. After step S1, add kanamycin standard solution and incubate at 15-25℃ for 10-20 min; add AuNPs-H1, HA and HB, and react for 30-50 min; then add heme and incubate for 5-10 min.
[0025] Preferably, the concentrations of each substance in the chemiluminescence sensor system described in step S2 are as follows:
[0026] The substrate concentration of H2O2 is 20~40 mM;
[0027] The substrate concentration of luminol is 0.05~0.07 mM;
[0028] The heme concentration is 0.3~0.5 μM;
[0029] The chemiluminescence sensor system was prepared using Tris-HCl buffer, wherein Mg... 2+ The concentration is 20~30 mM;
[0030] The concentration of HA or HB is 50~80 nM.
[0031] Preferably, the volume ratio of 10 nM AuNPs-H1 to 1 μM HA and 1 μM HB is (1~5): (1~3): (1~3), and more preferably 4:3:3.
[0032] In some implementations, the sample to be tested in step S3 is an emulsion or meat product;
[0033] The preparation method of the emulsion test sample solution is as follows: take 2 mL of emulsion and dilute it twice with Tris-HCl buffer, then add 1 mL of 15% trichloroacetic acid to precipitate the milk protein, mix well and sonicate for 20 min, centrifuge the mixture at 10,000 r / min for 10 min, and collect the supernatant; adjust the pH of the supernatant to 7.8, filter through a filter membrane to remove residual protein, and collect the filtrate to obtain the emulsion test sample solution;
[0034] The method for preparing the meat product test sample solution is as follows: the meat product is homogenized using a homogenizer, 1 g of homogenized tissue is mixed with 2 mL of methanol and 4 mL of Tris-HCl buffer, the mixture is sonicated for 20 min, centrifuged at 10,000 r / min for 10 min, the supernatant is collected, filtered through a filter membrane, and the filtrate is collected to obtain the meat product test sample solution.
[0035] In the above-mentioned method for detecting kanamycin using a CRET aptamer sensor, the detection range of kanamycin is 5-100 nM, the detection limit is 3.60 nM, and the chemiluminescence intensity is measured at 425 nm using a chemiluminescence analyzer.
[0036] The beneficial effects of this invention are:
[0037] Compared with the prior art, the present invention has the following advantages:
[0038] (1) Existing rapid test strips, immunoassays, and fluorescence methods usually require chemical labeling such as thiol labeling, antibody labeling, fluorescent dyes, quantum dots, or electrochemiluminescent substrates. The material synthesis and purification steps are cumbersome and costly. However, the method of this invention directly adsorbs adenine bases onto AuNPs, eliminating the need for expensive and unstable thiol modification. Signal output is achieved through the CRET effect, significantly reducing the cost of probe synthesis.
[0039] (2) Existing HPLC-MS / MS methods generally suffer from limitations such as complex sample pretreatment, long detection time, expensive instruments and equipment, and high professional requirements for operators, and are difficult to meet the needs of on-site real-time detection. The method of this invention only requires a chemiluminescence analyzer or even a portable photoelectric sensor, combined with a self-luminescent luminol system, to meet the needs of rapid on-site detection, without the need for complex instruments, and is suitable for scenarios with limited resources.
[0040] (3) Currently, although electrochemical sensors have made significant progress in sensitivity, most rely on complex nanomaterial systems. While achieving lower detection limits, this also increases reagent costs, system complexity, and operational requirements, and they are easily affected by food matrices. The method of this invention avoids the use of expensive nanomaterials and complex labeling steps, effectively reducing reagent costs while ensuring detection performance. Furthermore, experimental results show that this sensor exhibits good accuracy and reliability in actual food samples and has good tolerance to real sample matrices.
[0041] (4) The method of the present invention has low background interference and high signal-to-noise ratio. It utilizes the distance-dependent CRET between "Non-G4 / heme DNAase" and AuNPs: the signal is "on" (strong light emission) when there is no target; the signal is "off" (CRET quenching) when there is a target. This switching mode has stronger anti-background interference capability than a simple "signal enhancement" type sensor.
[0042] In summary, this invention constructs a novel enzyme-free, label-free, low-cost, and highly sensitive aptamer sensing method, which is of great significance for achieving rapid on-site screening and accurate quantification of KAN residues.
[0043] To further enhance detection performance and simplify system construction, this invention introduces a signal amplification strategy driven by a Toehold-mediated chain substitution reaction. Compared to commonly used signal amplification methods in aptamer sensors (such as catalytic hairpin assembly and hybridization chain reactions), the Toehold-mediated chain substitution reaction offers advantages such as a simpler reaction path, faster signal response, and higher cycle efficiency, achieving effective signal amplification while reducing system complexity. Furthermore, this invention combines the chain substitution reaction with the CRET signal output mode. Compared to traditional colorimetric methods, the CRET system exhibits lower background signal and higher sensitivity, which is beneficial for improving analytical performance.
[0044] This invention relates to a Toehold-mediated strand displacement reaction-driven cDNA cycling CRET sensor. By engineering the sequence of a Non-G4 splitting aptamer, its peroxidase activity formed with heme enables efficient chemiluminescent signal output. Combined with a competitive recognition mechanism between the aptamer and complementary strand cDNA, and a hairpin probe H1 immobilized at the AuNPs interface, a strand displacement-driven cDNA cycling amplification system is constructed, establishing a CRET aptamer sensing platform for KAN detection. This strategy significantly improves signal amplification efficiency and detection sensitivity, providing a new solution for high-performance detection of KAN residues in complex food samples. Attached Figure Description
[0045] Figure 1This is a schematic diagram illustrating the experimental principle of the sensor of this invention, which uses a Toehold-mediated strand displacement-triggered cDNA cycling strategy to detect KAN.
[0046] Figure 2 The following are characterization diagrams of AuNPs and AuNPs-H1: (A) Particle size distribution of AuNPs; (B) Zeta potential of AuNPs; (C) Physical images of AuNPs and AuNPs-H1 after heat drying; (D) Ultraviolet spectra of AuNPs and AuNPs-H1 at 518 nm; (E) Ultraviolet spectra of AuNPs and AuNPs-H1 after adding NaCl; (F) Physical images of AuNPs and AuNPs-H1 after adding NaCl.
[0047] Figure 3 The results showed that: (A) chemiluminescence reaction was used to investigate the peroxidase activity after HA and HB bind heme; (B) chemiluminescence reaction was used to determine the position of the extended double strand in HA and HB; (C) chemiluminescence reaction was used to optimize the length of the extended double strand; and (D) the catalytic activity of HA and HB binding heme to form peroxidase was verified by adding extended double strand and binding region sequence.
[0048] Figure 4 The results show: (A) the fluorescence spectrum of cDNA released by aptamer binding to KAN under TO dye; and (B) the results of the experiment on optimizing the number of complementary bases between aptamer and cDNA.
[0049] Figure 5 The results of the optimization experiments are shown: (A) optimization of the Toehold length of H1; (B) optimization of the length of the hairpin H1 locking region; (C) optimization of the length of the complementary bases of cDNA and H1; (D) optimization of the length of the complementary bases of H1 and HA / HB.
[0050] Figure 6 The effects of different ratios of AuNPs-H1 to HA / HB on the chemiluminescence signal (A) and on the relative chemiluminescence intensity (B) are shown.
[0051] Figure 7 The effects of different distances between AuNPs and Non-G4 / heme DNAase on the chemiluminescence signal (A) and the relative chemiluminescence intensity (B) are shown.
[0052] Figure 8The following were shown: (A) Validation of the strand displacement reaction by Native-PAGE; the specific sample types added were: Lane 1: 5 μM cDNA; Lane 2: 5 μM H1; Lane 3: 5 μM cDNA + 5 μM H1; Lane 4: 5 μM HA; Lane 5: 5 μM HB; Lane 6: 5 μM HA and 5 μM HB; Lane 7: 5 μM cDNA + 5 μM H1 + 5 μM H-A + 5 μM HB; Lane 8: 5 μM H1 + 5 μM H-A + 5 μM HB; (B) Validation of the complete experimental procedure by Native-PAGE (lane markings: "+" indicates presence, "−" indicates absence), the specific sample types added were: Lane 1: 5 μM aptamer; Lane 2: 5 μM cDNA; Lane 3: 5 μM aptamer + 5 μM cDNA; Lane 4: 5 μM aptamer + 5 μM cDNA + 10 μM aptamer. KAN; Lane 5: 5 μM H1; Lane 6: 5 μM aptamer + 5 μM cDNA + 10 μM KAN + 5 μM H-A + 5 μM HB; Lane 7: 5 μM aptamer + 5 μM cDNA + 5 μM H1 + 5 μM H-A + 5 μM HB; (C) Feasibility verification of strand substitution reaction; (D) Verification of the feasibility of Toehold-mediated strand substitution-driven cDNA cycling strategy for detecting KAN.
[0053] Figure 9 The results of the optimized detection conditions for the CRET sensor strategy are shown; the concentration of KAN added is 60 nM; (A) H2O2 concentration optimization; (B) Luminol concentration optimization.
[0054] Figure 10 The results of the optimized detection conditions for the CRET sensor strategy are shown; the concentration of KAN added is 60 nM; (A) optimization of Hemin concentration; (B) Mg 2+ Concentration optimization.
[0055] Figure 11 The results of the optimized detection conditions for the CRET sensor strategy are shown; the concentration of KAN added is 60 nM; (A) optimization of the reaction time for Toehold-mediated chain displacement; (B) optimization of HA and HB concentrations.
[0056] Figure 12Results (A) Chemiluminescence intensity at different KAN concentrations; (B) Establishment of standard curves for KAN by the Toehold-mediated strand displacement-triggered cDNA cycling CRET aptamer sensor; (C) Selectivity analysis of KAN by the Toehold-mediated strand displacement-triggered cDNA cycling CRET aptamer sensor; Neomycin (NEO), Streptomycin (STR), Amoxicillin (AMO), Sulfamethoxazole (SDM), Chloramphenicol (CAP), Oxytetracycline (OTC), Tetracycline (TC), and Penicillin (PEN). Detailed Implementation
[0057] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.
[0058] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0059] Example 1
[0060] 1. Information on main reagents and nucleic acids
[0061] 1.1 Reagents
[0062] Table 1 Main Reagent Information
[0063]
[0064] 1.2 Nucleic Acid Information
[0065] Table 2
[0066]
[0067]
[0068]
[0069] In Table 2, H1-a8 and H1-c18 were designed in the Toehold length optimization and chain permutation optimization experiments, respectively. They were designed according to their respective design rules, and the resulting sequences were exactly the same.
[0070] The aptamer sequence AGATGGGGGTTGAGGCTAAGCCGA is the kanamycin aptamer. The "GGTTGAGGCTAAGC" portion of the aptamer corresponds to the cDNA ( GCTTAGCCTCAACC The ATTGCAGC) underscore region complements to form dsDNA. In the presence of kanamycin, kanamycin binds to aptamer, releasing cDNA. The cDNA further binds to H1 (AAAATT) in AuNPs-H1. TGCAATGGTTGAGGCTAAThe underlined region (TGCTCTGCAGCCTCAACCAT) pairs complementaryly, thereby opening the hairpin H1 and triggering a toehold-mediated chain substitution reaction, H1 (AAAATTT) GCAATGGTTGAGGCTAATGCTCTGC AGCCTCAACCAT, where “TGCTCTGC” is the Toehold region, combined with “GCAGAGCA” of HB) and HA (TCGAATGTCCACGACTGATTCCGAGATATA) ATTGCAA ) and HB ( GCAGAGCATTAGCCTCAA The underlined region (CTGTACTGAGATTCCAAAGTCGTGGACATTCGA) binds to form a complex, which, in the presence of heme, HA (TCGAATGTCC) ACGACTGATTCCGAGATAT A CCATTGCAA) and HB (GCAGAGCATTAGCCTCAA CTGTACTGAGATTCCAAAGTCGT The underlined region of GGACATTCGA binds to heme to form Non-G4 / heme DNAase. At this time, Non-G4 / heme DNAase is close to AuNPs and the CRET effect occurs, resulting in a decrease in chemiluminescence signal.
[0071] 2 methods
[0072] 2.1 Synthesis of AuNPs
[0073] All glassware was first soaked in aqua regia (HNO3:HCl=1:3) overnight, then rinsed with ultrapure water and dried before use. AuNPs (gold nanoparticles) were prepared according to the classic sodium citrate reduction method. Under magnetic stirring, 1 mL of 1% (w / v) HAuCl4 was added to a 250 mL flask and heated to boiling. Then, 2 mL of 38.8 mM sodium citrate solution was quickly added while stirring. The mixture was stirred at boiling for 30 min, and the solution changed from light yellow to colorless and finally to wine red. The heat source was removed, and the solution was cooled to room temperature with continued magnetic stirring to obtain the AuNPs solution, which was stored at 4°C in the dark for later use.
[0074] 2.2 Synthesis of AuNPs-H1
[0075] Take 1000 μL of the AuNPs solution prepared in step 2.1 above and centrifuge at 13000 r / min for 15 min. Discard 990 μL of supernatant to concentrate the AuNPs 100-fold. Then add 20 μL of 100 μM non-thiolized H1 and mix well. Place the resulting mixture in a 90℃ constant temperature metal bath to evaporate to dryness for about 12 min. Immediately after drying, remove it and reconstitute it with pure water to a volume of 1000 μL. Then wash three times by centrifugation at 12000 rpm to remove excess DNA, and resuspend it in 1000 μL of ultrapure water for later use to prepare AuNPs-H1, which is stored at 4℃.
[0076] 2.3 Chemiluminescence verification of the catalytic activity of the Non-G4 splitting aptamer after binding to heme
[0077] Samples were prepared using Tris-HCl buffer (pH 7.8, 20 mM Tris, 100 mM NaCl, 20 mM MgCl2), with a total volume of 150 μL for each sample. Different Non-G4 mitotic aptamers (9 μL, 10 μM) were mixed thoroughly with heme (1.5 μL, 20 μM) and incubated for 10 min. Then, luminol (6 μL, 2 mM) and H2O2 (6 μL, 0.09 M) were added, and the chemiluminescence intensity was immediately measured at 425 nm using a chemiluminescence analyzer.
[0078] 2.4 Verification of cDNA release using fluorescence method
[0079] The aptamer (9 μL, 10 μM) was thoroughly mixed with cDNA (9 μL, 10 μM) and reacted at 25 °C for 15 min. KAN (3 μL, 100 μM) was then added and incubated for another 15 min. Subsequently, TO dye (2 μL, 0.1 mM) was added, and the fluorescence spectrum was immediately measured at room temperature (excitation Ex = 501 nm, emission Em = 535 nm). The total sample volume was 150 μL, and all samples were prepared using Tris-HCl buffer (pH 7.8, 20 Mm Tris, 100 mM NaCl, 20 mM MgCl2).
[0080] 2.5 Native-PAGE
[0081] To prepare the 15% separating gel, 8 mL of 30% acrylamide solution (29:1 ratio), 4.8 mL of deionized water, 3.2 mL of 5×TBE buffer (pH 8.0), 200 μL of 10% ammonium persulfate (APS), and 20 μL of TEMED were gently mixed at room temperature and immediately poured into a gel mold for polymerization for 15 min. Next, to prepare the stacking gel, 1 mL of 30% acrylamide solution, 1.2 mL of 5×TBE buffer (pH 8.0), 3.8 mL of deionized water, 80 μL of APS, and 8 μL of TEMED were mixed at room temperature and poured into a mold. A comb was inserted, and polymerization was carried out for 20 min. After the gel solidified, the sample was mixed with loading buffer at a 1:6 (volume ratio) and loaded onto the gel. Electrophoresis was performed in 1×TBE buffer at a constant voltage of 200 V for 45 min. After electrophoresis, the gel was stained with SYBR Gold at room temperature for 30 min, and then developed using an SH-520 gel imaging system.
[0082] 2.6 Feasibility Verification
[0083] Samples were prepared using Tris-HCl buffer (pH 7.8, 20 mM Tris, 100 mM NaCl, 20 mM MgCl2), with a total volume of 150 μL per sample. Aptamers (9 μL, 1 μM) and cDNA (9 μL, 1 μM) were incubated at 25 °C for 15 min, followed by incubation with different concentrations of KAN at 25 °C for 15 min. AuNPs-H1 (12 μL, 10 nM), HA (9 μL, 1 μM), and HB (9 μL, 10 nM) were then added and reacted for 30 min. Heme (1.5 μL, 20 μM) was added and incubated for 10 min. Subsequently, luminol (6 μL, 1.5 mM) and H2O2 (6 μL, 0.09 M) were mixed with the mixture, and the chemiluminescence intensity was measured at 425 nm using a chemiluminescence analyzer.
[0084] 2.7 Optimization of KAN Detection Conditions
[0085] The basic procedure is as follows: Samples were prepared using Tris-HCl buffer (pH 7.8, 20 mM Tris, 100 mM NaCl, 20 mM MgCl2), with a total volume of 150 μL for each sample. The aptamer (9 μL, 1 μM) was incubated with cDNA (9 μL, 1 μM) at 25°C for 15 min, followed by incubation with KAN (9 μL, 1 μM) at 25°C for 15 min. AuNPs-H1 (12 μL, 10 nM), HA (9 μL, 1 μM), and HB (9 μL, 10 nM) were added and reacted for 30 min (i.e., the strand displacement reaction time referred to in 2.7.6). Add heme (1.5 μL, 20 μM) and incubate for 10 min. Then, mix luminol (6 μL, 1.5 mM) and H2O2 (6 μL, 0.09 M) with the mixture and bring the volume to 150 μL with Tris-HCl buffer. Measure the chemiluminescence intensity at 425 nm using a chemiluminescence analyzer.
[0086] Optimize the following parameters according to the above steps.
[0087] 2.7.1 Mg 2+ Concentration optimization
[0088] While keeping other experimental conditions constant, different concentrations of Mg were used. 2+ Samples were prepared using Tris-HCl buffer (pH 7.8), with a total volume of 150 μL for each sample. The concentrations of each component in the Tris-HCl buffer were: 20 mM Tris, 100 mM Na + Different concentrations of Mg 2+ The concentrations were set to 10, 20, 30, 40, and 50 mM. The remaining procedures were performed according to method 2.7.
[0089] 2.7.2 Optimization of Luminol Concentration
[0090] While keeping other experimental conditions unchanged, the final concentrations of luminol in the mixture were set to 0.5, 1.0, 1.5, 2.0 and 2.5 mM respectively for investigation, and the remaining operation steps were carried out according to the method in 2.7.
[0091] 2.7.3 Optimization of Heme Concentration
[0092] While keeping other experimental conditions unchanged, the final concentration of heme in the mixture was adjusted to 0.1, 0.2, 0.3, 0.4 and 0.5 μM for investigation, and the remaining operation steps were performed according to the method in 2.7.
[0093] 2.7.4 H2O2 Concentration Optimization
[0094] While keeping other experimental conditions unchanged, the final concentration of H2O2 in the mixed solution was set to 5, 10, 30, 60 and 90 mM for investigation, and the remaining operation steps were carried out according to the method in 2.7.
[0095] 2.7.5 Optimization of HA and HB concentrations
[0096] While keeping other experimental conditions unchanged, the final concentrations of HA and HB in the mixed solution were simultaneously adjusted to 20, 40, 60, 80, and 100 nM (HA to HB volume ratio 1:1, and the concentrations of HA and HB in the mixed solution were the same), and the remaining operation steps were performed according to method 2.7.
[0097] 2.7.6 Optimization of chain displacement reaction time
[0098] While keeping other experimental conditions unchanged, the reaction time was set to 20, 40, 60, 80 and 100 min respectively for investigation, and the remaining operation steps were carried out according to the method in 2.7.
[0099] 2.8 Specificity Analysis
[0100] Two groups of experiments were conducted using the antibiotics KAN, AMO, SDM, CAP, OTC, TC, STR, PEN, and NEO:
[0101] The first group tested individual antibiotics separately: each of the above 9 antibiotics was prepared into a 1 μM solution, and 9 μL of one antibiotic was added to the reaction system each time. The signal was measured separately to verify whether each interfering substance would produce a false positive when it was present alone.
[0102] The second group tested a mixture of all antibiotics: the above 9 antibiotics (each with a concentration of 1 μM) were mixed together, and then 9 μL of the mixture was added to the reaction system for testing to verify whether the coexistence of multiple antibiotics would cause synergistic interference with the detection of KAN.
[0103] The detection method was as follows: Aptamer (9 μL, 1 μM) and cDNA (9 μL, 1 μM) were incubated at 25°C for 20 min, followed by incubation at 25°C for 15 min with the aforementioned antibiotics alone or in mixtures thereof. AuNPs-H1 (12 μL, 10 nM), HA (9 μL, 1 μM), and HB (9 μL, 1 μM) were then added and reacted for 30 min. Heme (1.5 μL, 20 μM) was added and incubated for 10 min. Subsequently, luminol (6 μL, 1.5 mM) and H2O2 (6 μL, 0.09 M) were mixed, and the chemiluminescence intensity was measured at 425 nm using a chemiluminescence analyzer. Samples were prepared using Tris-HCl buffer (pH 7.8, 20 mM Tris, 100 mM NaCl, 20 mM MgCl2), with a total sample volume of 150 μL.
[0104] 2.9 Sample Analysis
[0105] Recycling experiments were conducted on pork and milk samples that did not contain KAN.
[0106] For milk sample preparation, 2 mL of milk was diluted 2-fold with Tris-HCl buffer (pH 7.8) containing 20 mM Tris, 100 mM NaCl, and 20 mM MgCl2. Known concentrations of KAN standard solution (final concentrations of 10, 20, and 40 nM) were added to the diluted milk samples, followed by the addition of 1 mL of 15% (v / v) trichloroacetic acid to precipitate the milk proteins. After mixing, the mixture was sonicated for 20 min, centrifuged at 10,000 rpm for 10 min, and the supernatant was collected. The pH of the supernatant was adjusted to 7.8 with 1 M NaOH, and residual proteins were removed by filtration through a 0.22 µm membrane. The filtrate was collected for analysis.
[0107] For pork sample processing, pork tissue was homogenized using a homogenizer. One g of homogenized tissue was taken and KAN standard solutions of known concentrations (10, 20, and 40 nM) were added, followed by 2 mL of methanol and 4 mL of Tris-HCl buffer (pH 7.8, containing 20 mM Tris, 100 mM NaCl, and 20 mM MgCl2). The mixture was then sonicated for 15 min and centrifuged at 10,000 r / min for 10 min. The supernatant was filtered through a 0.22 µm membrane, and the filtrate was collected for analysis. Each concentration was measured five times according to the procedure in section 2.6. The recovery rate and coefficient of variation were calculated using a spiked recovery test.
[0108] 3 Results and Discussion
[0109] 3.1 Experimental Principle
[0110] The basic procedures are as follows: Samples were prepared using Tris-HCl buffer (pH 7.8, 20 mM Tris, 100 mM NaCl, 20 mM MgCl2), with a total volume of 150 μL for each sample. Aptamers (9 μL, 1 μM) and cDNA (9 μL, 1 μM) were incubated at 25°C for 15 min, followed by incubation with KAN (9 μL, 1 μM) at 25°C for 15 min. AuNPs-H1 (12 μL, 10 nM), HA (9 μL, 1 μM), and HB (9 μL, 10 nM) were added and reacted for 30 min. Heme (1.5 μL, 20 μM) was added and incubated for 10 min. Subsequently, luminol (6 μL, 1.5 mM) and H2O2 (6 μL, 0.09 M) were mixed with the mixture, and the chemiluminescence intensity was measured at 425 nm using a chemiluminescence analyzer.
[0111] The principle of the sensor of this invention is as follows: Figure 1As shown, the aptamer specifically recognizes the target KAN, and the cDNA is the complementary strand of the aptamer. Hairpin H1 was modified onto the surface of gold nanoparticles to prepare AuNPs-H1. In the absence of a target, H1 maintains a stable hairpin conformation and is fixed on the AuNPs surface. The cDNA is not released, the strand displacement reaction cannot be initiated, and the Non-G4 / heme DNase exists freely in the system, catalyzing luminol to produce a strong chemiluminescent signal, although the background signal is high. The non-thiolized hairpin H1 is coupled to the AuNPs surface via terminal adenine, and the aptamer and cDNA complementarily pair to form a double strand. In the absence of KAN, the Non-G4 splitting aptamers HA and HB in the system form Non-G4 / heme DNase with heme, catalyzing luminol to produce a chemiluminescent signal. Since the Non-G4 / heme DNase is not enriched on the AuNPs surface at this time and is far from the AuNPs, the CRET process does not occur, resulting in a high chemiluminescent signal. When KAN is present, it competitively binds to the aptamer, releasing cDNA complementary to the aptamer. The cDNA opens the hairpin H1 on AuNPs-H1 and hybridizes with it to form dsDNA. The toehold site at the other end of the hairpin H1 is exposed, and the toehold site hybridizes with the binding regions at the ends of HA and HB, undergoing a strand displacement reaction and releasing the cDNA that formed dsDNA with H1. Due to the presence of a large number of AuNPs-H1 probes in the reaction system, the released cDNA randomly diffuses and hybridizes with unopened H1 molecules, achieving cDNA cycling and signal amplification (one KAN molecule can only release one cDNA, but this cDNA can be reused repeatedly; after opening one H1 and being released by HA and HB, it can react with the next unopened H1). H1 forms a complex with HA, HB, and heme. At this point, because the distance between AuNPs and Non-G4 / heme DNAase is shortened, a CRET reaction occurs, leading to a decrease in the chemiluminescent signal, thus enabling sensitive detection of KAN.
[0112] 3.2 Characterization of probe AuNPs-H1
[0113] like Figure 2 As shown in (A) and (B), the hydrated particle size of AuNPs, measured by dynamic light scattering (DLS), is approximately 30 nm, and the Zete potential is approximately -39.8 mV. Figure 2As shown in (C) and (F), AuNPs synthesized by the hydrothermal method are wine-red in color and have uniform particle size. Upon addition of a buffer solution containing NaCl, they aggregate and turn blue-purple. This is because the AuNPs surface carries a large number of negative charges. When NaCl is added, a large number of positive ions aggregate on the negatively charged AuNPs surface, effectively neutralizing the charge of the particles themselves. The electrostatic repulsion is weakened, and the AuNPs are pulled closer by van der Waals attraction, forming irreversible aggregates. In contrast, the AuNPs-H1 solution synthesized by the thermal drying method maintains a red dispersed state. This is mainly attributed to the competitive adsorption of adenine at high temperatures and the extremely high DNA concentration during drying. Heating disrupts the secondary structure of DNA, keeping the strands in an extended state. Water evaporation creates a high-concentration environment, compressing the physical space between AuNPs and DNA, promoting their binding. The negatively charged DNA on the surface of AuNPs-H1 increases the mutual repulsion between AuNPs, thus keeping AuNPs-H1 dispersed. Figure 2 As shown in (D) and (E), the measured UV-Vis spectrum of AuNPs has a maximum absorption peak at 518 nm. After AuNPs is coupled with H1, its maximum absorption peak in the UV spectrum shifts slightly to the right. After adding a buffer solution containing NaCl, AuNPs-H1 still remains in a dispersed state. This indicates that the non-thiolized H1 was successfully coupled to AuNPs by the heat drying method, and the AuNPs-H1 product was obtained.
[0114] 3.3 Optimization of Non-G4 Aptamer Structure and Study on its Catalytic Activity
[0115] Referring to the research of Tang et al. (TANG J, LIU S, HUANG W, et al. A dual-lock toehold-exchange-based aptamer switch for detecting tetracyclines in foods using non-G-quadruplex / hemin DNAzyme [J]. Sensors and Actuators B: Chemical, 2025, 433:137528), the non-G4 aptamer Hem1-2T of heme splits into two fragments, HA and HB. Figure 3 (A) It can be seen that after adding heme to the mixture of HA and HB, the measured chemiluminescence signal value is higher than that of HA or HB alone. This indicates that Non-G4 / heme DNAase is formed, which in turn catalyzes luminol to undergo a chemiluminescence reaction and produces a strong signal.
[0116] Li et al. employed a spatial conformational stabilization strategy, extending the double-stranded structure at the Hem1-2T end to enhance the stability of the original Non-G4 aptamer structure. The resulting peroxidase exhibited catalytic activity reaching 200% of the original aptamer (LI C, WU J, LI X, et al. Application of Non-G-Quadruplex Hemin Aptamers to Hemin Detection and Heme Oxygenase 1 Activity Evaluation via Spatial Conformational Constraint [J]. Analytical Chemistry, 2025, 97(25): 13542-50). Based on this, to enhance the catalytic activity of Non-G4 / heme DNAase and improve the sensor sensitivity, double-stranded structures were extended at the ends of the splitting aptamer fragments HA and HB. To confirm the extension sites of the double strands, complementary double-stranded structures were extended at the 5' end of HA and the 3' end of HB (HA12+HB12 in Table 2), the 3' end of HA and the 5' end of HB (CA12+CB12 in Table 2), and both ends of HA and HB (SA12+SB12 in Table 2). The catalytic efficiency was verified using chemiluminescence experiments. Figure 3 As shown in (B), the chemiluminescence signal is highest when a double-stranded structure is extended at the HA 5' and HB 3' ends (i.e., HA12+HB12). This indicates that by adding complementary structural domains, the rigidity of the aptamer is improved, and the binding conformation is stabilized by spatial conformation constraints, effectively enhancing the binding performance of the aptamer. This is consistent with the results reported, which suggest that extending the terminal double-stranded structural domains of the Non-G4 aptamer can yield aptamers with more stable spatial conformations.
[0117] To further determine the length of the complementary region and obtain the Non-G4 / heme DNAase with maximum catalytic activity, the number of bases in the complementary region was optimized to be 2 bp (corresponding to HA2 and HB2 in Table 2), 4 bp (corresponding to HA4 and HB4 in Table 2), 6 bp (corresponding to HA6 and HB6 in Table 2), 8 bp (corresponding to HA8 and HB8 in Table 2), 10 bp (corresponding to HA10 and HB10 in Table 2), 12 bp (corresponding to HA12 and HB12 in Table 2), and 14 bp (corresponding to HA14 and HB14 in Table 2). Figure 3As shown in (C), the chemiluminescence signal increases with the increase of the number of complementary bases at the ends of HA and HB, indicating that the catalytic activity of Non-G4 / heme DNAase is stronger. The chemiluminescence signal reaches its maximum when the number of complementary bases reaches 10 bp (HA10+HB10), indicating that the catalytic activity of Non-G4 / heme DNAase is strongest at this point. As the number of complementary bases continues to increase, the chemiluminescence signal gradually decreases; therefore, 10 bp is selected as the optimal complementary region length. Based on the extended double strand, a sequence (H-A+HB) was added to the other end of the mitotic aptamer as a binding region to participate in the Toehold-mediated strand substitution reaction. The chemiluminescence reaction was used to verify whether the added sequence affected the catalytic activity of Non-G4 / heme DNAase. Figure 3 As shown in (D), the chemiluminescence intensity measured after the splitting aptamer with added sequence binds to heme is similar to the signal intensity before addition. Therefore, the designed HA and HB structures can be used for subsequent experimental verification.
[0118] 3.4 Verification of cDNA release after aptamer binding to KAN
[0119] The complementary pairing of the aptamer and cDNA was verified based on the significant enhancement of dsDNA fluorescence by TO dye insertion. Figure 4 As shown in (A), the system containing aptamers and cDNA separately served as the control group. When TO dye was applied to the system containing both aptamers and cDNA, the fluorescence signal increased, indicating that the aptamer and cDNA successfully paired to form a double-stranded structure. When KAN was present in the system, due to the stronger affinity of the aptamer for KAN, KAN competitively displaced cDNA from the aptamer-cDNA double-stranded complex. Therefore, by measuring the fluorescence spectrum of TO dye in the solution, a decrease in the fluorescence peak at 535 nm was observed, indicating that KAN specifically binds to the aptamer and cDNA is released. In the negative control group, where KAN was absent, the aptamer and cDNA existed in a hybridized form, exhibiting a stronger fluorescence value.
[0120] Previous studies have indicated that too few binding base pairs between the aptamer and cDNA result in insufficient thermodynamic stability of the double-stranded structure, easily leading to increased background signal; conversely, too many binding base pairs result in an overly strong binding between the aptamer and cDNA, preventing KAN from competing with the cDNA and thus hindering signal generation. Therefore, to improve the signal generation efficiency and sensitivity of the sensor in detecting KAN, based on the above experiments, the number of complementary bases between the aptamer and cDNA was further optimized by comparing the fluorescence changes before and after the addition of KAN. Keeping the aptamer sequence unchanged, the cDNA sequence was modified to achieve complementary bases of 12 (corresponding to cDNA1 in Table 2), 14 (corresponding to cDNA2 in Table 2), 16 (corresponding to cDNA3 in Table 2), 18 (corresponding to cDNA4 in Table 2), and 20 (corresponding to cDNA5 in Table 2) bp. Figure 4 As shown in (B), the fluorescence change value first increases and then decreases with the increase of the number of complementary bases between the aptamer and cDNA. The fluorescence change value is the highest when the number of complementary bases is 14 bp. Therefore, 14 bp is selected as the optimal number of complementary bases between the aptamer and cDNA. Finally, cDNA2 as shown in SEQ ID NO.3 is selected as the cDNA used in the detection system.
[0121] 3.5 CRET Signal Response Optimization Chain Permutation Architecture
[0122] In the proposed detection strategy, a toehold region is established at one end of H1 to identify and hybridize HA / HB. To obtain the optimal chemiluminescent signal response, the toehold length in H1 was optimized. Based on CRET experimental results (…), Figure 5 (A) The results showed that with the increase of Toehold length, the chain substitution reaction rate gradually increased, and the relative chemiluminescence change value ΔI / I0 also increased. The effects of different Toehold lengths were compared: 2 nt (H1-a2), 4 nt (H1-a4), 6 nt (H1-a6), 8 nt (H1-a8), 10 nt (H1-a10), and 12 nt (H1-a12). When the Toehold length was 8 nt, the system exhibited the largest ΔI / I0. Therefore, 8 nt was selected as the optimal Toehold length. In the absence of cDNA, to avoid non-specific binding of H1 to HA and HB, which would lead to an increase in background signal, the stem length of hairpin H1 was optimized to enhance its structural stability. Figure 5(B) H1 with stem lengths of 6 bp (corresponding to H1-1 in Table 2), 8 bp (corresponding to H1-2 in Table 2), 10 bp (corresponding to H1-3 in Table 2), 12 bp (corresponding to H1-4 in Table 2), 14 bp (corresponding to H1-5 in Table 2), 16 bp (corresponding to H1-6 in Table 2), and 18 bp (corresponding to H1-7 in Table 2) were validated using a CRET experiment. When the stem length was 12 bp, ΔI / I0 was the highest, indicating that the background signal of the system was the lowest and the CRET signal response was optimal. If the stem length was too short, the locking region would be insufficient, which might cause HA and HB to bind to H1 on their own, resulting in a large background signal. If the stem length was too long, it might be difficult for cDNA to open the hairpin H1, blocking the strand displacement reaction. Therefore, 12 bp was chosen as the optimal stem length.
[0123] Since cDNA, acting as the initiating strand, interacts with the hairpin H1 in AuNPs-H1 through a branching migration process to open the hairpin probe H1, leading to a strand displacement reaction, the binding of cDNA to AuNPs-H1 is the crucial first step in generating a signal response in the entire reaction system. To ensure the smooth progress of the strand displacement reaction, the number of bases binding between cDNA and AuNPs-H1 was optimized. The number of complementary bases between cDNA and AuNPs-H1 was set within the range of 8 to 20 bp. The optimal number of complementary bases was screened by measuring the chemiluminescent signal response values: 8 bp (cDNA+H1-c8), 10 bp (cDNA+H1-c10), 12 bp (cDNA+H1-c12), 14 bp (cDNA+H1-c14), 16 bp (cDNA+H1-c16), 18 bp (cDNA+H1-c18), and 20 bp (cDNA+H1-c20). Figure 5 (C) shows that ΔI / I0 increases with the number of bases bound, reaching its maximum at 18 bp of complementary bases. As the number of complementary bases continues to increase, the measured ΔI / I0 gradually decreases. This indicates that when the number of complementary bases is less than 18 bp, the binding free energy of cDNA to AuNPs-H1 is insufficient to provide enough driving force to completely open the hairpin H1, preventing subsequent reactions from proceeding. With increasing complementary bases, the binding free energy of the cDNA-AuNPs-H1 complex increases significantly, making the binding too stable and significantly inhibiting the formation of complexes between AuNPs-H1 and HA and HB, resulting in a lower measured ΔI / I0. Therefore, 18 bp is chosen as the optimal number of complementary bases, which effectively opens H1 and successfully initiates the Toehold-mediated strand displacement reaction, forming a stable complex and ensuring the smooth progress of the CRET reaction.
[0124] Finally, H1-a8 (which is the same as the H1-c18 sequence) as shown in SEQ ID NO.37 was selected as H-1 to be used in the detection system.
[0125] To improve chain substitution efficiency, the binding lengths of HA / HB and H1 were further optimized, with gradients ranging from 21 to 29 bp for investigation: 21 bp (H1+H-A+HB-5), 23 bp (H1+H-A+HB-4), 25 bp (H1+H-A+HB-3), 27 bp (H1+H-A+HB-2), and 29 bp (H1+H-A+HB-1). Figure 5 As shown in (D), the chemiluminescence signal changes were greatest when the complementary base numbers of the two reached 25 bp and 27 bp, respectively, and the corresponding ΔI / I0 values were similar. When the binding length was too short, the hybridization stability was insufficient, resulting in incomplete strand displacement reaction and limiting the cycle amplification efficiency of cDNA, thus leading to a lower signal change. Considering both signal response intensity and synthesis cost, 25 bp was ultimately selected as the optimal binding length between H1 and HA / HB. Finally, HB-3, as shown in SEQ ID NO. 62, was selected as the HB used in the detection system.
[0126] 3.6 Investigate the volume ratio of AuNPs-H1 to HA / HB
[0127] The ratio of AuNPs-H1 probe to HA and HB is a key parameter affecting signal amplification efficiency and quenching effect. To determine the optimal synergistic ratio among the three, reduce reagent waste, and achieve optimal sensor detection performance, the volume ratio of AuNPs-H1 to HA / HB was systematically optimized. For example... Figure 6As shown in (A) and (B), with the gradual increase of the added volume of AuNPs-H1, the ΔI / I0 of the system first increases and then decreases, reaching its maximum when the ratio of AuNPs-H1 to HA / HB is 4:3. This phenomenon is attributed to the fact that when less AuNPs-H1 is added, the number of AuNPs-H1 probes in the system is limited, resulting in fewer hairpin H1 probes that can bind to cDNA and be opened. Consequently, the complex formed with HA / HB is limited, leading to insufficient closeness between Non-G4 / heme DNAase and AuNPs, resulting in lower CRET quenching efficiency and therefore a smaller ΔI / I0. As the volume of AuNPs-H1 added increases, the number of H1 molecules that can be opened by cDNA in the reaction system increases, improving the binding efficiency with HA / HB. More Non-G4 / heme DNases are drawn closer to the AuNPs surface, enhancing the CRET quenching effect. ΔI / I0 gradually increases and reaches a peak, at which point the ratio of AuNPs-H1 to HA and HB reaches its optimal match, resulting in the highest quenching efficiency. However, excessive AuNPs-H1 may competitively bind a limited amount of cDNA or HA / HB, preventing some HA / HB from effectively participating in the formation of the triple-stranded complex. Therefore, a 4:3:3 ratio of AuNPs-H1 to HA and HB was chosen as the optimal working condition and served as a reference for concentration design in subsequent experiments.
[0128] 3.7 Verify the distance between AuNPs and Non-G4 / heme DNAase
[0129] Experiments were conducted using H-A1~H-A6 and H-B1~H-B6 from Table 2, where the distances between AuNPs and Non-G4 / heme DNAase were set as follows: 5 bp (H-A1+H-B1), 7 bp (H-A2+H-B2), 9 bp (H-A3+H-B3), 11 bp (H-A4+H-B4), 13 bp (H-A5+H-B5), and 15 bp (H-A6+H-B6).
[0130] like Figure 7As shown in (A), when the distance between AuNPs and Non-G4 / heme DNase is relatively short, the active site of Non-G4 / heme DNase is within the effective range of electron coupling on the AuNPs surface. The excited-state intermediates generated during its catalytic process can efficiently transfer energy to AuNPs, thus suppressing the chemiluminescence signal. As the distance between them continues to increase, the chemiluminescence signal of the system gradually strengthens. This is because the active site of Non-G4 / heme DNase moves further away from the AuNPs surface, significantly weakening the energy transfer efficiency. This allows the catalytic activity of Non-G4 / heme DNase to partially recover, catalyzing luminol luminescence and increasing the chemiluminescence signal. Figure 7 As shown in (B), when the distance between AuNPs and Non-G4 / heme DNAase is 5 bp, the ΔI / I0 value is low. This is because the number of bases is small at this point, and the binding of AuNPs-H1 with HA and HB is unstable, causing the AuNPs end to deviate from the Non-G4 / heme DNAase, thus reducing the quenching effect. Based on the experimental results, to obtain the best quenching effect and detection sensitivity, 9 bp was selected as the optimal distance between AuNPs and Non-G4 / heme DNAase. Finally, H-A3 as shown in SEQ ID NO.50 was selected as the HA used in the detection system.
[0131] 3.8 Feasibility Validation of Toehold-Mediated Strand Displacement-Triggered cDNA Cycle Detection of KAN
[0132] After preliminary optimization experiments, the nucleotide sequences finally determined to be used in the detection system are: aptamer as shown in SEQ ID NO.1, cDNA as shown in SEQ ID NO.3, hairpin probe H1 as shown in SEQ ID NO.37, splitting aptamer HA as shown in SEQ ID NO.50, and splitting aptamer HB as shown in SEQ ID NO.62.
[0133] First, the occurrence of the chain substitution reaction is verified using native-pAGE, such as... Figure 8 As shown in (A), a new band (lane 3) appears after the addition of cDNA and H1, exhibiting a slower migration rate than that of cDNA (lane 1) and H1 (lane 2). This indicates that the cDNA successfully opened the hairpin H1, forming a double-stranded structure. With the addition of HA and HB (lane 7), a new band with an even slower migration rate appears, indicating that the opened H1 underwent a strand displacement reaction with HA and HB, forming a triple-stranded complex. No new band appears in the lane where cDNA is absent (lane 8), indicating that a strand displacement reaction cannot occur in the system.
[0134] Furthermore, the feasibility of constructing a CRET aptamer sensor for detecting KAN using Toehold-mediated strand replacement-triggered cDNA cycling was verified using Native-PAGE. However, due to the small size of AuNPs, they would remain in the sample wells and could not be detected by Native-PAGE. Therefore, the feasibility of the sensor was first verified using a separate hairpin H1. Figure 8 As shown in (B), a new band (lane 3) appears after the addition of aptamer and cDNA, with a slower migration rate than aptamer (lane 1) and cDNA (lane 2), indicating that aptamer binds to cDNA to form a double strand. After adding excess KAN (lane 4), the slower-migrating band disappears, indicating that KAN successfully competitively binds to aptamer, and cDNA is released. When H1 is added, a new band appears in the lane (lane 5), indicating that cDNA binds to H1 to form a double-stranded complex. Finally, HA and HB are added (lane 6), and a new band appears at the top of the lane, with a slower migration rate than all other bands, and a band with the same migration rate as cDNA (lane 2) appears, indicating that the strand displacement reaction has successfully occurred, producing a triple-stranded complex and releasing cDNA. No new band appears in the lane without KAN (lane 7), indicating that the subsequent strand displacement reaction does not occur without the addition of KAN. The native-PAGE experimental results show that the designed KAN detection strategy performed as expected.
[0135] Based on this, the chain substitution reaction was verified through chemiluminescence experiments, such as... Figure 8 As shown in (C), in the designed strand substitution reaction, when cDNA is absent from the system, HA and HB bind with heme to form Non-G4 / heme DNase, which then catalyzes luminol, generating a strong chemiluminescent signal. After adding cDNA, the cDNA binds to H1 and undergoes a strand substitution reaction with HA and HB. The Non-G4 / heme DNase approaches AuNPs, resulting in a CRET effect and a decrease in the chemical signal. The experimental results indicate that the strand substitution was successfully constructed. Furthermore, using the chemiluminescence intensity before and after the addition of KAN as an evaluation index, the feasibility of constructing a CRET sensor to detect KAN using Toehold-mediated strand substitution-triggered cDNA cycling was explored. Figure 8 As shown in (D), the chemiluminescence signal is significantly reduced in the presence of KAN, indicating that KAN competitively binds to the aptamer, releasing cDNA and triggering the subsequent strand displacement reaction. This shortens the distance between the Non-G4 / heme DNAase and AuNPs, resulting in the CRET phenomenon. Based on this, it is demonstrated that the constructed Toehold-mediated strand displacement-triggered cDNA cycling CRET sensor for detecting KAN is feasible.
[0136] 3.9 Optimization of Experimental Conditions
[0137] To improve sensor performance, the system optimized the concentrations of H2O2, luminol, heme, and Mg. 2+ Key parameters such as concentration, chain displacement time, and HA / HB addition concentration were evaluated using relative chemiluminescence intensity ΔI / I0=(I0-I) / I0, where I0 is the chemiluminescence signal intensity in the absence of KAN, I is the chemiluminescence signal intensity after the addition of KAN, and ΔI=I0-I.
[0138] 3.9.1 Optimize the concentrations of chemiluminescent substrates H2O2 and luminol
[0139] like Figure 9 As shown in (A), within the H2O2 concentration range of 5-30 mM, ΔI / I0 increases significantly with increasing H2O2 concentration, reaching its maximum at 30 mM. This indicates that the increased H2O2 concentration promotes the oxidation process of luminol. However, when the H2O2 concentration exceeds 30 mM, the background signal of the system increases accordingly, and the ΔI / I0 value of the reaction system begins to gradually decrease. Therefore, 30 mM H2O2 is selected as the optimal substrate concentration.
[0140] like Figure 9 As shown in (B), it was observed that ΔI / I0 first increased and then decreased with increasing luminol concentration. As a direct reactant in the chemiluminescent reaction, increasing luminol concentration provides more substrate to the reaction system, promoting the reaction and thus increasing ΔI / I0 with increasing luminol concentration, reaching a peak at 0.06 mM. Subsequently, the signal intensity showed a significant decreasing trend in the range of 0.08 mM-0.1 mM. Therefore, 0.06 mM was selected as the optimal luminol concentration.
[0141] 3.9.2 Optimize heme concentration and Mg 2+ concentration
[0142] like Figure 10 As shown in (A), within the lower concentration range, the relative chemiluminescence intensity increases significantly with increasing heme concentration, reaching a peak at 0.4 μM. However, when the heme concentration exceeds 0.4 μM, further increasing the concentration leads to a sharp decrease in ΔI / I0, possibly because excessively high heme concentrations cause an increase in background signal, reducing the signal-to-noise ratio of the detection. Therefore, 0.4 μM heme was selected as the optimal concentration.
[0143] Mg 2+ It plays a key role in the binding of heme to Hem1-2T; therefore, by optimizing Mg... 2+ Concentration is used to enhance the thermal stability of the mitotic aptamer and its binding affinity to heme. For example... Figure 10 As shown in (B), with Mg2+ As the concentration gradually increases, the sensor's output signal shows a trend of first rising and then falling. When Mg 2+ At a concentration of 20 mM, ΔI / I0 reaches its maximum, indicating that at this concentration, the HA and HB structures of the Non-G4 aptamer fragment achieve optimal cofactor binding states, thus exhibiting the highest catalytic efficiency and structural stability. Further increasing Mg... 2+ When the concentration exceeds 20 mM, ΔI / I0 gradually decreases, which may be attributed to excessively high Mg concentrations. 2+ This interfered with the correct conformation of the nucleic acid chain and reaction kinetics, thereby reducing the overall activity of the reaction system. Therefore, 20 mM was chosen as the Mg... 2+ The optimal working concentration.
[0144] 3.9.3 Optimize chain displacement reaction time and HA and HB concentrations
[0145] The strand substitution reaction time directly affects the cDNA cycling efficiency and the degree of triple-stranded complex formation. Therefore, this experiment set up different strand substitution reaction time gradients to investigate their effect on ΔI / I0. Figure 11 As shown in (A), the ΔI / I0 of the system initially increases and then decreases with increasing reaction time. In the initial stage of the reaction, ΔI / I0 increases significantly with increasing reaction time. This is because cDNA is continuously released and cycles to open new AuNPs-H1 cells, promoting the binding of more HA and HB to the AuNPs-H1 surface to form a triple-stranded complex, thus increasing the CRET quenching efficiency. When the reaction time reaches 30 min, ΔI / I0 reaches its maximum value, indicating that the strand substitution reaction is essentially complete and the cDNA cycling efficiency is highest. Therefore, to balance detection sensitivity and experimental efficiency, 30 min is selected as the optimal strand substitution reaction time.
[0146] like Figure 11As shown in (B), the relative chemiluminescence intensity ΔI / I0 of the system first increases and then decreases with increasing HA and HB concentrations. At low HA and HB concentrations, the AuNPs-H1 probe is relatively excessive, able to bind with most HA and HB to form a complex, effectively quenching their catalytic activity, resulting in a low background signal. When the HA and HB concentrations increase to 60 nM, ΔI / I0 reaches its peak, indicating that the binding ratio of Non-G4 / heme DNase to the AuNPs-H1 probe is optimal, achieving the best balance between quenching efficiency and catalytic activity. However, when the HA and HB concentrations continue to increase beyond this optimal point, ΔI / I0 gradually decreases. This phenomenon may be attributed to the fact that excess HA and HB may exceed the binding capacity of the AuNPs-H1 probe, resulting in unquenched free Non-G4 / heme DNase in the system, continuously catalyzing luminol luminescence and significantly increasing the background signal. Therefore, this study selected 60 nM as the optimal concentration of HA and HB.
[0147] 3.10 Performance Analysis of Toehold-Mediated Stroke Displacement-Triggered cDNA Cyclic CRET Sensor
[0148] After determining the optimal reaction conditions for KAN detection, the detection performance of a CRET sensor based on Toehold-mediated strand displacement-triggered cDNA cycling was investigated. Different concentrations of KAN (2, 5, 10, 20, 30, 40, 50, 60, 80, 100, 200, 300 nM) were incubated with aptamer-cDNA, followed by CRET reactions with AuNPs-H1, HA, and HB. Figure 12 As shown in (A) and (B), the chemiluminescence intensity of the system gradually decreased as the concentration of KAN increased from 2 nM to 300 nM. ΔI / I0 showed a good linear relationship with the KAN concentration in the range of 5 nM-100 nM, with a linear regression equation of y=0.00605x+0.09762 and a coefficient of determination R0. 2 The limit of detection (LOD) was 0.97467, and the LOD was 3.60 nM (LOD = 3S / K, where S represents the standard deviation of the blank sample and K represents the slope of the linear regression equation).
[0149] The specificity of the sensor for KAN detection was further evaluated. Under the same experimental conditions, other aminoglycoside antibiotics, including neomycin (NEO) and streptomycin (STR), and other non-aminoglycoside antibiotics, including amoxicillin (AMO), sulfadiazine (SDM), chloramphenicol (CAP), oxytetracycline (OTC), tetracycline (TC), and penicillin (PEN), were selected as interfering antibiotics to enhance the sensor's specificity. Figure 12As shown in (C), none of the interfering antibiotics caused significant changes in the chemiluminescence signal. Compared with the interfering antibiotics, KAN showed a significant change in the chemiluminescence signal. Furthermore, when a mixture containing KAN and other interfering antibiotics was detected, the measured changes in the chemiluminescence signal were not significantly different from those when KAN was present alone, indicating that the proposed sensor has excellent KAN detection specificity, and the influence of other interfering antibiotics is negligible.
[0150] 3.11 Analytical Applications in Real Samples
[0151] Different concentrations of KAN standards (10, 20, and 40 nM) were added to pork and milk samples to investigate the accuracy and practicality of the Toehold-mediated strand displacement-triggered cDNA cycling CRET aptamer sensor for KAN detection. As shown in Table 3, the KAN spiked recoveries in pork samples ranged from 102.18% to 108.10%, with RSDs of 2.76% to 4.70%, while the recoveries in milk samples ranged from 95.23% to 104.06%, with RSDs varying between 1.49% and 5.22%. These results indicate that this method has good accuracy and applicability for the detection of KAN residues in pork and milk, enabling rapid detection of KAN in food samples.
[0152] Table 3. Accuracy and precision of the sensor of the present invention in detecting KAN in pork and milk samples.
[0153]
[0154] 3.12 Performance Comparison with Reported KAN Aptamer Sensors
[0155] To further evaluate the performance of the constructed Toehold-mediated strand displacement-triggered cDNA cycling CRET sensor, this study systematically compared this method with KAN detection methods reported in recent years, and the results are summarized in Table 4. Comprehensive analysis shows that while existing methods have made significant progress in sensitivity, most rely on complex nanomaterial systems. While achieving lower detection limits, this also increases reagent costs, system complexity, and operational requirements. For example, He et al. used a g-C3N4 / BiOI heterostructure to construct a sensing platform for sensitive detection of KAN; Zhang et al. constructed a SERS sensor with AuNFs-MPBA@Ag-Apt and Fe3O4@MoS2@Ag-Apt dual probes for highly specific recognition and sensitive quantitative detection of KAN; Zhao et al. achieved rapid detection of KAN through a TdT-mediated signal amplification strategy; and Xie et al. constructed an enzyme-free fluorescent aptamer sensor using an EDSDR mechanism and DNA fluorescent labeling modification. Although these strategies can effectively reduce the detection limit, their long detection time, reliance on complex labeling steps, and harsh environmental conditions limit their application in rapid detection of real samples.
[0156] In contrast, this study proposes a CRET sensor that utilizes Toehold-mediated chain displacement reactions to achieve efficient enzyme-free cyclic amplification. Combined with AuNPs interface regulation and a Non-G4 splitting aptamer, this sensor enables precise signal modulation and efficient transduction. Compared to traditional fluorescence or colorimetric systems, the CRET signal output exhibits advantages such as low background, high sensitivity, and strong anti-interference capability. Furthermore, this method avoids the use of expensive nanomaterials and complex labeling steps, effectively reducing reagent costs while maintaining detection performance. Experimental results also demonstrate that the sensor exhibits good accuracy and reliability in actual food samples, showing promising application potential. In summary, this study effectively overcomes the shortcomings of existing aptamer sensors in terms of system complexity, cost, and environmental stability while maintaining high detection sensitivity, providing a new, efficient, reliable, and widely applicable strategy for the rapid detection of KAN residues in food.
[0157] Table 4. Performance comparison of the sensor of this invention with other KAN aptamer sensing methods
[0158]
[0159] The literature information listed in Table 4 is as follows:
[0160] Reference 1: TANG Y, HU Y, ZHOU P, et al. Colorimetric Detection of Kanamycin Residue in Foods Based on the Aptamer-Enhanced Peroxidase-Mimicking Activity of Layered WS₂ Nanosheets [J]. Journal of Agricultural and Food Chemistry, 2021, 69(9): 2884-2893.
[0161] Reference 2: QI X, ZHAO Y, SU H, et al. A label-free colorimetric aptasensor based on split aptamers-chitosan oligosaccharide-AuNPs nanocomposites for sensitive and selective detection of kanamycin [J]. Talanta, 2022, 238: 123032.
[0162] Reference 3: ZHAO T, CHEN Q, WEN Y, et al. A competitive colorimetric aptasensor for simple and sensitive detection of kanamycin based on terminal deoxynucleotidyl transferase-mediated signal amplification strategy [J]. Food Chemistry, 2022, 377: 132072.
[0163] Reference 4: XIE L, FAN C, LIU Y, et al. A fluorescent aptasensor for enzyme-free and sensitive detection of kanamycin based on entropy-driven strand displacement reaction [J]. Analytica Chimica Acta, 2024, 1308: 342659.
[0164] Reference 5: HE Z, SU D, LIANG Z, et al. A novel photoelectrochemicalaptasensor based on 3D flower-like g-C3N4 / BiOI p-n heterojunction for thesensitive detection of kanamycin [J]. Analytica Chimica Acta, 2024, 1316:342867.
[0165] Reference 6: XU D, SHAN L, GUO B, et al. A fluorescent aptasensor forkanamycin detection in milk, seafood and water samples using DNA-AgNCs andexonuclease I-assisted recycling amplification strategy [J]. Food Chemistry,2025, 478: 143291.
[0166] Reference 7: ZHANG S, MI F, GENG P, et al. Double enhanced flower-like SERSsensor based on aptamer modification for high specific recognition andsensitive rapidly detection of kanamycin [J]. Sensors and Actuators B:Chemical, 2026, 447: 138899.
[0167] Reference 8: ZHU Y, WANG X, YAN Z, et al. A Dual-SignalElectrochemiluminescence Sensor for Kanamycin Detection Based on a Self-Enhanced Zr MOF and Single Co-Reactant Competition Mechanism [J]. Biosensors,2025, 15(5): 291.
[0168] Document 9: XU Y, LIU Z, DONG H, et al. All-DNA self-assembled G-Quadruplex / hemin DNAzyme nanosphere for ultrasensitive electrochemical detection of kanamycin residue [J]. Sensors and Actuators B: Chemical, 2026,449: 139152.
[0169] 4. Analysis and Summary
[0170] This study constructed a CRET aptamer sensor based on Toehold-mediated strand substitution triggering cDNA cycling for highly sensitive detection of KAN in food. By structurally elongating and optimizing the Non-G4 splitting aptamer fragments HA and HB, the signal response capability of the system was effectively improved. Simultaneously, by controlling the lengths of the hairpin H1 locking region and the Toehold region, and systematically investigating the effect of DNA strand complementary base length on strand substitution efficiency, a Toehold-mediated strand substitution amplification system was established. Based on this, H1 was coupled to AuNPs, and through cDNA cycling, the Non-G4 / heme DNase was drawn closer to the AuNPs surface, triggering the CRET reaction and achieving efficient signal quenching and transduction.
[0171] After optimization, the optimal substrate concentrations for the detection reaction system were: 30 mM H₂O₂, 0.06 mM luminol, and 0.4 μM heme. The optimal Mg concentration in the Tris-HCl buffer was [not specified]. 2+ The optimal working concentration is 20 mM, the optimal chain displacement reaction time is 30 min, the optimal concentration of HA and HB in the sensor system reaction mixture is 60 nM, and the optimal volume ratio of AuNPs-H1 (10 nM) to HA (60 nM) and HB (60 nM) is 4:3:3.
[0172] The sensor of this invention exhibits excellent detection performance for KAN, with a detection limit as low as 3.60 nM, good linear response in the 5-100 nM range, and good specificity. In actual sample detection, the method achieved KAN spiked recoveries of 95.23%-108.10% in pork and milk samples, demonstrating good accuracy and reliability. In summary, this study successfully constructed a CRET aptamer sensing strategy based on Toehold-mediated strand displacement-triggered cDNA cycling, providing an enzyme-free, rapid, and highly sensitive analytical method for KAN detection.
Claims
1. A CRET aptamer sensor for kanamycin (KAN) detection based on Toehold-mediated strand displacement-triggered cDNA cycling, characterized in that: The components include aptamers, cDNA, AuNPs-H1, splitting aptamers HA and HB, heme, luminol, and H2O2; the AuNPs-H1 is obtained by loading hairpin probe H1 onto the surface of gold nanoparticles AuNPs. The base sequence of the aptamer is shown in SEQ ID NO.1, the base sequence of the cDNA is shown in SEQ ID NO.3, the base sequence of the hairpin probe H1 is shown in SEQ ID NO.37, the base sequence of the splitting aptamer HA is shown in SEQ ID NO.50, and the base sequence of the splitting aptamer HB is shown in SEQ ID NO.
62.
2. The CRET aptamer sensor according to claim 1, characterized in that: The aptamer can specifically recognize the target KAN, and the cDNA is the complementary strand of the aptamer; the non-thiolized hairpin probe H1 is coupled to the surface of AuNPs through the terminal adenine, and the aptamer and cDNA complement each other to form a double strand. When KAN is absent, the cleavage aptamers HA and HB in the system form Non-G4 / heme DNase with heme, which catalyzes luminol to produce a chemiluminescent signal. Since the Non-G4 / heme DNase is not enriched on the surface of AuNPs at this time and is far away from AuNPs, the CRET process will not occur, so the chemiluminescent signal is high. When KAN is present, it competitively binds to the aptamer, releasing cDNA complementary to the aptamer. The cDNA opens the hairpin probe H1 on AuNPs-H1 and hybridizes with it to form dsDNA. The toehold site at the other end of the hairpin probe H1 is exposed, and then hybridizes with the binding regions at the ends of HA and HB, resulting in a strand displacement reaction. The released cDNA then binds again to the unopened H1 on the surface of AuNPs, realizing cDNA cycling. H1 forms a complex with HA, HB, and heme. At this time, due to the shortened distance between AuNPs and Non-G4 / heme DNAase, a CRET reaction occurs, resulting in a decrease in the chemiluminescent signal, thus enabling sensitive detection of KAN.
3. The CRET aptamer sensor according to claim 1, characterized in that: The preparation method of AuNPs-H1 includes the following steps: mixing AuNPs with hairpin probe H1 solution, evaporating the resulting mixed solution in a 90°C constant temperature metal bath, reconstituted with pure water, centrifuged, washed to remove excess DNA, and resuspended in ultrapure water to prepare AuNPs-H1.
4. The application of the CRET aptamer sensor according to claim 1 in the detection of kanamycin.
5. The method for detecting kanamycin using the CRET aptamer sensor according to claim 1, characterized in that, Includes the following steps: S1. Incubate the aptamer with cDNA to bind it; S2. After step S1, kanamycin standard solution is added and incubated. KAN competitively binds to the aptamer and releases cDNA complementary to the aptamer. AuNPs-H1, HA and HB are added and reacted. Then heme is added and incubated. Subsequently, luminol and H2O2 are added to obtain the chemiluminescence sensor system. The chemiluminescence intensity of the system is detected and a standard curve is plotted. S3. Prepare the sample solution to be tested. Replace the kanamycin standard solution with the sample solution to be tested. Repeat steps S1 and S2 to prepare the chemiluminescence sensor system and measure its chemiluminescence intensity. Based on the standard curve and the chemiluminescence intensity results of the sample solution to be tested, perform quantitative analysis of the kanamycin contained in the sample solution to be tested.
6. The method according to claim 5, characterized in that: S1. Incubate the aptamer and cDNA at 15-25 ℃ for 10-20 min; S2. After step S1 is completed, add kanamycin standard solution and incubate at 15~25℃ for 10-20 min. Add AuNPs-H1, HA and HB, and react for 30-50 minutes; then add heme and incubate for 5-10 minutes.
7. The method according to claim 5, characterized in that: The concentrations of each substance in the chemiluminescence sensor system described in step S2 are as follows: The substrate concentration of H2O2 is 20~40 mM; The substrate concentration of luminol is 0.05~0.07 mM; The heme concentration is 0.3~0.5 μM; The chemiluminescence sensor system was prepared using Tris-HCl buffer, wherein Mg... 2+ The concentration is 20~30 mM; The concentration of HA or HB is 50~80 nM.
8. The method according to claim 5 or 7, characterized in that: The volume ratio of 10 nM AuNPs-H1 to 1 μM HA and 1 μM HB is (1~5): (1~3): (1~3), preferably 4:3:
3.
9. The method according to claim 5, characterized in that: The sample to be tested in step S3 is an emulsion or meat product; The preparation method of the emulsion test sample solution is as follows: Take 2 mL of emulsion and dilute it twice with Tris-HCl buffer, then add 1 mL of 15% trichloroacetic acid to precipitate the milk protein, mix well and sonicate for 20 min, centrifuge the mixture at 10,000 r / min for 10 min, and collect the supernatant; adjust the pH of the supernatant to 7.8, filter through a filter membrane to remove residual protein, and collect the filtrate to obtain the emulsion test sample solution; The method for preparing the meat product test sample solution is as follows: The meat product is homogenized using a homogenizer. 1 g of homogenized tissue is mixed with 2 mL of methanol and 4 mL of Tris-HCl buffer. The mixture is sonicated for 20 min and then centrifuged at 10,000 r / min for 10 min. The supernatant is collected, filtered through a filter membrane, and the filtrate is collected to obtain the meat product test sample solution.
10. The method according to claim 5, characterized in that: The detection range of kanamycin is 5-100 nM, and the detection limit is 3.60 nM. The chemiluminescence intensity is measured at 425 nm using a chemiluminescence analyzer.