SNP site related to corn silking time, and reagent, kit and application thereof

Abstract

The application discloses a SNP molecular marker site related to corn silk time and application thereof and belongs to the field of crop genetic breeding. By using a whole genome association analysis method, a SNP molecular marker site significantly related to corn silk time is obtained, and the SNP molecular marker site is a base G / C at 209353886 bp of a corn reference genome B73V3 of a No.1 chromosome. The application can quickly and accurately identify the corn silk time by specific detection of the SNP site through a PCR technology, can effectively improve the accuracy of corn variety selection, speeds up the variety breeding process, and has important significance for variety improvement of the corn silk period.

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding, specifically relating to SNP loci related to the silking time of maize and their detection reagents, kits and applications. Background Technology

[0002] As the world's largest and most important food crop, maize is widely cultivated and consumed globally. Variety improvement is an effective means of addressing food security. The silking period of maize refers to the time from seedling emergence to the emergence of the silks from the husks of the female ear. This silking period marks the transition from vegetative to reproductive growth and is a crucial indicator of the maize's growth cycle. Determining the optimal silking period in different planting regions, aligning with the appropriate vegetative and reproductive growth periods, ensures the development of sufficiently robust vegetative cells while allowing ample time for reproductive growth, thus achieving high and stable yields. Furthermore, varieties with shorter silking periods can accelerate breeding by reducing intergenerational growth cycles. In conclusion, the silking period of maize has a significant impact on maize growth and variety selection. Therefore, cultivating and selecting maize varieties with suitable silking periods is of great importance for improving maize quality and yield, accelerating maize breeding, and meeting the growing demand for food.

[0003] No genes related to maize silking stage have been reported to be cloned and analyzed. At the genomic level, maize silking stage, as a quantitative trait, is influenced by the additive, dominant, and epistatic effects of multiple minor genes, as well as their environmental interactions. The overall genetic basis for its formation is not yet fully understood. With the continuous development of next-generation sequencing technologies and the decreasing sequencing costs, novel markers, represented by single nucleotide polymorphisms (SNPs), are increasingly being applied to plant population genetics research. SNP loci are characterized by their large number and high distribution density, and their development can be performed on a large scale and with high automation without the need for PCR and electrophoresis experiments.

[0004] Conventional breeding requires planting experimental materials and then selecting based on phenotypes. This results in: 1) a long experimental cycle; 2) the need for breeders to accumulate years of experience to obtain accurate experimental data, and high requirements for technical personnel; and 3) the need to spend a lot of money on land, labor, fertilizer, and other resources.

[0005] Therefore, there is an urgent need in this field for a SNP molecular marker related to the silking time of maize for silking period identification and breeding. Summary of the Invention

[0006] In view of this, the present invention obtained SNP molecular markers associated with the silking time of maize through genome-wide association analysis. These SNP molecular markers can be used to effectively screen maize varieties with shorter silking times. Thus, the present invention is completed.

[0007] In a first aspect, the present invention provides an application of SNP molecular markers in the identification of silking time traits in maize, wherein the SNP molecular markers are located at a 209353886bp site on chromosome 1 of the maize reference genome B73 V3, and the SNP molecular markers have G / C base mutations.

[0008] In a second aspect, the present invention provides a primer for detecting SNP molecular markers associated with the silking time trait in maize. The primer is a primer for detecting an SNP molecular marker located at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, wherein the SNP molecular marker has a G / C base mutation.

[0009] In a third aspect, the present invention provides a kit for detecting SNP molecular markers associated with the silking time trait of maize, the kit comprising the primers and PCR amplification reagents described in the second aspect; the SNP molecular marker is located at a 209353886bp site on chromosome 1 of the maize reference genome B73 V3, and the SNP molecular marker has a G / C base mutation.

[0010] In a fourth aspect, the present invention provides a method for predicting the silking time of corn, the method comprising the following steps:

[0011] (1) Extract genomic DNA from maize leaves to test the sample;

[0012] (2) Using genomic DNA as a template, PCR amplification is performed on the target sequence in the genomic DNA of the sample to be tested using the primers described in the second aspect of the present invention or the kit described in the third aspect of the present invention;

[0013] (3) Detect the amplified samples to determine the polymorphism of SNP molecular markers;

[0014] (4) The silking time of corn is determined based on the polymorphism of the SNP molecular marker. If the amplification result shows that the SNP molecular marker is G, the silking time of the corn sample to be tested is short; if the SNP molecular marker is C, the silking time of the corn sample to be tested is long.

[0015] In a fifth aspect, the present invention provides an isolated nucleic acid comprising a G at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, and 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, or 300 bp upstream and downstream of the 209353886 bp site on chromosome 1.

[0016] In a sixth aspect, the present invention provides a carrier carrying the isolated nucleic acid described in the fifth aspect.

[0017] In a seventh aspect, the present invention provides a recombinant cell carrying the isolated nucleic acid described in the fifth aspect or the vector described in the sixth aspect.

[0018] In an eighth aspect, the present invention provides a method for breeding maize varieties with short silking periods, the method comprising: transforming the maize variety to be constructed using recombinant cells as described in the seventh aspect.

[0019] In summary, this invention provides an application of SNP molecular markers in the identification of silking time traits in maize. Utilizing these SNP molecular markers, maize varieties with shorter silking periods or those better suited to the planting environment can be effectively bred. Employing whole-genome molecular marker-assisted breeding technology allows for selection based on genotype, overcoming the shortcomings and deficiencies of conventional breeding methods, such as long breeding cycles, heavy workload in later screening stages, and low efficiency in identifying varieties or lines, thus further accelerating breeding. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other implementation schemes can be obtained based on these drawings without creative effort.

[0021] Figure 1 The silking time of corn with different SNPs is shown in Example 2. Detailed Implementation

[0022] The present invention will now be clearly and completely described in conjunction with its embodiments and accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments that can be obtained by those skilled in the art based on the embodiments of the present invention are within the scope of protection of the present invention.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0024] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of." The expressions "comprising," "including," or "basically / mainly composed of" should be understood as open-ended expressions, indicating that they include not only the elements, components, parts, and method steps specifically listed after the expression, but also other elements, components, parts, and method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of" may also be understood as closed-ended expressions in certain circumstances, indicating that they only include the elements, components, parts, and method steps specifically listed after the expression, and do not include any other elements, components, parts, or method steps. In this case, the expression is equivalent to the expression "composed of."

[0025] In this paper, the term "SNP (Single Nucleotide Polymorphism)" refers to a nucleic acid sequence polymorphism caused by a single nucleotide variation at the genomic level. The term "SNP site" refers to a site in the genome that exhibits a single nucleotide polymorphism.

[0026] As previously stated, the present invention aims to provide an SNP molecular marker related to corn silking time.

[0027] Therefore, in a first aspect, the present invention provides an application of SNP molecular markers in the identification of silking time traits in maize, wherein the SNP molecular markers are located at a 209353886bp site on chromosome 1 of the maize reference genome B73 V3, and the SNP molecular markers have a G / C base mutation.

[0028] In a second aspect, the present invention provides primers for detecting SNP molecular markers associated with the silking time trait in maize. The primers are for detecting an SNP molecular marker located at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, wherein the SNP molecular marker exhibits a G / C base mutation. In a preferred embodiment, the primers comprise: a forward primer 5'-CGCCGTCGTGGGCTGATGAT-3' (SEQ ID NO:1) and a reverse primer 5'-GCTGCTCTGGTCCGTGCTGA-3' (SEQ ID NO:2).

[0029] For the G / C polymorphism at the 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, primers can be designed using methods known in the art, such as online primer design using Primer 3. Furthermore, those skilled in the art will understand that primers used to detect the aforementioned SNP molecular markers are not limited to the primers SEQ ID NO:1-2 disclosed in the second aspect of this invention.

[0030] In a third aspect, the present invention provides a kit for detecting SNP molecular markers associated with the silking time trait in maize. The kit includes the primers and PCR amplification reagents described in the second aspect. The SNP molecular marker is located at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, and the SNP molecular marker exhibits a G / C base mutation. In a preferred embodiment, the primers include: a forward primer 5'-CGCCGTCGTGGGCTGATGAT-3' (SEQ ID NO: 1) and a reverse primer 5'-GCTGCTCTGGTCCGTGCTGA-3' (SEQ ID NO: 2).

[0031] In one embodiment, the PCR amplification reagent includes dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer. Those skilled in the art will understand that the PCR amplification reagent may also include other reagents necessary for PCR. In a preferred embodiment, the DNA polymerase is Taq DNA polymerase.

[0032] In a further embodiment, the kit further includes template DNA as a positive control to increase the accuracy of the SNP molecular marker detection. In a preferred embodiment, the template DNA is G at the 209353886 bp site on chromosome 1 of the maize reference genome B73 V3. That is, it can be understood that, for the purpose of screening maize with a short silking time, a maize sequence including G at the 209353886 bp site on maize chromosome 1 is used as a positive control.

[0033] In a fourth aspect, the present invention provides a method for predicting the silking time of corn, the method comprising the following steps:

[0034] (1) Extract genomic DNA from maize leaves to test the sample;

[0035] (2) Using genomic DNA as a template, PCR amplification is performed on the target sequence in the genomic DNA of the sample to be tested using the primers described in the second aspect of the present invention or the kit described in the third aspect of the present invention;

[0036] (3) Detect the amplified samples to determine the polymorphism of SNP molecular markers;

[0037] (4) The silking time of corn is determined based on the polymorphism of the SNP molecular marker. If the amplification result shows that the SNP molecular marker is G, the silking time of the corn sample to be tested is short; if the SNP molecular marker is C, the silking time of the corn sample to be tested is long.

[0038] Those skilled in the art will understand that methods for detecting the SNP molecular markers described in the first aspect of the present invention include, but are not limited to, sequencing methods (e.g., Sanger sequencing, whole genome resequencing, etc.), PCR-based methods (e.g., TaqMan probe method, ARMS-PCR method, etc.), gene chip methods, etc.

[0039] In a fifth aspect, the present invention provides an isolated nucleic acid comprising a G at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, and upstream and downstream of this 209353886 bp site by 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, and 300 bp, respectively. That is, the sequence of the isolated nucleic acid is: N1 bp upstream of the 209353886 bp site on chromosome 1 + G + N2 bp downstream of the 209353886 bp site on chromosome 1, where N1 and N2 are any positive integers and can be the same or different.

[0040] In a preferred embodiment, the isolated nucleic acid comprises a G at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, and 250 bp upstream and downstream of this 209353886 bp site on chromosome 1. That is, the sequence of the isolated nucleic acid is: 250 bp upstream of the 209353886 bp site on chromosome 1 + G + 250 bp downstream of the 209353886 bp site on chromosome 1, and the nucleotide sequence of the isolated nucleic acid is GGCGCCGTCGTGGGC. TGATGATGGCGACGGGGCGCGGGAGACGATGCGGCTCGACGAGTGCCACCTCTTGATCATGCACCGGAGCTTGCTCAGCCCGCCCTTCGCCATTGTTGCCTCTCTCTCTCCCTCCTTCGG TCGGACTTCGGATGGGGCGAGGCCTGGCTAACACACCAGACGCGCGCCGAATTCAAGTACAAGAACAGGGGAGGAAGGAAGAATGGAAGAAGAAGAAGAAGAAGATGGGGGGAGAAGGTTATG GTTGGGAAATGGGACTGCAGAGTGCAGACGAGGCGACGGCCAAGGCAACAAGGGTGGATTGAATATATAAGGGAAATAAAATCGGGTGGTGCGGCGCGGCGGAAGAGGCAATGTGGGGACCGCATGTCGGCCGGAGGAGGCCGAGAGGCCAGCCGCTGCCGATTAGGCGATTAGCCGTCCGTCGTCAGCACGGACCAGAGCAGCAGCAGCTGGCGGGGGCGTTTTGTGGCTTTTGTCCAGA (SEQ ID NO:3), where the G at the 209353886bp site on chromosome 1 of the maize reference genome B73 V3 is shown in bold.

[0041] In a sixth aspect, the present invention provides a vector carrying the isolated nucleic acid described in the fifth aspect. In one embodiment, the vector may be, for example, a bacterial plasmid, a bacteriophage, or an animal or plant virus.

[0042] In a seventh aspect, the present invention provides a recombinant cell carrying the isolated nucleic acid described in the fifth aspect or the vector described in the sixth aspect. In one embodiment, the recombinant cell is selected from Agrobacterium.

[0043] The inventors of this invention have discovered that transfecting maize cells with a nucleic acid sequence containing the SNP site (G) of this invention, and then cultivating the plants, can shorten the silking period of the maize plants. Therefore, those skilled in the art can use the isolated nucleic acid, vector, or recombinant cells to cultivate transgenic maize varieties with a short silking period.

[0044] In an eighth aspect, the present invention provides a method for breeding maize varieties with short silking periods, the method comprising: transforming the maize variety to be constructed using the recombinant cells described in the seventh aspect, or hybridizing the transgenic maize variety described above with the maize variety to be constructed.

[0045] Example

[0046] The present invention and its technical effects will be clearly and completely described below with reference to embodiments and accompanying drawings, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0047] Example 1

[0048] This embodiment utilizes WGS (whole genome sequencing) technology to develop SNP loci, performing high-throughput sequencing of the entire genome to analyze differences between individuals, and simultaneously annotating SNPs and genome structure. With the continuous advancement of sequencing technology and the decreasing cost of sequencing in recent years, whole genome sequencing has become readily available. Because whole genome sequencing contains complete and rich information, it can obtain more information than exon sequencing or targeted sequencing, and it has advantages in identifying single nucleotide variants (SNPs), insertions, and deletions (Indels).

[0049] Based on previous research, this embodiment performs whole-genome sequencing on 1,600 maize inbred lines widely planted in China that were screened from the National Gene Bank. High-density genotype data for each material was obtained. Combined with the corresponding phenotypic data, genome-wide association analysis (GWAS) was used to analyze and locate genes for silking stage traits, providing genetic materials and gene selection sites for the improvement of maize silking stage heritable traits.

[0050] This embodiment includes the following steps:

[0051] 1. Measurement of corn silking period

[0052] The silking period was defined as the time from emergence to the emergence of approximately 2 cm of silk from the husk in 1600 maize samples. Three plants were selected from each sample, and the average silking period was taken as the silking period for each sample.

[0053] 2. WGS library construction and resequencing

[0054] Fresh young leaves (0.5g each) were harvested from 1600 maize samples collected in Step 1. Genomic DNA was extracted from each sample using the CTAB (hexadecyltrimethylammonium bromide) method and its quality was assessed. Sequencing libraries were constructed using the TruSeq NanoDNA HT Sample Preparation Kit (Illumina USA), and an index was added to each sample. The genomic DNA samples were fragmented to approximately 350 base pairs (bp) using sonication. The DNA fragments were then end-repaired, A-tailed, ligated with full-length adapters, and further amplified by PCR. The PCR products were then purified (using the AMPure XP bead system), and the size distribution of the libraries was analyzed using an Agilent 2100 bioanalyzer. Quantification was performed using real-time quantitative PCR. Sequencing was then performed using the Illumina HiSeq X platform, yielding raw sequences with paired-end reads of 150 bp.

[0055] 3. Mutation detection

[0056] Variation detection was performed using the maize B73 reference genome version V3. Quality control, alignment, deduplication, and variation detection were performed using the Mega BOLT full workflow developed by BGI Genomics Co., Ltd. Genotype files for each sample were obtained and merged to produce a total file containing SNP variation information from all 1600 materials. Plink (v1.9) was used to filter SNP sites with a minor allele frequency less than 0.01 and a deletion rate greater than 0.6%, resulting in 16,552,492 valid SNP sites for downstream analysis.

[0057] 4. Genome-wide association analysis of the silking stage trait in maize

[0058] Using 1600 maize genotype files as input, genome-wide association analysis (GWAS) was performed using GEMMA. First, the G matrix of the 1600 materials was calculated using the "-gk 2" parameter. Then, GEMMA was used with the G matrix as a covariate to eliminate errors caused by kinship. Finally, the "-lmm 1" model was used to perform GWAS on the 1600 materials.

[0059] 5. Gene screening and mining

[0060] Using 0.05 / number of valid SNPs as the significance threshold and 0.01 / number of valid SNPs as the highly significant threshold, the p_wald values ​​in the genome-wide association analysis output files were screened. The results showed that the SNP locus located at POS209353886 on chromosome 1 of the maize B73 V3 reference genome, with a G / C polymorphism, was highly significantly associated with the silking stage of maize and was tightly linked to the GRMZM2G059138 gene.

[0061]

[0062] Example 2

[0063] This embodiment uses maize material to verify the SNP molecular markers screened in Example 1.

[0064] 1. Using the results files of whole-genome sequencing and variant detection of 1600 maize materials as described in Example 1, bcftools was used to extract the variant at POS209353886 on chromosome 1 of the maize B73 V3 reference genome for each material. In the genome-wide association analysis, the p_wald value of this variant was less than 0.01 / the number of valid SNPs used for analysis, indicating that this site was highly significantly associated with silking time in the analysis.

[0065] 2. Using the variant file at POS209353886 on chromosome 1, samples with genotypes of C / C and G / G at this locus were screened, and their silk-reeling time traits were statistically plotted. Figure 1 It can be seen that the sample with genotype G / G at this locus has a shorter silk-reeling time. A t-test showed a statistically significant difference between the two. Figure 1 It is identified by the symbol "***".

[0066] Example 3

[0067] This embodiment uses the following steps to design primer pairs targeting the SNP sites in Example 1: Using samtools (v1.3.1), a fAI index file is created for the FASTA file corresponding to the maize B73 reference genome v3 version, and the sequences of 250 bp upstream and downstream of the aforementioned SNP, i.e., positions 209353636 to 209354136 on chromosome 1, are extracted. The extracted sequences are imported into Primer Premier 5 software to design primers, setting the primer amplification result fragment to include the target SNP at position 251 of the sequence. The primer pair with the highest score and the fewest hairpin-like or other special structures (i.e., SEQ ID NO:1 and SEQ ID NO:2) is selected from the software design.

[0068] The aforementioned primer pair was synthesized by a biotechnology company and used to detect the SNP at position 209353886 on chromosome 1 of a maize sample. The results showed that this primer pair could obtain relevant information about position 209353886 on chromosome 1.

[0069] The above provides a detailed description of the SNP sites related to corn silking time, their detection reagents, kits, and applications provided by this invention. Specific embodiments are used to illustrate the principles and implementation methods of this invention. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.

Claims

1. The use of a SNP molecular marker in identifying the silk time trait of corn, characterized in that, The SNP molecular marker is located at a position of 209353886 bp on chromosome 1 of the maize reference genome B73 V3, and the SNP molecular marker has a G / C base mutation.

2. A primer for detecting a SNP molecular marker associated with the silk time trait of corn, characterized in that, The primers are primers for detecting an SNP molecular marker located at a 209353886 bp site on chromosome 1 of the maize reference genome B73 V3, wherein the SNP molecular marker has a G / C base mutation; preferably, the primers include: a forward primer 5'-CGCCGTCGTGGGCTGATGAT-3' and a reverse primer 5'-GCTGCTCTGGTCCGTGCTGA-3'.

3. A kit for detecting a SNP molecular marker associated with the silk time trait of maize, characterized in that, The kit includes the primers and PCR amplification reagents as described in claim 2; the SNP molecular marker is located at a 209353886 bp site on chromosome 1 of the maize reference genome B73V3, and the SNP molecular marker has a G / C base mutation.

4. The kit of claim 3, wherein The PCR amplification reagents include dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer; optionally, the kit also includes template DNA.

5. A method of predicting the silked time of corn, characterized by, The method includes the following steps: (1) Extract genomic DNA from maize leaves to test the sample; (2) Using genomic DNA as a template, PCR amplification is performed on the target sequence in the genomic DNA of the sample to be tested using the primers described in claim 2 or the kit described in any one of claims 3-5; (3) Detect the amplified samples to determine the polymorphism of SNP molecular markers; (4) The silking time of corn is determined based on the polymorphism of the SNP molecular marker. If the amplification result shows that the SNP molecular marker is G, the silking time of the corn sample to be tested is short; if the SNP molecular marker is C, the silking time of the corn sample to be tested is long.

6. An isolated nucleic acid, comprising, The isolated nucleic acid comprises a G at a 209353886 bp site on chromosome 1 of the maize reference genome B73V3, and 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, or 300 bp upstream and downstream of the 209353886 bp site on chromosome 1; preferably, the isolated nucleic acid comprises a G at a 209353886 bp site on chromosome 1 of the maize reference genome B73V3, and 250 bp upstream and downstream of the 209353886 bp site on chromosome 1, and the isolated nucleic acid has a nucleotide sequence as shown in SEQ ID NO:

3.

7. A carrier, characterized in that, The vector carries the isolated nucleic acid as described in claim 6.

8. A recombinant cell, characterized in that, The recombinant cells carry the isolated nucleic acid as described in claim 6 or the vector as described in claim 7; optionally, the recombinant cells are selected from Agrobacterium.

9. A method for breeding maize varieties with short silking periods, characterized in that, The method includes: transforming the maize variety to be constructed using the recombinant cells described in claim 8.

Images