Method for manufacturing nucleic acid oligomers

Abstract

The present application relates to a method for producing a nucleic acid oligomer. The present application provides a method for efficiently producing a nucleic acid oligomer. Specifically, the present application provides a method for producing a nucleic acid oligomer represented by Formula (2), which comprises reacting a nucleic acid oligomer represented by Formula (1) with formaldehyde and dichloroacetic acid at a molar ratio (formaldehyde mol / dichloroacetic acid mol) of 90 x 10 ‑6 The following procedure for the reaction of a dichloroacetic acid solution, Formula (1), wherein the symbols have the meanings described in the specification; Formula (2), wherein the symbols have the meanings described in the specification.

Description

[0001] This application is a divisional application of Chinese invention patent application No. 202180023282.5 (PCT application number PCT / JP2021 / 013023), filed on March 26, 2021, entitled "Method for manufacturing nucleic acid oligomers". Technical Field

[0002] This application claims priority and benefits from Japanese Patent Application No. 2020-058880, filed on March 27, 2020, the entire contents of which are incorporated herein by reference.

[0003] This invention relates to a method for manufacturing nucleic acid oligomers. Background Technology

[0004] In recent years, interest in the application of nucleic acid oligomers in the medical field has been growing. Examples include antisense nucleic acids, aptamers, ribozymes, and siRNAs, which induce RNA interference (RNAi) and are collectively known as nucleic acid drugs.

[0005] Nucleic acid oligomers can be synthesized using a solid-phase synthesis method. The oligomers, synthesized by extending nucleic acids on a solid support, are cleaved from the solid support. Then, for nucleic acid oligomers containing ribose, the protecting group at the 2' position of the ribose is deprotected to remove it, thus producing the target nucleic acid oligomer. In the solid-phase synthesis method, phosphorous amides of nucleosides (hereinafter referred to as "amidite") are used as raw materials. It is known that the protecting group at the 5' position of the hydroxyl group is deprotected using a dichloroacetic acid solution; however, the yield of nucleic acid oligomers synthesized using dichloroacetic acid solution has not always been satisfactory, and the synthesis is not efficient (Patent Document 1).

[0006] Existing technical documents Patent documents Patent Document 1: International Publication No. 99 / 43694 Summary of the Invention

[0007] The problem that the invention aims to solve The purpose of this invention is to provide an efficient method for preparing nucleic acid oligomers.

[0008] Methods for solving problems The inventors of this application have conducted repeated and careful research to achieve the above-mentioned objectives, and as a result, provide an efficient method for manufacturing nucleic acid oligomers, characterized in that, in the synthesis of nucleic acid oligomers, a dichloroacetic acid solution with a formaldehyde concentration of a certain level or below is used, or the formaldehyde solution is used after the quality of the dichloroacetic acid has been improved.

[0009] This invention includes, but is not limited to, the following methods.

[0010] 1. A method for manufacturing the nucleic acid oligomer shown in formula (2), comprising setting the molar ratio (mol formaldehyde / mol dichloroacetic acid) of the nucleic acid oligomer shown in formula (1) to 90 × 10⁻⁶. -6 The following steps describe the reaction process using dichloroacetic acid solution. [Chemical Formula 1] In equation (1), G 2 The protecting group representing the hydroxyl group. B a Whether they are the same or different, each independently represents a nucleic acid base that can be protected by a protecting group. R 1 R 2 and R 3 They may be the same or different from each other, each independently representing a hydrogen atom or an alkoxy group. R may be the same or different from each other, each independently representing a protected hydroxyl, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group. Q' may be the same as or different from each other, each independently representing a methylene group bonded to the carbon atom at the 4' position of the ribose, an ethylene group bonded to the carbon atom at the 4' position of the ribose, or an ethimide group bonded to the carbon atom at the 4' position of the ribose. Y may be the same or different from each other, each independently representing an oxygen atom or a sulfur atom. n represents any integer from 1 to 200. W1 represents the OZ base and X1 represents the R base, or W1 represents the OV base and X1 represents the OZ base. V represents the protecting group for the hydroxyl group. Z is a group having a structure consisting of a solid support and a linking group. Furthermore, when n is an integer greater than 2, non-nucleotide linkers can be incorporated between the nucleotides of the nucleic acid oligomer shown in equation (1); [Chemical Formula 2] In equation (2), G 2 B a R, Y, X1, W1, and n are the same as described above, and Non-nucleotide linkers can be incorporated between nucleotides in the manner defined in equation (1).

[0011] 2. A method for manufacturing the nucleic acid oligomer shown in formula (2'), comprising the following steps: The process described in item 1 above; A further step is to remove the group represented by Z from the nucleic acid oligomer of formula (2) generated in this process; and The process of removing hydroxyl groups and protecting groups from nucleic acid bases. [Chemical Formula 3] In equation (2'), Y and n are the same as described above. B c They may be the same or different from each other, each independently representing a nucleic acid base. G 4 They may be the same or different from each other, each independently representing a hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion. R' may be the same or different from each other, each independently representing a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' is the same as above. X3 and W3 each independently represent a hydroxyl group, or X3 represents the R' group and W3 represents the hydroxyl group.

[0012] 3. The manufacturing method as described in item 1 above further includes the following steps: The process of obtaining the nucleic acid compound represented by formula (3), wherein the nucleic acid compound represented by formula (3) is obtained by arbitrarily extending the chain length of the nucleic acid oligomer represented by formula (2) using an amide method; and The process of cleaving the compound shown in formula (3) to obtain the compound shown in formula (4), and further deprotecting the compound shown in formula (4) to produce the nucleic acid oligomer shown in formula (5) [Chemical Formula 4] In equation (3), G 2 B a R, Y, X1, and W1 are the same as described above. G 5 The protecting group or hydrogen atom of the hydroxyl group shown in the following formula is represented. [Chemical Formula 5] R 1 R 2 and R 3 As mentioned above, m is an integer that satisfies m≥n; [Chemical Formula 6] In equation (4), G5 R, Y, and m are the same as described above. G 4 They may be the same or different from each other, each independently representing a hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion. B C They may be the same or different from each other, each independently representing a nucleic acid base. X2 represents a hydroxyl group and W2 represents an OV group, or X2 represents the R group and W2 represents the hydroxyl group. V represents the protecting group of the hydroxyl group; [Chemical Formula 7] In equation (5), G 4 B c Y and m are the same as described above. R' may be the same or different from each other, each independently representing a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' is the same as above. X3 and W3 each independently represent a hydroxyl group, or X3 represents the R' group and W3 represents the hydroxyl group.

[0013] 4. The manufacturing method as described in any one of paragraphs 1 to 3 above, wherein the non-nucleotide linker is a linker comprising an amino acid backbone.

[0014] 5. The manufacturing method as described in item 4 above, wherein the linker comprising the amino acid backbone is a linker having a structure selected from the group consisting of (A14-1), (A14-2), and (A14-3) below. [Chemical Formula 8] In the formula, Y is the same as described above.

[0015] 6. The manufacturing method according to any one of paragraphs 1 to 5, wherein the dichloroacetic acid solution comprises at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents.

[0016] 7. The manufacturing method as described in any one of items 1 to 6 above, wherein the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) is 43 × 10⁻⁶. -6 the following.

[0017] 8. The manufacturing method as described in any one of items 1 to 6 above, wherein the molar ratio (formaldehyde mol / dichloroacetic acid mol) of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution is 22 × 10⁻⁶.-6 the following.

[0018] 9. The manufacturing method as described in any one of paragraphs 1 to 8 above, wherein the nucleic acid oligomer is ribonucleic acid (RNA).

[0019] 10. The manufacturing method as described in any one of items 1 to 8 above, wherein the nucleic acid oligomer is ribonucleic acid (RNA), and the protecting group at the 2' position of the ribose is the protecting group shown in formula (6). [Chemical Formula 9] In equation (6), q represents any integer from 1 to 5. R a and R b They may be the same or different from each other, each independently representing a methyl, ethyl, or hydrogen atom. The * symbol indicates the bonding site with the oxygen atom of the hydroxyl group at the 2' position of the ribose, and E W This indicates an electron-withdrawing group.

[0020] 11. The manufacturing method as described in item 10 above, wherein R a and R b Both are hydrogen atoms and E W It is a cyano group.

[0021] 12. The manufacturing method as described in any one of paragraphs 1 to 11 above, wherein the nucleic acid oligomer is an oligomer with a chain length of 40 or more.

[0022] 13. The manufacturing method as described in any one of paragraphs 1 to 11 above, wherein the nucleic acid oligomer is an oligomer with a chain length of 50 or more.

[0023] 14. The manufacturing method as described in any one of paragraphs 1 to 11 above, wherein the nucleic acid oligomer is an oligomer with a chain length of 60 or more.

[0024] 15. The manufacturing method as described in any one of paragraphs 1 to 11 above, wherein the nucleic acid oligomer is an oligomer with a chain length of 80 or more.

[0025] 16. The manufacturing method as described in any one of paragraphs 1 to 11 above, wherein the nucleic acid oligomer is an oligomer with a chain length of 100 or more.

[0026] 17. A dichloroacetic acid solution, wherein the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 90 × 10⁻⁶. -6 the following.

[0027] 18. The dichloroacetic acid solution as described in item 17 above, wherein the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 43 × 10⁻⁶. -6 the following.

[0028] 19. The dichloroacetic acid solution as described in item 17 above, wherein the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 22 × 10⁻⁶. -6 the following.

[0029] 20. A method for manufacturing a dichloroacetic acid solution as described in any one of items 17 to 19 above, comprising the following steps: A purified dichloroacetic acid solution is obtained by azeotropic distillation to remove formaldehyde from a solution containing an unpurified dichloroacetic acid solution containing formaldehyde and a solvent that azeotropically reacts with formaldehyde.

[0030] 21. The manufacturing method as described in item 20 above, wherein the boiling point of the azeotropic solvent is below 194°C.

[0031] 22. The manufacturing method as described in item 20 or 21 above, wherein the azeotropic solvent is dichloromethane, acetonitrile, or an aromatic organic solvent.

[0032] 23. The manufacturing method as described in item 22 above, wherein the aromatic organic solvent is toluene.

[0033] 24. A method for manufacturing nucleic acid oligomers, comprising the purification step of the dichloroacetic acid solution described in paragraph 20 above, and the step of using the purified dichloroacetic acid solution obtained in the previous step as described in any one of paragraphs 1 to 3 above.

[0034] The effects of the invention This invention provides an efficient method for manufacturing nucleic acid oligomers. Using this method, an increased yield of the manufactured nucleic acid oligomers can be expected. Attached Figure Description

[0035] [ Figure 1 ] Figure 1 Route A is shown as a typical example of manufacturing nucleic acid oligomers of formula (5) from nucleic acid oligomers represented by formula (1). In the figure, G is... 1 As long as it can function as a protecting group for the hydroxyl group, it can be used without particular restrictions, and known protecting groups used in amide compounds can be widely used. Additionally, G... 3 They may be the same or different from each other, each independently representing an alkyl group, or they may be 2 Gs. 3 They bond together to form a ring structure. As G 3 The symbols, whether identical or different from each other, independently represent alkyl groups, such as preferably methyl, ethyl, propyl, or isopropyl, more preferably both being isopropyl. Other symbols are the same as described above. Detailed Implementation

[0036] A method for reacting a dichloroacetic acid solution with a formaldehyde concentration below a certain level with the nucleic acid oligomer shown in formula (1) to obtain the nucleic acid oligomer shown in formula (2) will be described.

[0037] The molar ratio (formaldehyde mol / dichloroacetic acid mol) of the dichloroacetic acid solution in this invention is typically 90 × 10⁻⁶. -6 The preferred value is 43×10. -6 The following is more preferably 22×10 -6 The following are methods for determining the formaldehyde concentration in dichloroacetic acid solution: gas chromatography or high-performance liquid chromatography (HPLC). In gas chromatography, the formaldehyde concentration is calculated by direct analysis. In HPLC, formaldehyde is reacted with acetylacetone, and the amount of 3,5-diacetyl-1,4-dihydrodimethylpyridine obtained is measured to calculate the formaldehyde concentration.

[0038] The concentration of dichloroacetic acid in the dichloroacetic acid solution is usually 0.1~2.4M, preferably 0.1~1.2M, more preferably 0.1~0.6M, and even more preferably 0.2~0.4M.

[0039] As a diluent for dichloroacetic acid, there are no particular limitations as long as it does not participate in the reaction; dichloromethane, acetonitrile, aromatic organic solvents, water, or any mixture of solvents can be included. Preferably, at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents can be included, and more preferably, an aromatic organic solvent can be included. Toluene can be included as an aromatic organic solvent.

[0040] The reaction temperature in the above reaction is preferably 0~40℃, more preferably 10~30℃.

[0041] Formaldehyde in a dichloroacetic acid solution can be removed by azeotropic mixing with any solvent or mixture of solvents. The azeotropic solvent is not particularly limited as long as it has a boiling point lower than dichloroacetic acid; examples include dichloromethane, acetonitrile, aromatic organic solvents, or any mixture of solvents. Dichloromethane, acetonitrile, or aromatic organic solvents are preferred, and aromatic organic solvents are more preferred. Toluene is an example of an aromatic organic solvent.

[0042] The boiling point of the azeotropic solvent is preferably below 200°C, and more preferably below 194°C.

[0043] Dichloroacetic acid solution can be stored in glass, plastic, or metal containers. Plastic containers can be made of polyethylene or polypropylene, while metal containers can be made of SUS or Hastelloy.

[0044] It can preserve oxidizing solutions in an air atmosphere or an inactive gas atmosphere. As an inactive gas, it can use argon, nitrogen, carbon dioxide or helium.

[0045] As a nucleic acid compound having a protecting group at the 5' position hydroxyl group, the nucleic acid compound of the aforementioned formula (1) can be exemplified. As a nucleic acid compound generated by reacting a dichloroacetic acid solution, the nucleic acid compound of the aforementioned formula (2) can be exemplified.

[0046] In the aforementioned formulas (1) and (2), as compounds that present the same or different from each other and are independent of each other, such as methylene, ethylene, or ethionyl groups bonded to the carbon atom at the 4' position of the ribose, specifically, the structures shown in formula (7) LNA-1, LNA-2, or LNA-3 can be cited.

[0047] [Chemical Formula 10] (In the formula, B) a (Indicates the nucleic acid bases that can be protected) As shown in Z, a group having a structure consisting of a solid support and a linking group that connects the solid support to the oxygen atom of the 2' or 3' position of the hydroxyl group of the 3' end of the ribose of the nucleic acid oligomer, more specifically, the structure shown in the following formula (8) can be cited.

[0048] [Chemical Formula 11] In equation (8), Sp represents the spacer basis.

[0049] As a spacer group (Sp), for example, a group having the structure shown in formula (9) can be exemplified.

[0050] [Chemical Formula 12] The linker can be, for example, the structure shown in formula (10) below, or a structure of formula (10) without the hexamethylene amino group moiety, or an aminopropyl group bonded to Si. Alternatively, the linker can also be the structure shown in formula (11) below.

[0051] [Chemical Formula 13] (In the formula, A can be any of hydroxyl, alkoxy, or alkyl. Examples of alkoxy groups include methoxy and ethoxy. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl. (This represents the oxygen bond between Si and the hydroxyl groups on the support surface.) Examples of solid supports include inorganic porous supports and organic resin supports. For example, controlled porous glass (CPG) is an example of an inorganic porous support. For example, supports made of polystyrene are examples of organic resin supports.

[0052] Examples of nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomers used in this invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA and the aforementioned LNA, but the aforementioned nucleosides are not limited thereto.

[0053] The synthesis of nucleic acid oligomers using a solid-phase synthesis method that includes the aforementioned deprotection step based on dichloroacetic acid solution typically includes the following steps.

[0054] (1) A process for deprotecting the 5' hydroxyl group of a nucleoside whose hydroxyl group is bonded to a solid support via a linker; (2) The process of coupling the 5'-hydroxyl group generated in the aforementioned process with the phosphoramidite compound to obtain the phosphite triester compound; (3) The process of oxidizing the triphosphite generated in the aforementioned process into triphosphate to produce extended nucleic acid molecules, or any process of converting it into trithiophosphate; (4) A process of synthesizing nucleic acid molecules on a solid support by repeatedly performing the aforementioned steps (1) to (3) an arbitrary number of times, namely, the deprotection step of the 5'-hydroxyl group of the generated nucleic acid molecule, the coupling step of the 5'-hydroxyl group with the amide compound, and the oxidation step of the generated triphosphite; and (5) The nucleic acid molecules on the solid support generated in step (4) are provided for the process of cleavage and deprotection, so that they are freed from the solid support and the process of manufacturing nucleic acid oligomers with the protective groups removed.

[0055] In the aforementioned method for synthesizing nucleic acid oligomers, after step (2) or (3), a step of capping the 5' hydroxyl group that has not undergone coupling reaction with the phosphoramidite compound may be included, or a capping step may be added between any steps in a cycle of reactions constituting step (4).

[0056] More specifically, for the aforementioned step (5), the nucleic acid molecules on the solid support generated in step (4) are carried out in the following sequence of reactions (5-1) and (5-2), and then fed into the reaction of step (5-3). Here, the implementation of the reaction in step (5-1) can be arbitrary, and the implementation of the reaction in step (5-2) can also use the method described in Japanese Patent No. 4705716. As a result, it is possible to produce nucleic acid oligomers that are free from the solid support and whose protecting groups have been removed from the nucleic acid molecules, or nucleic acid oligomers with 5'-terminal hydroxyl groups protected.

[0057] (5-1) A reaction to remove the protecting group of the 5' terminal hydroxyl group of a nucleic acid molecule; (5-2) The reaction of cleaving nucleic acid molecules from a solid support and releasing them into their free state; and (5-3) Deprotection reaction of the protecting group of the 3'-position of the 2' or 3' end of the ribose that constitutes the nucleic acid molecule.

[0058] Figure 1 The route of the aforementioned processes (1) to (5) is shown in the figure. Figure 1 The deprotection reaction in step (1) or step (4) shown is carried out using the aforementioned dichloroacetic acid solution. The definitions of substituents in the chemical formulas in route A are the same as those defined above.

[0059] The nucleic acid compound of formula (1) can be further extended to any chain length using amide method with nucleotide or non-nucleotide linkers and used to manufacture the nucleic acid compound shown in formula (3). After cleaving the nucleic acid compound bonded to the solid support of formula (3) to obtain the nucleic acid oligomer shown in formula (4), deprotection can be performed to obtain the nucleic acid oligomer shown in formula (5). Hereinafter, the substituents in each formula will be described in further detail.

[0060] B a The nucleic acid bases and B shown are protected by the protecting group. c The nucleic acid base shown is not particularly limited. Examples of such nucleic acid bases include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. Furthermore, the nucleic acid base can also be substituted with substituents. Examples of such substituents include halogen atoms such as fluorine, chloro, bromine, and iodo, acyl groups such as acetyl, alkyl groups such as methyl and ethyl, aralkyl groups such as benzyl, alkoxy groups such as methoxy, alkoxyalkyl groups such as methoxyethyl, cyanoalkyl groups such as cyanoethyl, hydroxyl, hydroxyalkyl, acyloxymethyl, amino, monoalkylamino, dialkylamino, carboxyl, cyano, and nitro, as well as combinations of two or more of the above substituents.

[0061] As B a The protecting groups shown are not particularly limited to the nucleic acid bases that can be protected by the protecting groups. Any protecting groups known in nucleic acid chemistry can be used as such protecting groups. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, 4-methylbenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, as well as combinations of two or more of the above protecting groups.

[0062] More specifically, B a Represents any of the groups shown in the following formulas.

[0063] [Chemical Formula 14] (In the above formula, R 4 This indicates a hydrogen atom, methyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, phenylacetyl, acetyl, or benzoyl. R 5 Represents a hydrogen atom, acetyl group, isobutyryl group, or benzoyl group. R 6 Represents a hydrogen atom, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, phenylacetyl, acetyl, or isobutyryl. R 7 It represents 2-cyanoethyl. R 8 This represents a hydrogen atom, methyl, benzoyl, 4-methoxybenzoyl, or 4-methylbenzoyl, and R 9 (This represents dimethylaminomethylene.) As B c More specifically, examples from B above can be cited. a Specific examples include groups with the protecting group removed.

[0064] G 5 The following groups are preferred.

[0065] [Chemical Formula 15] (In the formula, R 1 R 2 and R 3 They may be the same or different from each other, each independently representing a hydrogen atom or an alkoxy group. R 1 R 2and R 3 Preferably, one atom is a hydrogen atom, and the remaining two are alkoxy groups that are the same or different from each other (preferably the same). As an alkoxy group, a methoxy group is particularly preferred. More preferably, G... 5 It is 4,4'-dimethoxytriphenylmethyl (DMTr).

[0066] As G 2 As long as it can function as a protecting group for the hydroxyl group, it can be used without particular restrictions, and known protecting groups used in amide compounds can be widely used. As G 2 Examples include alkyl, alkenyl, alkynyl, cycloalkyl, haloalkyl, aryl, heteroaryl, aralkyl, cycloalkenyl, cycloalkylalkyl, cycloalkylyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, heterocyclic alkenyl, heterocyclic alkyl, heteroarylalkyl, silyl, siloxyalkyl, monoalkyl silyl, dialkyl silyl or trialkyl silyl, monoalkyl siloxyalkyl, dialkyl siloxyalkyl or trialkyl siloxyalkyl, etc., which can be substituted with one or more electron-withdrawing groups.

[0067] G 2 Preferably, the alkyl group has been substituted with an electron-withdrawing group. Examples of such electron-withdrawing groups include cyano, nitro, alkylsulfonyl, halogen, arylsulfonyl, trihalomethyl, and trialkylamino, with cyano being the most preferred.

[0068] As G 2 The following groups are particularly preferred.

[0069] [Chemical Formula 16] The aforementioned R 1 R 2 R 3 and G 2 The alkyl group defined herein can be either straight-chain or branched, preferably an alkyl group having 1 to 12 carbon atoms, and more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. The alkyl moiety constituting the alkoxy group in the aforementioned definition of substituents has the same definition as that of the alkyl group herein.

[0070] Furthermore, in the method of the present invention, the amide compound can be used in a free state or a salt state. Examples of salts for the amide compound include base addition salts and acid addition salts, without particular limitation. Specifically, examples of base addition salts include salts formed with inorganic bases such as sodium, magnesium, potassium, calcium, and aluminum salts; salts formed with organic bases such as methylamine, ethylamine, and ethanolamine; salts formed with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specifically, examples of acid addition salts include inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amide compound also includes salts, hydrates, solvates, and polymorphs.

[0071] R preferably represents a protected hydroxyl group. The protecting group when R represents a protected hydroxyl group, or the protecting group of the hydroxyl group indicated by V, can be used as long as it is usable in the amide process. For example, groups described in 2'-tert-butyldimethylsilyl (TBS), 2'-bis(2-acetoxy)methyl (ACE), 2'-(triisopropylsilyloxy)methyl (TOM), 2'-(2-cyanoethoxy)ethyl (CEE), 2'-(2-cyanoethoxy)methyl (CEM), 2'-p-toluenesulfonylethoxymethyl (TEM), 2'-EMM (International Publication No. 2006 / 022323), and International Publication Nos. 2013 / 027843 and 2019 / 208571 are acceptable. V is preferably 2'-tert-butyldimethylsilyl (TBS). Furthermore, in cases where the nucleic acid oligomer produced using the method of the present invention is ribonucleic acid (RNA), or where the nucleic acid oligomer contains ribose, the protecting group shown in the aforementioned formula (6) can be used as a preferred protecting group as the hydroxyl group at the 2' position of the ribose. A further preferred example is a protecting group having a cyano group as the E... W The electron-withdrawing group shown is the protecting group represented by formula (12).

[0072] [Chemical Formula 17] (In the formula, q, R a and R b Same as the definition in equation (6) above. Further preferred examples show that in the group represented by formula (12), q is 1 and R is 1. a and R b It is also a group that contains hydrogen atoms.

[0073] The protecting group shown in formula (12) can be synthesized in accordance with, for example, the descriptions in International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571, and the amide compound having the protecting group can be used in the manufacture of nucleic acid compounds.

[0074] In nucleic acid extension reactions, the following methods are used: Figure 1 The amide compound of formula (13) described in route A.

[0075] As non-nucleotide linkers, linkers comprising an amino acid backbone can be exemplified (e.g., linkers comprising an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specifically, as a non-limiting example, linkers represented by formulas (A14-1), (A14-2), or (A14-3) (e.g., described in International Publication No. 2019 / 074110) can be exemplified. In addition to these linkers, linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 can be exemplified.

[0076] [Chemical Formula 18] (In the formula, Y is the same as before.) Nucleotides and amides in which the R group in formula (13) and the R' group in formula (5) are substituents other than hydroxyl groups can also be manufactured by nucleosides synthesized using known methods described in Japanese Patent No. 3745226, International Publication No. 2001 / 053528, or Japanese Unexamined Patent Application No. 2014-221817 and the known methods cited therein. In addition, substances that are commercially available can be used to manufacture them based on the methods described in the examples described below or by using methods with appropriate modifications to these methods.

[0077] G 4 This refers to a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups for alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl; more specifically, examples include diethylammonium ions, triethylammonium ions, tetrabutylammonium ions, hexylammonium ions, and dibutylammonium ions. Specific examples of hydroxyalkylammonium ions for hydroxyalkyl groups include hydroxymethyl, hydroxyethyl, hydroxyn-propyl, hydroxyisopropyl, hydroxyn-butyl, and trihydroxymethyl; more specifically, examples include trihydroxymethylammonium ions.4 The preferred representation is a hydrogen atom.

[0078] G 5 A protecting group representing a hydrogen atom or the aforementioned hydroxyl group, where a protecting group is indicated, G 1 It also indicates the same protecting base. G 5 In the case of deprotection, the nucleotides are hydrogen atoms, and in this case, the nucleotide compounds are also used in a series of nucleic acid extension reactions.

[0079] Y is preferably an oxygen atom.

[0080] W1 and X1 are preferred to represent OZ-based and R-based.

[0081] W2 and X2 are preferred, with W2 representing a hydroxyl group and X2 representing an R group.

[0082] W3 and X3 preferably represent hydroxyl groups independently, respectively.

[0083] R' is preferably a hydroxyl group.

[0084] Regarding the synthesis of nucleic acid compounds using the amide method described in steps (1) to (5) above, Figure 1 Apart from the deprotection step of step (1) or step (5) in the route, the nucleic acid extension reaction can be performed according to a generally known method (e.g., the method described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step will be described below.

[0085] (Nucleic acid extension reaction) In this specification, "nucleic acid extension reaction" refers to the reaction in which oligonucleotides are extended by sequentially bonding nucleotides through phosphodiester bonds. The nucleic acid extension reaction can be carried out following the usual phosphorus amide process. Alternatively, it can be performed using automated nucleic acid synthesis apparatus employing the phosphorus amide process.

[0086] The chain length of nucleic acid oligomers can be, for example, 20 mere or more (i.e., n≥19), 40 mere or more (i.e., n≥39), 50 mere or more (i.e., n≥49), 60 mere or more (i.e., n≥59), 80 mere or more (i.e., n≥79), 100 mere or more (i.e., n≥99), 2~200 mere (i.e., 1≤n≤199), 10~150 mere (i.e., 9≤n≤149), or 15~110 mere (i.e., 14≤n≤109).

[0087] The deprotection step in step (1) is a step of deprotecting the 5' hydroxyl protecting group at the end of the oligonucleotide chain supported on the solid phase support. Common protecting groups include 4,4'-dimethoxytriphenylmethyl (DMTr), 4-monomethoxytriphenylmethyl, and 4,4',4”-trimethoxytriphenylmethyl. Deprotection can be performed using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0088] The condensation process in process (2) is to make Figure 1 The reaction described in Route A, using the nucleoside phosphoramidol of formula (13), involves bonding the 5' hydroxyl group at the end of an oligonucleotide chain that has undergone the aforementioned deprotection process. It should be noted that the phosphoramidol used in nucleic acid extension is an amide compound represented by formula (13) or (A9) to (A12). Other usable phosphoramidols include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, and 2'-fluoro-2'-deoxy-β-D-arasofuranyl. The aforementioned nucleoside phosphoramidol is a nucleoside phosphoramidol with its 5' hydroxyl group protected (e.g., a DMTr group). The condensation process can be performed using an activator or condensing agent that activates the aforementioned nucleoside phosphoramidol. Examples of activators or condensing agents include 5-benzylthio-1H-tetrazazole (BTT) (also known as 5-benzylmercapto-1H-tetrazazole), 1H-tetrazazole, 4,5-dicyanimidazazole (DCI), 5-ethylthio-1H-tetrazazole (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazazole.

[0089] Figure 1 The nucleoside phosphoramidide (hereinafter referred to as amide) shown in formula (13) recorded in route A refers to the following.

[0090] The compound shown in formula (13).

[0091] [Chemical Formula 19] (In the formula, G 1 G 2 G 3 B a And R is the same as described above. After the condensation step, the unreacted 5' hydroxyl group can also be capped. Capping can be performed using known capping solutions such as acetic anhydride-tetrahydrofuran solution or phenoxyacetic anhydride / N-methylimidazole solution.

[0092] The oxidation step in step (3) is a step of converting the phosphorous acid group formed by the aforementioned condensation step into a phosphoric acid group or a thiophosphate group. This step is a reaction that uses an oxidant to convert trivalent phosphorus into pentavalent phosphorus, which can be carried out by reacting the oxidant with an oligonucleotide derivative supported on a solid phase carrier.

[0093] When converting phosphite groups to phosphate groups, iodine can be used as an "oxidizing agent," for example. This oxidizing agent can be prepared and used at a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazolium (NMI), N-methylmorpholine, or triethylamine can be used as the base for carrying out the reaction. Furthermore, there are no particular limitations on the solvent, as long as it does not participate in the reaction; acetonitrile, tetrahydrofuran (THF), or mixtures thereof in any proportion can be used. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is typically suitable to be 1 minute to 30 minutes. The amount of reagent used relative to 1 mol of the compound supported on the solid phase is preferably 1 to 100 mol, more preferably 1 to 10 mol.

[0094] In the case of converting the phosphite triester group to the thiophosphate triester group, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazoline-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazoline-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used as "oxidizing agents". These oxidizing agents can be diluted with a suitable solvent to a concentration of 0.001 to 2 M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction; examples include dichloromethane, acetonitrile, pyridine, or mixtures thereof in any proportion. The oxidation step can be performed after the aforementioned capping operation, or vice versa; the order is not limited.

[0095] In step (5-1), for the protecting group of the 5' hydroxyl group of the nucleotide introduced at the end of the extension, the column purification tagged with the protecting group of the 5' hydroxyl group can be carried out after the cleavage from the solid support and the deprotection of the protecting group described later. The protecting group of the 5' hydroxyl group can be deprotected after column purification.

[0096] In step (5-2), the step of deprotecting the phosphate protecting group involves, after the synthesis of the nucleic acid having the desired sequence is completed, using an amine compound to deprotect the phosphate protecting group. Examples of amine compounds include diethylamine as described in Japanese Patent No. 4705716.

[0097] For the excision of nucleic acid oligomers from the solid support in step (5-2), which are formed by extending the chain to the desired length on the solid support, concentrated ammonia is usually used as the excision agent.

[0098] Further methods include using ammonia or amine compounds to cleave the oligonucleotide chain from the solid support and recover it. Examples of amine compounds include methylamine, ethylamine, isopropylamine, ethylenediamine, or diethylamine.

[0099] In step (5-3), the protecting group of the 2' or 3' hydroxyl group of the ribose of the nucleic acid compound (4) excised from the solid support in step (5-2) can be removed in accordance with the methods described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571, thereby obtaining the deprotected nucleic acid oligomer (5).

[0100] Nucleic acid oligomers that can be manufactured using the manufacturing method of the present invention include, but are not limited to, nucleic acid oligomers containing nucleosides of RNA, DNA, and RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. Examples include, for instance, various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid oligomers manufactured using the method of the present invention are of RNA.

[0101] Typical examples of nucleic acid oligomers that can be used in the manufacturing method of the present invention are shown below in addition to the examples described in the embodiments, but are not limited thereto.

[0102] In the following sequence descriptions, U represents uridine, C represents cytidine, A represents adenosine, or G represents guanosine.

[0103] Examples of such examples include nucleic acid oligomers having the sequences (A) and (B) described in International Publication No. 2019 / 060442.

[0104] Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antonym) (Sequence No. 1) 21mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Justice) (Sequence Number 2) 21mer In sequences (A) and (B), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine.

[0105] Nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553), can be cited as examples. A typical example is a nucleic acid oligomer having the following sequence (C).

[0106] Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (Sequence number 3) 36mer Nucleic acid oligomers described in Japanese Patent No. 4965745 can be cited as an example. As a typical example, a nucleic acid oligomer having the following sequence (D) can be cited.

[0107] Sequence (D): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' (Sequence number 4, 5) 49mer In sequence (D), “P” is represented by the local structure divided by wavy lines in the following equation (A5).

[0108] It should be noted that sequence number 4 in the sequence listing represents the base sequence of the following sequence (D1) from the 5' end of sequence (D) to before "P", and sequence number 5 represents the base sequence of the following sequence (D2) from after "P" of sequence (D) to the 3' end.

[0109] Sequence (D1): 5'-CCAUGAGAAGUAUGACAACAGCC-3' (Sequence No. 4) 23mer Sequence (D2): 5'-GGCUGUUGUCAUACUUCUCAUGGUU-3' (Sequence number 5) 25mer Nucleic acid oligomers with the following sequence (E) can be cited as an example in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547.

[0110] Sequence (E): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (Sequence No. 6) 67mer Examples of such examples include the nucleic acid oligomers with the following sequence (F) described in Japanese Patent Publication No. 2015-523856, page 173.

[0111] Sequence (F): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (Sequence Number 7) 94mer Nucleic acid oligomers described in Japanese Patent Publication No. 2017-537626 can be cited as examples. As typical examples, nucleic acid oligomers having the following sequences (G), (H), (I), and (J) can be cited.

[0112] Sequence (G): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (Sequence No. 8) 100mer Sequence (H): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (Sequence number 9) 113mer Sequence (I): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCUUUUUUU-3' (serial number 10) 113mer In sequence (I), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.

[0113] Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (Sequence No. 11) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents thiophosphate modification.

[0114] Example The present invention will be further described in detail below with reference to embodiments, but the present invention is not limited thereto.

[0115] <Determination Method> First, the various measurement methods used in the following experiments are shown below.

[0116] Oligonucleotide purity was determined using HPLC.

[0117] The HPLC determination conditions are shown in Table 1 below.

[0118] (Method 1: Determination of oligonucleotide purity) [Table 1] (Method 2: Determination of oligonucleotide yield) Determination of OD of crude product 260 OD 260 This represents the absorbance at UV260 nm per 10 mm optical path length in 1 mL of solution (pH=7.5). Typically, it is known that 1 OD = 40 μg in RNA, therefore, the absorbance can be calculated based on the aforementioned OD values. 260 The measured value is used to calculate the yield.

[0119] (Method 3: Determination of formaldehyde concentration) Methods for determining formaldehyde concentration in dichloroacetic acid solution include gas chromatography (GC) or high-performance liquid chromatography (HPLC). In GC, the concentration is calculated by direct analysis of formaldehyde. In HPLC, formaldehyde is reacted with acetylacetone, and the amount of 3,5-diacetyl-1,4-dihydrodimethylpyridine obtained is measured to calculate the formaldehyde concentration.

[0120] <Preparation of dichloroacetic acid solution> The dichloroacetic acid solutions with different formaldehyde concentrations used in the following experiments were prepared by first preparing a dichloroacetic acid solution with a low formaldehyde concentration and then adding an aqueous formaldehyde solution to the resulting dichloroacetic acid solution.

[0121] Solid-phase synthesis of oligonucleotides Sequence (I): 5'-GGCACCGAGUCGGUGCUUUU-3' (Sequence No. 12) 20mer Sequence (II): 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (Sequence No. 13) 50mer Sequence (III): 5'-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (Sequence No. 14) 100mer In the aforementioned sequences (I), (II), and (III), “A” is represented by a local structure divided by wavy lines in the following equation (A1). “C” is represented by a local structure divided by wavy lines in the following equation (A2). “G” is represented by a local structure divided by wavy lines in the following equation (A3). “U” is represented by a local structure divided by wavy lines in the following equation (A4). It should be noted that “U” at the end of 3’ is represented by a local structure divided by wavy lines in the following equation (A8). In addition, in sequence (I), “G” at the end of 5’ is represented by a local structure divided by wavy lines in the following equation (A6), and in sequences (II) and (III), “A” at the end of 5’ is represented by a local structure divided by wavy lines in the following equation (A7).

[0122] [Chemical Formula 20] [Chemical Formula 21] [Chemical Formula 22] [Chemical Formula 23] [Chemical Formula 24] [Chemical Formula 25] [Chemical Formula 26] [Chemical Formula 27] Controlled porous glass (CPG) was used as the solid-phase support. An NTS M-4MX-E (manufactured by Nihon Techno Service) was used as the nucleic acid synthesizer. Oligonucleotides consisting of the aforementioned sequences (I), (II), and (III) were synthesized from the 3' side to the 5' side using a phosphorous amide solid-phase synthesis method. The synthesis was carried out at a scale of approximately 1 μmol. Furthermore, uridine EMMamide (A11) described in Example 2 of US2012 / 0035246, cytidine EMMamide (A9) described in Example 3, adenosine EMMamide (A12) described in Example 4, and guanosine EMMamide (A10) described in Example 5 were used in the synthesis. A 3% dichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, iodine solution was used as the oxidizing agent, and phenoxyacetic anhydride solution and N-methylimidazole solution were used as the capping solutions.

[0123] [Chemical Formula 28] [Chemical Formula 29] [Chemical Formula 30] [Chemical Formula 31] Next, specific manufacturing examples of oligonucleotides (nucleic acid oligomers) produced using the method of the present invention are shown. Here, the oligonucleotides produced using the method of the present invention in the following examples are oligonucleotides having the aforementioned sequences (I), (II), and (III).

[0124] Furthermore, the guanosine derivatives described in the following examples and comparative examples refer to the compounds shown in the following structural formulas. The circles in the diagrams below schematically represent CPG.

[0125] [Chemical Formula 32] (Example 1) Using a controllable porous glass (CPG) loaded with 0.98 μmol of uridine derivative, and an amide shown in formulas (A9), (A10), (A11), or (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3' side to the 5' side using an NTS M-4MX-E (manufactured by Nihon Techno Service). For the automated synthesis step, firstly, a 3% dichloroacetic acid toluene solution was added to the CPG to deprotect the triphenylmethyl protecting group at the 5' position. At this point, the formaldehyde concentration in the dichloroacetic acid solution used could be determined using determination method 3, and the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) was 43 × 10⁻⁶. -7 Next, various amides and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to CPG for coupling with the 5' hydroxyl group. Then, an oxidizing solution containing 50 mM iodine was added to convert the phosphite group to a phosphate group. Next, a capping solution of 0.1 M phenoxyacetic anhydride acetonitrile and 10% N-methylimidazolium / 10% 2,6-dimethylpyridine acetonitrile was used as a capping solution to cap the uncoupled reaction site. These steps were repeated a total of 19 times. The protecting group (DMTr group) at the 5' end was deprotected with 3% dichloroacetic acid toluene solution, thereby synthesizing the nucleic acid oligonucleotide with the sequence shown in (I) on the CPG support. Then, 1.5 mL of 28% ammonia and 0.5 mL of ethanol were added to the CPG support carrying 0.98 μmol of the oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid oligomer from the solid support. The solvent was then removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, followed by the addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stir bar. The mixture was then stirred at room temperature and 2.08 mL of a 1M tetrabutylammonium fluoride (TBAF) dimethyl sulfoxide solution (dehydrated using molecular sieve 4A) was added. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the oligonucleotide was determined using the method described in Method 1 above, and the purity was 76.2%. The yield of the oligonucleotide was determined using the method described in Method 2 above, and the yield was 4032 μg, which is equivalent to 4114 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0126] (Example 2) In the experiment of Example 1, controllable porous glass (CPG) loaded with 1.02 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 90 × 10⁻⁶. -6 The nucleic acid oligomer of sequence (I) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 75.0%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 4147 μg, which is equivalent to 4066 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0127] (See Example 1 for reference) In the experiment of Example 1, controllable porous glass (CPG) loaded with 1.03 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 20 × 10⁻⁶. -5 The nucleic acid oligomer of sequence (I) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 73.8%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 3979 μg, which is equivalent to 3863 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0128] (Example 3) Using a controllable porous glass (CPG) loaded with 1.03 μmol of uridine derivative, and an amide shown in formulas (A9), (A10), (A11), or (A12), the nucleic acid oligomer shown in sequence (II) was automatically synthesized from the 3' side to the 5' side using an NTS M-4MX-E (manufactured by Nihon Techno Service). For the automated synthesis step, firstly, a 3% dichloroacetic acid toluene solution was added to the CPG to deprotect the triphenylmethyl protecting group at the 5' position. At this point, the formaldehyde concentration in the dichloroacetic acid solution used could be determined using determination method 3, and the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) was 43 × 10⁻⁶. -7Next, various amides and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to CPG for coupling with the 5' hydroxyl group. Then, an oxidizing solution containing 50 mM iodine was added to convert the phosphite group to a phosphate group. Next, a capping solution of 0.1 M phenoxyacetic anhydride acetonitrile and 10% N-methylimidazolium / 10% 2,6-dimethylpyridine acetonitrile was used as a capping solution to cap the uncoupled reaction site. These steps were repeated a total of 49 times. The protecting group (DMTr group) at the 5' end was deprotected with 3% dichloroacetic acid toluene solution, thereby synthesizing the nucleic acid oligonucleotide of sequence (II) on the CPG support. Then, 1.5 mL of 28% ammonia and 0.5 mL of ethanol were added to the CPG support carrying 1.03 μmol of the oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid oligomer from the solid support. The solvent was then removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, followed by the addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stir bar. The mixture was then stirred at room temperature and 2.08 mL of a 1M tetrabutylammonium fluoride (TBAF) dimethyl sulfoxide solution (dehydrated using molecular sieve 4A) was added. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the oligonucleotide was determined using the method described in Method 1 above, and the purity was 50.8%. The yield of the oligonucleotide was determined using the method described in Method 2 above, and the yield was 9156 μg, which translates to 8889 μg per 1.00 μmol of uridine derivative-loaded CPG. The results are shown in Table 2.

[0129] (Example 4) In the experiment of Example 3, controllable porous glass (CPG) loaded with 1.05 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 90 × 10⁻⁶. -6 The nucleic acid oligomer of sequence (II) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 47.8%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 9378 μg, which is equivalent to 8931 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0130] (See Example 2 for reference) In the experiment of Example 3, controllable porous glass (CPG) loaded with 1.05 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 20 × 10⁻⁶. -5 The nucleic acid oligomer of sequence (II) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 42.8%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 9307 μg, which is equivalent to 8864 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0131] (Example 5) Using a controllable porous glass (CPG) loaded with 0.99 μmol of uridine derivative, and an amide shown in formulas (A9), (A10), (A11), or (A12), the nucleic acid oligomer shown in sequence (III) was automatically synthesized from the 3' side to the 5' side using an NTS M-4MX-E (manufactured by Nihon Techno Service). For the automated synthesis step, firstly, a 3% dichloroacetic acid toluene solution was added to the CPG to deprotect the triphenylmethyl protecting group at the 5' position. At this point, the formaldehyde concentration in the dichloroacetic acid solution used could be determined using determination method 3, and the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) was 43 × 10⁻⁶. -7Next, various amides and 5-benzylmercapto-1H-tetrazole as a condensing agent were added to CPG for coupling with the hydroxyl group at the 5' position. Then, an oxidizing solution containing 50 mM iodine was added to convert the phosphite group to a phosphate group. Next, a capping solution of 0.1 M phenoxyacetic anhydride acetonitrile and 10% N-methylimidazolium / 10% 2,6-dimethylpyridine acetonitrile was used as a capping solution to cap the uncoupled reaction site. These steps were repeated a total of 99 times. The protecting group (DMTr group) at the 5' end was deprotected with 3% dichloroacetic acid toluene solution, thereby synthesizing the nucleic acid oligonucleotide of sequence (III) on the CPG support. Then, 1.5 mL of 28% ammonia and 0.5 mL of ethanol were added to the CPG support carrying 1.03 μmol of the oligonucleotide, and the mixture was incubated at 40°C for 4 hours to release the nucleic acid oligomer from the solid support. The solvent was then removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, followed by the addition of 1.0 mL of acetonitrile, 20 μL of nitromethane, and a stir bar. The mixture was then stirred at room temperature with 2.08 mL of a 1M tetrabutylammonium fluoride (TBAF) dimethyl sulfoxide solution dehydrated using molecular sieve 4A. The mixture was incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The nucleic acid oligomer product was then obtained by precipitation. The purity of the oligonucleotide was determined using the method described in Method 1 above, and the purity was 33.1%. The yield of the oligonucleotide was determined using the method described in Method 2 above, and the yield was 12889 μg, which is equivalent to 13019 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0132] (Example 6) In the experiment of Example 5, controllable porous glass (CPG) loaded with 1.04 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 90 × 10⁻⁶. -6 The nucleic acid oligomer of sequence (III) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 29.7%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 13375 μg, which is equivalent to 12861 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0133] (See Example 3 for reference) In the experiment of Example 5, controllable porous glass (CPG) loaded with 0.99 μmol of uridine derivative was used, and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 20 × 10⁻⁶. -5 The nucleic acid oligomer of sequence (III) was obtained by the same method except for the 3% dichloroacetic acid toluene solution. The purity of the oligonucleotide was determined by the method described in Method 1 above, and the purity of the product was 26.4%. In addition, the yield of the oligonucleotide was determined by the method described in Method 2 above, and the yield was 12675 μg, which is equivalent to 12803 μg of CPG loaded with 1.00 μmol of uridine derivative. The results are shown in Table 2.

[0134] (Example 7) The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 25 × 10⁻⁶. -5 30g of dichloroacetic acid solution was mixed with 300mL of toluene. The toluene and formaldehyde were then subjected to azeotropic distillation at 40℃ using an evaporator to obtain 34g of a pale yellow, oily dichloroacetic acid solution. The formaldehyde content in the obtained dichloroacetic acid solution was analyzed using the method described in Method 3. The molar ratio of formaldehyde to dichloroacetic acid was found to be 43 × 10⁻⁶. -7 .

[0135] [Table 2] Based on the results in Table 2 above, compared with the use of dichloroacetic acid solutions from Reference Examples 1, 2 and 3, nucleic acid oligomers can be obtained in high yield when using the dichloroacetic acid solution of the present invention with a formaldehyde concentration of a certain or lower.

[0136] Industrial availability This invention provides an efficient method for manufacturing nucleic acid oligomers. Furthermore, it is expected that the yield of nucleic acid oligomers manufactured according to this method will be improved.

[0137] [Sequence List Free Text] Sequence numbers 1 to 14 in the sequence listing represent the base sequences of oligonucleotides manufactured according to the manufacturing method of the present invention.

Claims

1. A method for manufacturing the nucleic acid oligomer shown in formula (2), comprising a step of reacting the nucleic acid oligomer shown in formula (1) with a dichloroacetic acid solution containing dichloroacetic acid, toluene, and formaldehyde, wherein the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) is 90 × 10⁻⁶. -6 Hereinafter, the nucleic acid oligomers referred to are oligomers with a chain length of 40 or more. In equation (1), G 2 express The groups shown, B a Whether they are the same or different, each independently represents a nucleic acid base that can be protected by a protecting group. R 1 R 2 and R 3 They may be the same or different from each other, each independently representing a hydrogen atom or a methoxy group. R may be the same or different from each other, each independently representing a protected hydroxyl, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group. Q' may be the same as or different from each other, each independently representing a methylene group bonded to the carbon atom at the 4' position of the ribose, an ethylene group bonded to the carbon atom at the 4' position of the ribose, or an ethimide group bonded to the carbon atom at the 4' position of the ribose. Y can be the same or different from each other, each independently representing an oxygen atom or a sulfur atom. n represents any integer from 1 to 200. W1 represents the OZ base and X1 represents the R base, or W1 represents the OV base and X1 represents the OZ base. V represents the protecting group for the hydroxyl group. Z is a group having a structure consisting of a solid support and a linking group. Furthermore, when n is an integer greater than 2, non-nucleotide linkers can be inserted between the nucleotides of the nucleic acid oligomer shown in equation (1); In equation (2), G 2 B a R, Y, X1, W1, and n are the same as described above, and Nonnucleotide linkers can be incorporated between nucleotides in the manner defined in equation (1).

2. A method for manufacturing the nucleic acid oligomer shown in formula (2'), comprising the following steps: The process described in claim 1; A further step is to remove the group represented by Z from the nucleic acid oligomer of formula (2) generated in this process; and The process of removing hydroxyl groups and protecting groups from nucleic acid bases. In equation (2'), Y and n are the same as described above. B c They may be the same or different from each other, each independently representing a nucleic acid base. G 4 They may be the same or different from each other, each independently representing a hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion. R' may be the same or different from each other, each independently representing a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' is the same as above. X3 and W3 each independently represent a hydroxyl group, or X3 represents the R' group and W3 represents the hydroxyl group.

3. The manufacturing method as described in claim 1, further comprising the following steps: The process of obtaining the nucleic acid compound represented by formula (3), wherein the nucleic acid compound represented by formula (3) is obtained by arbitrarily extending the chain length of the nucleic acid oligomer represented by formula (2) using an amide method; and The process of cleaving the compound shown in formula (3) to obtain the compound shown in formula (4), and further deprotecting the compound shown in formula (4) to produce the nucleic acid oligomer shown in formula (5) In equation (3), G 2 B a R, Y, X1, and W1 are the same as described above. G 5 The protecting group or hydrogen atom of the hydroxyl group shown in the following formula is represented. R 1 R 2 and R 3 As mentioned above, m is an integer that satisfies m≥n; In equation (4), G 5 R, Y, and m are the same as described above. G 4 They may be the same or different from each other, each independently representing a hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion. B C They may be the same or different from each other, each independently representing a nucleic acid base. X2 represents a hydroxyl group and W2 represents an OV group, or X2 represents the R group and W2 represents the hydroxyl group. V represents the protecting group of the hydroxyl group; In equation (5), G 4 B c Y and m are the same as described above. R' may be the same or different from each other, each independently representing a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group. Q' is the same as above. X3 and W3 each independently represent a hydroxyl group, or X3 represents the R' group and W3 represents the hydroxyl group.

4. The manufacturing method according to any one of claims 1 to 3, wherein, Non-nucleotide linkers are linkers that contain an amino acid backbone.

5. The manufacturing method as described in claim 4, wherein, The linker containing the amino acid backbone is a linker having a structure selected from the group consisting of (A14-1), (A14-2), and (A14-3) below. In the formula, Y is the same as described above.

6. The manufacturing method according to any one of claims 1 to 5, wherein, The molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) is 43 × 10⁻⁶. -6 the following.

7. The manufacturing method according to any one of claims 1 to 5, wherein, The molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) is 22 × 10⁻⁶. -6 the following.

8. The manufacturing method according to any one of claims 1 to 7, wherein, Nucleic acid oligomers are ribonucleic acid (RNA).

9. The manufacturing method according to any one of claims 1 to 7, wherein, The nucleic acid oligomer is ribonucleic acid (RNA), and the protecting group at the 2' position of the hydroxyl group of its ribose is the protecting group shown in formula (6). In equation (6), q represents any integer from 1 to 5. R a and R b They may be the same or different from each other, each independently representing a methyl, ethyl, or hydrogen atom. The * symbol indicates the bonding site with the oxygen atom of the hydroxyl group at the 2' position of the ribose, and E W This indicates an electron-withdrawing group.

10. The manufacturing method as described in claim 9, wherein, R a and R b Both are hydrogen atoms and E W It is a cyano group.

11. The manufacturing method according to any one of claims 1 to 10, wherein, Nucleic acid oligomers are oligomers with a chain length of 50 or more.

12. The manufacturing method according to any one of claims 1 to 10, wherein, Nucleic acid oligomers are oligomers with a chain length of 60 or more.

13. The manufacturing method according to any one of claims 1 to 10, wherein, Nucleic acid oligomers are oligomers with a chain length of 80 or more.

14. The manufacturing method according to any one of claims 1 to 10, wherein, Nucleic acid oligomers are oligomers with a chain length of 100 or more.

15. A dichloroacetic acid solution containing dichloroacetic acid, toluene, and formaldehyde, wherein... The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 90 × 10⁻⁶. -6 the following.

16. The dichloroacetic acid solution as described in claim 15, wherein, The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 43 × 10⁻⁶. -6 the following.

17. The dichloroacetic acid solution as described in claim 15, wherein, The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) is 22 × 10⁻⁶. -6 the following.

18. A method for producing a dichloroacetic acid solution according to any one of claims 15 to 17, comprising the following steps: A purified dichloroacetic acid solution is obtained by azeotropic distillation to remove formaldehyde from a solution containing an unpurified dichloroacetic acid solution containing formaldehyde and a solvent that azeotropically reacts with formaldehyde.

19. The manufacturing method as claimed in claim 18, wherein, The boiling point of the azeotropic solvent is below 194°C.

20. The manufacturing method as described in claim 18 or 19, wherein, The azeotropic solvent is dichloromethane, acetonitrile, or an aromatic organic solvent.

21. The manufacturing method as described in claim 20, wherein, The aromatic organic solvent is toluene.

22. A method for manufacturing nucleic acid oligomers, comprising a purification step of the dichloroacetic acid solution as described in claim 18, and a step of using the purified dichloroacetic acid solution obtained in the step as described in any one of claims 1 to 3.

Images