An amphiphilic DNA framework and its preparation method and application

Abstract

The application discloses an amphiphilic DNA framework and a preparation method and application thereof, and the preparation method comprises the following steps: 1) designing a plurality of DNA single strands, performing cholesterol hydrophobic modification on at least one DNA single strand, and arranging a hanging hybridization chain which can be complementary to an oligonucleotide drug base on the DNA single strand; 2) mixing all the DNA single strands in an equal molar ratio, and then adding to an adaptive buffer system to obtain a mixed solution; and 3) performing high-temperature water bath treatment on the mixed solution, and then cooling and standing, so that the amphiphilic DNA framework carrier is obtained through DNA chain self-assembly. According to the amphiphilic DNA framework carrier provided by the application, the drug delivery efficiency reaches the level of commercial transfection reagents, the toxicity is lower, and the application drug types are wide, so that the application has good clinical transformation and industrialization application prospects in the fields of in-vivo and in-vitro delivery of oligonucleotide nucleic acid drugs and disease gene therapy.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid drug delivery, and more specifically to an amphiphilic DNA framework, its preparation method, and its applications. Background Technology

[0002] As is well known, nucleic acid drugs can only exert their regulatory and therapeutic effects by successfully reaching the cytoplasm and acting on their target sites. Improving the cytoplasmic delivery efficiency of nucleic acid drugs can not only effectively optimize therapeutic effects but also reduce the toxic side effects caused by excessive use of carriers and drugs, which is of great value for the practical application of precision medicine. However, the delivery of nucleic acid drugs is always constrained by biological barriers. Nucleic acid macromolecules themselves carry a negative charge, making it difficult to directly penetrate cell membranes with the same electrical charge. Even if they enter the cell through endocytosis, the drugs are often trapped in endosomes and lysosomes and cannot be released into the cytoplasm to exert their effects.

[0003] Currently, researchers have developed several nanocarriers for nucleic acid drug delivery. However, these technologies all have unavoidable drawbacks. One representative strategy involves using cationic nanomaterials that can fuse with and penetrate negatively charged cell membranes, or attaching positively charged ligands to the carrier. While these methods can help the carrier bind and penetrate the cell membrane, most of these cationic ligands or materials are still metabolized and cleared along the endosome-lysosome pathway after entering the cell, resulting in insufficient effective drug concentration in the cytoplasm and limiting efficacy. Another representative strategy utilizes the effects of proton sponges and endosome perforation to achieve lysosomal escape, or modifies the uptake method by modifying special groups (disulfides) to bypass the endosome-lysosome pathway. However, these strategies often damage the cell membrane and endosomes / lysosomes, leading to significant cytotoxicity.

[0004] Current research also applies cholesterol modification to DNA frameworks and uses it in drug delivery. However, these technologies primarily focus on targeted delivery based on ligand-receptor interactions and membrane interface modification. Their core objective is merely to enhance the binding affinity between the carrier and the cell membrane and increase total cellular uptake, without addressing the distribution of the drug within the cell. Practice has shown that simply increasing cellular uptake is far from sufficient; if nucleic acid drugs remain largely trapped in endosomes and lysosomes, they still cannot function effectively.

[0005] Therefore, developing a DNA framework nanocarrier that can efficiently deliver nucleic acid drugs into the cytoplasm and has good biocompatibility remains a pressing technical challenge in the field of nanomedicine. Summary of the Invention

[0006] The purpose of this invention is to provide an amphiphilic DNA framework, its preparation method, and its application, thereby solving the technical problems of low cytoplasmic delivery efficiency of nucleic acid delivery vectors, easy drug retention in endosomes and lysosomes, significant cytotoxicity of some vectors, and traditional cholesterol-modified DNA frameworks that only focus on improving cellular uptake and neglect intracellular delivery effects.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] According to a first aspect of the present invention, a method for preparing an amphiphilic DNA framework vector is provided, comprising the following steps:

[0009] 1) Design multiple DNA single strands, modify at least one DNA single strand with cholesterol hydrophobicity, and set a dangling hybridization strand on the DNA single strand that can be complementary to the bases of the oligonucleotide drug;

[0010] 2) Mix all DNA single strands in an equimolar ratio and add them to the appropriate buffer system to obtain a mixture;

[0011] 3) The mixture is subjected to high-temperature water bath treatment, followed by cooling and standing, and the amphiphilic DNA framework vector is obtained through DNA chain self-assembly.

[0012] Preferably, the cholesterol modification site is located at the 5' end of a single DNA strand, and a single DNA framework vector binds at least one cholesterol molecule.

[0013] Preferably, the pendant hybridization strand extends outside the DNA framework for binding and loading target oligonucleotide drugs via base complementarity.

[0014] Preferably, the buffer system is a weakly alkaline buffer solution containing Tris, acetic acid, EDTA, and magnesium acetate. More preferably, the buffer system contains 40 mM Tris, 20 mM acetic acid, 2 mM EDTA, 12.5 mM magnesium acetate, and pH = 8.

[0015] Preferably, the high-temperature water bath is a boiling water bath, and the cooling and settling process is carried out in a closed environment until the system returns to room temperature and completes self-assembly. More preferably, the mixture obtained in step 2) is placed in a foam box for boiling water bath (100°C). C), and then allow it to cool naturally in a foam box to room temperature for 12 hours to complete the self-assembly of the DNA framework vector.

[0016] Preferably, the main body of the amphiphilic DNA framework carrier is a DNA nanoframework with a rigid three-dimensional structure.

[0017] Preferably, the DNA nanoframework is selected from any one of a six-helix bundle, a tetrahedron, a triangular prism, and a cube. Particularly preferably, the DNA nanoframework is a six-helix bundle.

[0018] The oligonucleotide drug is a therapeutic nucleic acid such as siRNA, miRNA, or antisense oligonucleotide (ASO) that can bind to the amphiphilic DNA framework vector through base complementary pairing, preferably siRNA.

[0019] According to a second aspect of the present invention, an amphiphilic DNA framework vector prepared by the method is provided, wherein the amphiphilic DNA framework vector has both cell membrane binding ability and endosome escape ability, and can mediate the delivery of oligonucleotide drugs into the cell cytoplasm.

[0020] According to a third aspect of the present invention, an amphiphilic DNA framework vector is provided for use in the preparation of oligonucleotide drug delivery formulations.

[0021] According to the present invention, the oligonucleotide drug is a functional nucleic acid that can be used for cell regulation or disease treatment, including siRNA, miRNA, and antisense oligonucleotides. It should be understood that the vector system provided by the present invention is not limited to the delivery of siRNA, but can actually be used for the delivery of a variety of oligonucleotide drugs.

[0022] This invention provides an amphiphilic DNA framework (ADF) vector, which acquires amphiphilic properties by modifying a cholesterol molecule onto a single strand of the DNA framework. The cholesterol structure enhances the binding ability of the vector to the cell membrane lipid bilayer, thereby increasing the overall uptake of the vector by the cell and facilitating the direct transmembrane entry of the vector carrying oligonucleotide drugs into the cell, or enabling efficient escape from endosomes and lysosomes after entry. Ultimately, this significantly increases the effective distribution concentration of oligonucleotide drugs in the cytoplasm, achieving efficient cytoplasmic drug delivery. A pendant hybridization strand is provided on the outer side of the vector, which stably loads various oligonucleotide drugs such as siRNA and antisense oligonucleotides through base complementarity pairing.

[0023] As described in the background section of this invention, existing cholesterol-modified DNA frameworks are mostly used for ligand-receptor-dependent targeted delivery or membrane interface modification, focusing on membrane binding or cellular uptake, while intracellular localization has not been extensively studied. However, numerous studies have shown that even with improved cellular uptake, if the drug is primarily retained in endosomes / lysosomes, its cytoplasmic concentration remains low, resulting in limited therapeutic efficacy. This invention focuses on improving the cytoplasmic delivery efficiency of drug-loaded cells by modifying a single site of the DNA framework with cholesterol, enabling direct transmembrane penetration or escape from endosomes / lysosomes. Furthermore, this invention systematically compares various DNA frameworks with different rigidities, such as hexagonal bundles, tetrahedrons, triangular prisms, and cubes, finding that the hexagonal bundle, with the highest rigidity, exhibits the highest cytoplasmic delivery efficiency after cholesterol modification. This invention achieves dual optimization of uptake and cytoplasmic delivery by modifying a single cholesterol molecule at one end of the hexagonal bundle; this technical approach is not documented in existing cholesterol-modified DNA framework technologies.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] 1) Improved cell internalization performance: Cholesterol modification significantly enhances the binding of the carrier to the cell membrane lipid layer. Compared with tetrahedral, triangular prism and cubic configurations, the six-helix bundle carrier shows a highly significant improvement in cell uptake fluorescence intensity.

[0026] 2) Excellent endosome escape ability: Compared with the commercial transfection reagent Lipofectamine 3000, this vector has a lower degree of colocalization with late endosomes and lysosomes after delivering siRNA, resulting in higher endosome escape efficiency and significantly reducing drug degradation and retention;

[0027] 3) Excellent gene silencing efficacy: Validated using the siEGFP delivery model, this amphiphilic DNA framework vector can achieve gene silencing efficiency similar to that of the commercial transfection reagent Lipofectamine 3000, and its efficacy reaches the level of commercial transfection reagents;

[0028] 4) Better biosafety: It does not require the use of highly toxic cationic materials or endogenous perforation-destructive groups. It relies on the physical properties of its amphiphilic structure to achieve membrane penetration and escape, thus avoiding the risk of strong cytotoxicity.

[0029] 5) Wide range of applications: The vector loading system is not limited to siRNA, but can be adapted to all types of oligonucleotide therapeutic drugs such as miRNA and antisense oligonucleotides, and can be adapted to intracellular drug delivery scenarios for various cells such as tumor cells.

[0030] 6) Stable and controllable assembly process: The entire DNA self-assembly preparation process is simple and mild, the conditions are easy to standardize, the vector assembly has good uniformity, and the morphology and structure are stable.

[0031] In summary, this invention breaks through the traditional research and development approach of existing cholesterol-modified DNA frameworks, abandoning the inherent bias of solely pursuing cellular uptake. It innovatively employs single-site cholesterol modification combined with a highly rigid DNA framework, relying on a unique amphiphilic interaction mechanism to solve the core industry challenges of low cytoplasmic drug delivery efficiency and severe endosomal lysosomal retention. The vector delivers drug efficacy at the level of commercially available transfection reagents, with lower toxicity and broad applicability to various drug types, demonstrating promising clinical translation and industrial application prospects in the in vitro and in vivo delivery of oligonucleotide nucleic acid drugs and gene therapy for diseases. Attached Figure Description

[0032] Figure 1 This is a schematic diagram of the overall structure of the six-helix bundle amphiphilic DNA framework vector according to Embodiment 1 of the present invention, showing the relative positions of the DNA framework body, cholesterol modification sites, and dangling hybridization strands;

[0033] Figure 2 Images of the amphiphilic DNA framework vector prepared in Example 1 before and after loading fluorescently labeled siRNA, and images of the fluorescently labeled siRNA after GelRed staining (left) and fluorescence imaging (right).

[0034] Figure 3 The images are atomic force microscopy (AFM) characterizations of the amphiphilic DNA framework vector prepared in Example 1 before and after loading siRNA, used to observe the morphology of the six-helix bundle amphiphilic DNA framework before and after loading siRNA.

[0035] Figure 4 The images show the cell uptake results of amphiphilic DNA framework vectors with different geometric configurations (hexagonal bundle, tetrahedron, triangular prism and cube) prepared in Example 2, where a is a laser confocal microscopy image and b is a flow cytometry detection result.

[0036] Figure 5 The results of flow cytometry analysis of the cellular uptake effect of amphiphilic DNA framework vectors with different geometric configurations (hexagonal bundle, tetrahedron, triangular prism and cube) prepared in Example 2 are as follows:

[0037] Figure 6 The images show a comparison of subcellular colocalization of siRNA delivered using the amphiphilic DNA framework vector of this invention and the commercial transfection reagent Lipofectamine 3000 in Example 3, respectively; where a represents the colocalization result of siRNA with early endosomes, b represents the colocalization result of siRNA with late endosomes, and c represents the colocalization result of siRNA with lysosomes.

[0038] Figure 7This is a flow cytometry result of the gene silencing efficiency of siRNA delivered by the amphiphilic DNA framework vector in Example 4, used to compare the gene silencing efficiency achieved by the amphiphilic DNA framework vector of the present invention and siEGFP delivered by Lipofectamine 3000. Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the embodiments are conventional practices in the art, or experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, the reagents and materials used in the embodiments are commercially available.

[0040] This invention uses programmable DNA framework nucleic acids as the structural basis, with cholesterol molecules as a representative of amphiphilic modification. Amphiphilic DNA framework vectors are constructed by introducing hydrophobic modifying groups and used in oligonucleotide drug delivery research. In the embodiments of this invention, four different geometric shapes of amphiphilic DNA framework vectors—hexagonal bundles, tetrahedral, triangular prisms, and cubic structures—were systematically compared. The results showed that the hexagonal bundle, with its higher structural stability and rigidity, exhibited the highest cellular uptake efficiency. Based on this, the hexagonal bundle DNA framework is preferred as the model structure for the amphiphilic vector, and subsequent oligonucleotide drug delivery research is conducted using it as an example. It should be understood that this invention is not limited to the hexagonal bundle structure; other DNA framework nucleic acids with sufficient structural rigidity can also be used, but the hexagonal bundle represents the currently preferred implementation method.

[0041] Example 1: Preparation of amphiphilic DNA framework vector and siRNA loading

[0042] This embodiment uses a six-helix bundle DNA framework modified with one cholesterol molecule and having one hanging strand for loading siRNA as an example to illustrate the synthesis of an amphiphilic DNA framework vector. The specific DNA single strands in this article were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the specific sequences are shown in Table 1. The siRNA sequence was designed based on the EGFP (Enhanced Green Fluorescent Protein) sequence, and will be uniformly referred to as "siEGFP" below.

[0043] like Figure 1As shown, the amphiphilic DNA framework vector of the present invention comprises a DNA framework body, a cholesterol-modifying group, and a dangling hybridization strand. The DNA framework body has a six-helix bundle structure, synthesized from 15 single-stranded DNA strands, including one cholesterol-modified DNA strand and a DNA strand with an extended dangling strand. The cholesterol-modifying group is attached to one end of the DNA framework to enhance the hydrophobic interaction between the vector and the lipid bilayer. The dangling hybridization strand has three potential selection sites located on the sides of the DNA framework and extending outwards. It contains sequences capable of base-complementary pairing with the target oligonucleotide drug, enabling specific drug loading and assembly.

[0044] Preparation of the DNA framework synthesis system. Fifteen single-stranded DNA molecules were synthesized at equimolar concentrations (1... The mixtures (M) were prepared in the following proportions. The reaction buffer system consisted of 40 mM Tris, 20 mM acetic acid, 2 mM EDTA, and 12.5 mM magnesium acetate, with a pH of 8. The remaining volume of the system was made up with deionized water.

[0045] DNA framework assembly and synthesis: Seal the opening of the EP tube containing the synthesis system with sealing film. Fill a 1L glass beaker with boiling water and immerse the EP tube in it. Then place the glass beaker in a sealed large foam box, ensuring that the temperature does not drop too quickly. Once the sample temperature has cooled to room temperature, remove it from the water bath to obtain the amphiphilic DNA framework vector (1μM). To synthesize amphiphilic DNA frameworks with different numbers and positions of hanging strands, simply replace the DNA strands at specific positions with DNA strands with extended hanging strands; the rest of the method is the same.

[0046] siRNA loading. Alexa Flour 647 fluorescent molecules were labeled on the siEGFP load to monitor the ligation of siEGFP with ADF-overhang. 10 µL of the above ADF-overhang was added to 1 µL of siEGFP-AF647 (10 µM), mixed thoroughly, and reacted at 37 °C for 30 minutes to obtain the product ADF-siEGFP.

[0047] The siEGFP banding was characterized by 6% polyacrylamide gel electrophoresis. The reaction products were electrophoresed on 6% polyacrylamide gels for 120 minutes, and the DNA frames stained with Alexa Fluor 647 and GelRed were characterized using an Odyssey CLx near-infrared dual-color imaging system and a Syngene GBOX Chemi luminescence imaging system, respectively.

[0048] Result: As Figure 2As shown, the 6% polyacrylamide gel electrophoresis bands indicate efficient assembly of the amphiphilic DNA framework vector, and the change in the position of the ADF-siEGFP band indicates successful loading of siEGFP onto the ADF vector, forming a vector-loador system with a larger molecular weight. Simultaneously, the Alexa Fluor 647 fluorescence signal band attached to siEGFP highly overlaps with the position of the amphiphilic DNA framework; the siRNA band in the ADF-siRNA lane shows no obvious fluorescence, indicating that most of the siEGFP in the system is loaded onto the ADF vector. These results demonstrate the efficient loading of siEGFP onto the vector system.

[0049] like Figure 3 As shown, the atomic force microscopy results indicate that the vector is uniform in size, appearing as a columnar structure approximately 7 nm wide and 21 nm long (Bar = 10 nm). Furthermore, the loading of siEGFP did not significantly alter the overall morphology of the vector system.

[0050] Example 2: Cellular uptake study of amphiphilic DNA framework vectors with different geometries

[0051] Following the method described in Example 1, four amphiphilic DNA frameworks—six-helix bundle (6HB), tetrahedron (TH), triangular prism (TP), and cube—were synthesized (specific sequences are shown in Table 1). Each structure had a cholesterol molecule modified at one vertex, and an Alexa Fluor 647 fluorescent molecule was simultaneously labeled at the 5' end of one of the constituent strands to achieve fluorescent labeling and tracking of the framework nucleic acid structure. Intracellular fluorescence signals were monitored to investigate ADF uptake within the cells. HeLa cells were incubated with an equimolar concentration (200 nM) for 8 hours, and the cellular uptake efficiency was qualitatively and quantitatively assessed using laser confocal microscopy and flow cytometry.

[0052] Result: As Figure 4 As shown, confocal fluorescence imaging (a) and flow cytometry (b) results indicate that the cell membrane adsorption and cellular uptake of the six-helix bundle amphiphilic DNA framework are significantly higher than those of the other three structures.

[0053] like Figure 5 As shown, flow cytometry quantitative analysis revealed that the mean fluorescence intensity (MFI) of cells treated with the six-helix bundled amphiphilic DNA framework was approximately 2.1, 2.4, and 2.9 times that of the tetrahedral, triangular prism, and cubic amphiphilic DNA framework structures, respectively. This result indicates that the six-helix bundled amphiphilic DNA framework exhibits superior cell binding and uptake capabilities compared to other structures.

[0054] Example 3: Study on endosome / lysosomal escape of siRNA delivered via amphiphilic DNA framework

[0055] Following the method in Example 1, ADF-siEGFP carrying a single siRNA (siRNA sequence as in Example 1) was prepared, and the siRNA was labeled with Alexa Flour 647 fluorescent molecules to track its subcellular localization. ADF-siEGFP was diluted to a final concentration of 500 nM in serum (0.5%) MEM medium and incubated with HeLa cells. Confocal microscopy was used to image the fluorescence colocalization of siEGFP and endosomes / lysosomes at 2, 4, 8, 12, 24, and 36 hours. Early endosome, late endosome, and lysosomal localization were imaged using Rab5 protein, Rab7 protein, and Lyso-Tracker Green (lysosomal green fluorescent probe), respectively. ImageJ was used to analyze the obtained confocal images, and the Manders' Colocalization Coefficients (MCCs) of the two fluorescence types were calculated to represent the colocalization of siEGFP and endosomes / lysosomes.

[0056] Meanwhile, siEGFP was transfected using the commercial transfection reagent Lipofectamine 3000 (Invitrogen, L3000001) and compared with the ADF-siEGFP group using the same imaging analysis.

[0057] Result: As Figure 6 As shown, the colocalization intensity of siEGFP carried by the commercial transfection reagent Lipofectamine 3000 with endosomes / lysosomes showed a gradual increasing trend over time. The percentage of colocalization of siEGFP with early endosomes carried by ADF showed a similar increasing trend to that of Lipofectamine 3000. Figure 6 (a), but the increasing trend of colocalization with late endosomes and lysosomes slowed significantly after 4 hours, and showed a significant decrease at 8 and 12 hours (a). Figure 6(b, c) Comparatively, at 2 hours, the colocalization of siEGFP delivered by the ADF vector with lysosomes was significantly higher than that of Lipofectamine 3000, while at 8 and 12 hours, it was significantly lower than that of Lipofectamine 3000. Based on these results, after entering the cell, siEGFP delivered by ADF as a vector undergoes endosome escape over time during the maturation process from early endosomes to late endosomes and from late endosomes to lysosomes, resulting in a gradual decrease in the colocalization of siEGFP with late endosomes and lysosomes.

[0058] Example 4: Study on gene silencing effect of siRNA delivered by amphipathic DNA framework vector

[0059] siEGFP (as in Example 1) was designed based on the EGFP (Enhanced Green Fluorescent Protein) sequence to perform gene silencing in the HeLa cell line (HeLa-EGFP) that stably expresses EGFP. Following the method in Example 1, ADF-siEGFP carrying one siEGFP was prepared. The siEGFP-carrying ADF and Lipofectamine 3000 were incubated with HeLa-EGFP for 12 hours each, and after 12 hours, the fluorescence intensity of the EGFP protein was detected by flow cytometry to verify the siRNA gene silencing level.

[0060] Result: As Figure 7 As shown, flow cytometry confirmed that after treatment with siEGFP delivered by ADF and Lipofectamine 3000, the average fluorescence intensity of cells decreased by approximately 42.2% and 52.7%, respectively, indicating that the gene silencing efficiency delivered by the ADF vector was comparable to that of Lipofectamine 3000.

[0061] Table 1. DNA and RNA sequences (5'-3') used in this paper:

[0062] ADF-2 CGGTACGTGACGATAGGACACATCAGATGTCTTAGGAGAGGTCACAGTAACCTTCGACAATCT ADF-3 AGGCAGATACGAAGAGCGCCGGGCTGTCGTAGATAGTTCTCGCACGACGCTAGACACGCTAGA ADF-4 GGATTGATCGGATGCCAGACGCATCGACATGAAGCAGCACGACTTACCAACTCAACGTGGTGC ADF-5 GCCTAGCGATCCAATGGAACGACCGTATTGCTGAGGTGAGTGTATGTATCACTTGCACGGACA ADF-6 CAACGGTACAGGGCAGCCTCCAACCTTGTAACCAGCGGCATAACGCTGGACATTGCCACTCGC ADF-7 GCGTCGAGTCACGTGCGTGTCTAGCGTCTGGCATCAGTGATA ADF-8 GTGCTCAAGGTTACGCTCTTCGTATCTGCACGTTGGATCGCT ADF-9 GCAGTCAACTG ADF-10 TCCTATCCTTGATGGCTGCCCTGTACCGCCGTGCACGATCAA ADF-11 TTGTCGAGGTACTAGTGGCAATGTCCAGTCCATTGAGTTGGT ADF-12 TACGACAGCTGCTTAGCAATACGGTCGTCGTTATGGCATTCA ADF-13 AAGTCGTGCCCGGCTGTGACCTCTCCTACTACATCCCGCTGG ADF-14 CATACACGTTGGAGGAGCAGAGCTACTTAGACATCAACTATC ADF-15 TTACAAGTCACCTCCATGTCGATGCGTCGTGCGAGTGATGTG ADF-2-Chol Cholesterol-CGGTACGTGACGATAGGACACATCAGATGTCTTAGGAGAGGTCACAGTAACCTTCGACAATCT ADF-7-overhang GCGTCGAGTCACGTGCGTGTCTAGCGTCTGGCATCAGTGATATACACACGTCCTTAG siEGFP-sense ACAUGAAGCAGCACGACUUdTdT siEGFP-antisense AAGUCGUGCUGCUUCAUGUdTdTCUAAGGACGUGUGUA TH-A5 CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG TH-A3 CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCG GCCTGCCGTCCCGTGTGGG TH-B5 CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG TH-B3 GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC TH-C5-chol Cholesterol-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC TH-C3 CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC TH-D5 GCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG TH-D3 CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGC CCGGCTCTTGTAAGTCGG TP-1aa TCGCTGAGTATTTTGCCTGGCCTTGGTCCATTTGTTTTGCAAGTGTGGGCACGCACACTTTTGCCTGGCCTTGGTCCATTTGTTTTCACAAATCTG TP-2aa CACTGGTCAGTTTTGCCTGGCCTTGGTCCATTTGTTTTTACTCAGCGACAGATTTGTGTTTTGCCTGGCCTTGGTCCATTTGTTTTGGTTTGCTGA TP-3ab CCACACTTGCTTTTCCATGCCGTAGCTGCGTATGTTTTCTGACCAGTGTCAGCAAACCTTTTGCCTGGCCTTGGTCCATTTGTTTTGTGTGCGTGC TP-a CAAATGGACCAAGGCCAGGC TP-b-chol Cholesterol-CATACGCAGCTACGGCATGG Cube-1AA TCGCTGAGTATTTTTCCTATATGGTCAACTGCTCTTTTGCAAGTGTGGGCACGCACACTTTTTCCTATATGGTCAACTGCTCTTTTCACAAATCTG Cube-2AA CTATCGGTAGTTTTTCCTATATGGTCAACTGCTCTTTTTACTCAGCGACAGATTTGTGTTTTTCCTATATGGTCAACTGCTCTTTTCAACTAGCGG Cube-3AB CACTGGTCAGTTTTTCCGACAAGCTAAGCTACTCTTTTCTACCGATAGCCGCTAGTTGTTTTTCCTATATGGTCAACTGCTCTTTTGGTTTGCTGA Cube-4AA CCACACTTGCTTTTTCCTATATGGTCAACTGCTCTTTTCTGACCAGTGTCAGCAAACCTTTTTCCTATATGGTCAACTGCTCTTTTGTGTGCGTGC Cube-A TTTTTCAGTTGACCATATA Cube-B-chol Cholesterol-TTTTTTAGCTTAGCTTGTC

[0063] In summary, the cholesterol molecule of the amphiphilic DNA framework provided by the present invention can enhance the binding ability of the carrier to the cell membrane, thereby significantly improving the uptake of the carrier system by the cell; more importantly, the amphiphilic characteristics of the carrier can change the uptake pathway and intracellular distribution of the DNA framework to a certain extent, so that it can enter the cytoplasm more directly through the membrane or escape through the endosome, thereby significantly improving the efficiency of oligonucleotide drug delivery to the cytoplasm.

[0064] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A method for preparing an amphiphilic DNA framework vector, characterized in that, Includes the following steps: 1) Design multiple DNA single strands, modify at least one DNA single strand with cholesterol hydrophobicity, and set a dangling hybridization strand on the DNA single strand that can be complementary to the bases of the oligonucleotide drug; 2) Mix all DNA single strands in an equimolar ratio and add them to the appropriate buffer system to obtain a mixture; 3) The mixture is subjected to high-temperature water bath treatment, followed by cooling and standing, and the amphiphilic DNA framework vector is obtained through DNA chain self-assembly.

2. The preparation method according to claim 1, characterized in that, The cholesterol modification site is located at the 5' end of the DNA single strand, and a single DNA framework vector binds to at least one cholesterol molecule.

3. The preparation method according to claim 1, characterized in that, The pendant hybridization strand extends outside the DNA framework and is used to bind and load target oligonucleotide drugs through base complementarity.

4. The preparation method according to claim 1, characterized in that, The buffer system is a weakly alkaline buffer solution containing Tris, acetic acid, EDTA and magnesium acetate.

5. The preparation method according to claim 1, characterized in that, The high-temperature water bath is a boiling water bath, and the cooling and settling process is carried out in a closed environment until the system returns to room temperature and completes self-assembly.

6. The preparation method according to claim 1, characterized in that, The main body of the amphiphilic DNA framework carrier is a DNA nanoframework with a rigid three-dimensional structure.

7. The preparation method according to claim 6, characterized in that, The DNA nanoframework is selected from any one of the following: hexagonal bundle, tetrahedron, triangular prism, and cube.

8. An amphiphilic DNA framework vector prepared by the method according to any one of claims 1 to 7, characterized in that, The amphiphilic DNA framework vector possesses both cell membrane binding and endosome escape capabilities, and can mediate the delivery of oligonucleotide drugs into the cell cytoplasm.

9. The use of the amphiphilic DNA framework vector according to claim 8 in the preparation of oligonucleotide drug delivery formulations.

10. The application according to claim 9, characterized in that, The oligonucleotide drugs are functional nucleic acids that can be used for cell regulation or disease treatment, including siRNA, miRNA, and antisense oligonucleotides.

Images