A polypeptide, radionuclide imaging probe targeting alpha 7-nAChR and application thereof

Abstract

This invention discloses a polypeptide targeting α7-nAChR, a radionuclide imaging probe, and their applications, belonging to the field of biomedical technology. This invention modifies a linear polypeptide targeting α7-nAChR with polyethylene glycol and conjugates it with the bifunctional chelating agent pSCN Bn NOTA to obtain the radioactive probe precursor NOA-PEG8-12C-1. The precursor targeting α7-nAChR is then labeled with a radionuclide to form a radionuclide imaging probe. 18 F]AlF-NOTA-KHH-01 was found to be a radioactive tracer through in vitro radiochemical property studies and in vivo stability studies. 18 F]AlF-NOTA-KHH-01 exhibits strong qualitative properties and hydrophilicity; the radioactive tracer was investigated using small animal PET / CT. 18 The tumor imaging effect of F]AlF-NOTA-KHH-01 was investigated, and it was found that it can be used for the detection of 7-nAChR expression level and as a tumor imaging agent targeting 7-nAChR.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a polypeptide, radionuclide imaging probe, and its application targeting α7-nAChR. Background Technology

[0002] α7 nicotinic acetylcholine receptors (α7-nAChRs) play important roles in cognitive function, inflammation regulation, and neuroprotection, and are also closely related to tumor progression. As the main nAChR subtype mediating the proliferative effect of nicotine in cancer cells, α7-nAChRs can activate multiple signaling pathways, enhance the invasiveness of lung cancer cells, and inhibit their apoptosis, thereby inducing chemoresistance.

[0003] Several tracers targeting α7-nAChR have been developed for imaging, including 131I-CHIBA-1001, [¹ 8 F]ASEM、[¹ 8 F]DBT-10、[¹ 8 F]15, etc. However, these tracers generally suffer from problems such as complex precursor synthesis, difficult fluorination reaction, and low yield. In addition, existing research focuses only on diseases related to cognitive impairment, and their application in tumor imaging is extremely rare. Therefore, there is an urgent need to develop a new tracer that is easy to prepare and readily radiolabeled. Although α7-nAChR is considered a biomarker for certain types of tumors, most of the reported PET radiotracers targeting α7-nAChR ([¹ 8 F]ASEM、[¹ 8 F]DBT-10、[¹ 8 F]NS10743 and [¹ 8 F]NS14490 was developed and evaluated almost exclusively in the context of neuropsychiatric and neurodegenerative diseases, rather than for use in oncology. To date, very few studies have extended PET probes targeting α7-nAChR to tumor imaging applications; currently, only Deuther-Conrad and his team have studied α7-nAChR-specific radioligands in a subcutaneous U87-MG glioblastoma xenograft mouse model [¹]. 8 [F]NS10743. Therefore, imaging agents targeting α7-nAChR tumors are still lacking. We need to continue our research on PET radiotracers targeting α7-nAChR in order to provide more tracers that can be used for tumor imaging. Summary of the Invention

[0004] To achieve the above objectives, this invention screens a lead polypeptide from a phage display library, modifies it with polyethylene glycol (PEG), conjugates it with a Nota chelating agent, and ¹ 8 F-radiolabeling successfully yielded a novel¹8 F-labeled tracers were used to evaluate their pharmacokinetic properties and specific diagnostic capabilities in preclinical models. The specific technical solution is as follows:

[0005] The first objective of this invention is to provide a polypeptide targeting α7-nAChR, characterized in that the polypeptide is a linear polypeptide 12C-1 with the following molecular structure:

[0006] Sequencing revealed the base sequence of the peptide 12C-1 targeting α7-nAChR as GATGTTACGGGTCATGATCGTGTTAATA, and the amino acid sequence as DVTGHDRVNSWSGGG.

[0007] A second objective of this invention is to provide a radionuclide imaging probe targeting α7-nAChR, the probe comprising a polypeptide targeting α7-nAChR and a labeled radionuclide, wherein the polypeptide is a straight-chain polypeptide 12C-1 as described above, and the structural formula of the radionuclide imaging probe is as follows:

[0008] Furthermore, the radionuclide used for labeling is a diagnostic radionuclide or a therapeutic radionuclide.

[0009] The third objective of this invention is to provide a method for preparing a radionuclide imaging probe targeting α7-nAChR, specifically comprising the following steps:

[0010] S1, Synthesis of radioactive probe precursor: The polypeptide 12C-1 targeting α7-nAChR as described in claim 1 was modified with polyethylene glycol and coupled with the bifunctional chelating agent pSCN Bn NOTA to obtain the radioactive probe precursor NOA-PEG8-12C-1.

[0011] S2, [¹ 8 F] Fluoride ion enrichment and purification: [¹] 8 F] ions were enriched on an activated Sep Pak light QMA column, which was pretreated sequentially with 5 mL of physiological saline and 10 mL of double-distilled water, and then eluted with 0.2 mL of acetonitrile solution containing 2% physiological saline at a volume ratio of 50:50 to obtain purified [¹] ions. 8 F] Fluoride ion eluent;

[0012] S3, [ 18 F] Reaction with precursor: In a reaction flask, the radioactive probe precursor NOTA-PEG8-12C-1 solution obtained in S1 was mixed with AlCl3 solution, followed by the addition of 37 GBq.18 The F-eluent was prepared with physiological saline / acetonitrile and reacted at 110 °C with magnetic stirring for 15 min to complete the radiolabeling. The precursor solution and AlCl3 solution were prepared with 0.2 M acetate buffer at pH 4.

[0013] S4, C18 column purification: The C18 column was pre-activated with anhydrous ethanol and double-distilled water; after cooling the reaction solution, the sample was loaded and eluted with 30 mL of double-distilled water to remove free [¹]. 8 F] Fluoride ion impurities were removed, and the target product was then eluted with a 50:50 volume ratio of ethanol / double-distilled water mixture.

[0014] S5, Product purification: The eluted product solution was filtered through a 0.22 μm filter membrane for sterilization to obtain a PET imaging probe targeting α7-nAChR. 18 F]AlF-NOTA-PEG8-12C-1.

[0015] The fourth objective of this invention is to provide an application of a radionuclide imaging probe targeting α7-nAChR in the preparation of formulations for detecting the expression level of α7-nAChR in tumors.

[0016] Furthermore, the present invention also provides the application of a radionuclide imaging probe targeting α7-nAChR in the preparation of a formulation for diagnosing tumors with high expression of α7-nAChR.

[0017] Furthermore, the application of the radionuclide probe in the preparation of PET imaging agents for diagnosing non-small cell lung cancer, pheochromocytoma, cholangiocarcinoma, and breast cancer, wherein the radionuclide probe is an imaging probe. 18 F]AlF-NOTA-PEG8-12C-1, we also named it [ 18 F]AlF-NOTA-KHH-01.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] (1) Peptide 12C-1 has a strong binding affinity to the α7-nAChR receptor and has good targeting recognition ability for α7-nAChR.

[0020] (2) The probe [ 18 F]AlF-NOTA-KHH-01 can specifically target tumors with high expression of α7-nAChR, with good in vivo retention and low non-specific uptake, and has good prospects for PET imaging applications.

[0021] (3) [ 18F]AlF-NOTA-KHH-01 showed no significant liver, kidney, or major organ toxicity in experimental animals at effective imaging doses, demonstrating good in vivo biocompatibility.

[0022] (4) Tracers 18 The precursor synthesis of F]AlF-NOTA-KHH-01 is simple, and the uncorrected radiochemical yield is 15.3 ± 6.1%. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of phage peptide library screening.

[0024] Figure 2 This is a schematic diagram showing the binding mode and binding energy of the targeting peptide 12C-1 to α7-nAChR.

[0025] Figure 3 This is a schematic diagram of the immunofluorescence expression of α7-nAChR in different cells.

[0026] Figure 4 for[ 18 Molecular structure diagram of F]AlF-NOTA-KHH-01.

[0027] Figure 5 for[ 18 Quality control and in vitro stability analysis of F]AlF-NOTA-KHH-01, wherein:

[0028] A is [ 18 HPLC analysis of F]AlF-NOTA-KHH-01 showed that the ultraviolet peak of the product was consistent with the radioactive peak.

[0029] BC is [ 18 Stability analysis of the product after incubation of F]AlF-NOTA-KHH-01 with PBS and FBS at 37°C for 1 h, 2 h and 4 h, respectively.

[0030] Figure 6 for[ 18 Quality control and in vitro stability analysis of F]AlF-NOTA-KHH-01

[0031] Figure 7 for[ 18 A549α7-nAChR PET / CT imaging results of F]AlF-NOTA-KHH-01.

[0032] Figure 8 For different tumor xenograft models (A549, A549α7-nAChR, 4T1 and HUCCT1) [ 18PET / CT images of F]AlF-NOTA-KHH-01 (n = 3-4).

[0033] Figure 9 for[ 18 Biodistribution of F]AlF-NOTA-KHH-01 in A549α7-nAChR xenografts (30 min, 1 h and 2 h after radiotracer administration, n = 5).

[0034] Figure 10 For targeting α7-nAChR¹ 8 F-labeled polypeptide PET probe [ 18 Dynamic PET imaging and quantitative analysis results of F]AlF-NOTA-KHH-01 in tumor-bearing mice, including:

[0035] A represents whole-body dynamic PET imaging;

[0036] B represents the time-activity curves (TAC) for tumor, muscle, and liver.

[0037] C represents the kidney's time-activity curve (TAC).

[0038] Figure 11 For targeting α7-nAChR radioactive probes [ 18 Biocompatibility evaluation (liver and kidney function indicators) bar chart of F]AlF-NOTA-KHH-01.

[0039] Figure 12 For targeting α7-nAChR radioactive probes [ 18 The histopathological (H&E staining) safety evaluation results of F]AlF-NOTA-KHH-01.

[0040] Figure 13 The results were used to compare and validate the tissue morphology (HE staining) and α7-nAChR protein expression (IHC immunohistochemistry) of five tumor models. Detailed Implementation

[0041] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings.

[0042] Example 1: Screening for peptides targeting α7-nAChR using phage display technology

[0043] like Figure 1As shown, phage display and panning experiments were performed using the extracellular domain of recombinant human α7-nAChR as the target, employing Ph.D.™-12 (linear peptide) and Ph.D.™-C7C (cyclic peptide) phage display libraries from NEB. Each library contained approximately 10... 9 Each phage plaque is unique. The selection process follows the manufacturer's operating protocol. After three rounds of screening, individual phage plaques are isolated from each library for sequencing. The phage display process is as follows: Figure 1 As shown in Table 1, the base and amino acid sequences of the obtained α7-nAChR-targeting polypeptide 12C-1 are presented.

[0044] Table 1. Peptide sequences targeting α7-nAChR screened by phage display technology

[0045] GATGTTACGGGTCATGATCGTGTTAATAGTTGGTCGGGTGGAGGT DVTGHDRVNSWSGGG

[0046] Example 2: Docking of α7-nAChR-targeting peptide 12C-1 with α7-nAChR molecules

[0047] ① Prepare the target protein (α7-nAChR, CHRNA7): Download the α7-nAChR (2MAW) structure from the PDB bank database website (https: / / www.rcsb.org / ) and store it in PDB format. Use AutoDock Vina to dehydrate and hydrogenate the α7-nAChR protein and store it as a receptor PDBQT format file for later use.

[0048] ②Preparation of small molecule peptides: The small molecule peptide structure was drawn using ChemDraw 20.0 and saved as a Mol format. ChemDraw3D was then used for energy minimization to obtain the optimal peptide structure. Hydrogenation and torsion bond detection were performed using AutoDock Vina, and the structure was saved as a ligand PDBQT format file for later use.

[0049] ③ Set docking parameters: AutoDock Vina sets the grid box to include the entire α7-nAChR protein region to define the docking calculation area. The number of docking attempts is selected as 10 to obtain the optimal docking conformation. A binding affinity of <-5 kcal / mol is considered to be able to bind.

[0050] The binding mode and binding energy of the target peptide to protein α7-nAChR are as follows: Figure 2As shown, the binding energy of peptide 12C-1 to α7-nAChR is -5.1 kcal / mol, which is <-5 kcal / mol. This targeting peptide 12C-1 can precisely bind to the active region of the extracellular ligand of α7-nAChR. 12C-1 and α7-nAChR form hydrogen bonds, and the two form a stable complex through hydrogen bonds, hydrophobic interactions, and electrostatic interactions. The binding energy results indicate that the peptide has a strong binding affinity to the receptor, confirming that the peptide has good targeting recognition ability for α7-nAChR and can be used as a targeting molecule for further research.

[0051] Immunofluorescence was used to verify transfection efficacy and evaluate the expression level of α7-nAChR in non-small cell lung cancer (A549), non-small cell lung cancer overexpressing α7-nAChR (A549α7-nAChR), pheochromocytoma (PC12), cholangiocarcinoma (HUCCT1), and breast cancer cells (4T1). Cells were seeded on coverslips in culture plates and cultured at 37°C and 5% CO2 until cell confluence reached 70%-80%. After fixation with 4% paraformaldehyde, cells were washed with PBS. After permeabilization with Triton X-100, the cells were blocked and incubated overnight at 4°C with anti-α7-nAChR antibody primary antibody. Under light-protected conditions, the cells were incubated with fluorescently labeled secondary antibody, and the nuclei were counterstained with DAPI. After final washing, the cells were mounted with anti-fluorescence quenching mounting medium and observed under a fluorescence microscope.

[0052] The results are as follows Figure 3 As shown, non-small cell lung cancer (A549), non-small cell lung cancer overexpressing α7-nAChR (A549α7-nAChR), pheochromocytoma (PC12), cholangiocarcinoma (HUCCT1), and breast cancer cells (4T1) all express α7-nAChR protein. The expression of α7-nAChR in A549 overexpressing α7-nAChR is significantly higher than that in A549.

[0053] Example 3: Radiolabeling of α7-nAChR peptide

[0054] The linear polypeptide 12C-1 selected in Example 1 was used for modification and radionuclide treatment. 18 F-mark, get (Also named) ), and is used for subsequent PET / CT imaging. The molecular structure of the linear polypeptide 12C-1 is as follows: Figure 4 As shown, The specific preparation method is as follows:

[0055] S1, Precursor modification and synthesis: The selected precursor was modified with polyethylene glycol (PEG8) and coupled with the bifunctional chelating agent pSCN Bn NOTA to obtain the NOTA-PEG8-peptide precursor;

[0056] S2, [ 18 F] ion enrichment: [ 18 F] ions were enriched on an activated Sep Pak light QMA column (WAT023525, Waters, USA), which was pretreated sequentially with 5 mL of physiological saline and 10 mL of double-distilled water (ddH2O); then [¹] ions were enriched with 0.2 mL of acetonitrile solution containing 2% physiological saline (50 / 50, v / v). 8 F] Fluoride elution.

[0057] S3, [ 18 [F] Reaction with the precursor: In a reaction flask, 50 nmol of the precursor (dissolved in 200 μL of 0.2 M acetate buffer, pH 4) was mixed with 40 nmol of AlCl3 (dissolved in 0.2 M acetate buffer at 5 nmol / μL, pH 4), and then 200 μL of [a specific solution] containing [a specific ingredient] was added. 37 GBq 18 F was eluent with physiological saline / acetonitrile. The reaction was carried out at 110 °C with magnetic stirring for 15 minutes.

[0058] S4, C18 column purification: A C18 Sep Pak Light column (WAT023501, Waters, USA) was activated with 5 mL of anhydrous ethanol and 10 mL of ddH2O. After the reaction was complete and cooled, the mixture was loaded onto the activated C18 column for purification.

[0059] S5, Product purification: Elute the column with 30 mL ddH2O to remove unbound [[ 18 [F]fluoride was then eluent with a 500 μL ethanol / ddH2O mixture (50 / 50, v / v). The final eluent was sterilized by filtration through a 0.22 μm filter membrane. .

[0060] Results: Radiosynthesis was performed manually and completed within 40 minutes. Uncorrected radiochemical yield: It is 15.3 ± 6.1%.

[0061] (1) Product quality control and in vitro stability: The product was evaluated by radio-high performance liquid chromatography (radio-HPLC) in phosphate-buffered saline (PBS) and 5% fetal bovine serum (FBS). The in vitro stability was assessed. In physiological saline studies, the compounds were incubated at 37°C for 1, 2, and 4 hours, respectively, and then directly analyzed by radio-HPLC. In 5% FBS studies, the radioactive tracer ( After incubation, proteins were precipitated with acetonitrile, followed by radio-HPLC analysis. A Waters C18 column (150 mm × 4.6 mm, 5 μm) was used at a flow rate of 1 mL / min, and the UV detection wavelength was 220 nm. A linear gradient elution was used for 20 minutes, with mobile phase B increasing from 10% to 70%. Mobile phase A consisted of ultrapure water containing 0.1% trifluoroacetic acid (TFA), and mobile phase B consisted of 100% acetonitrile (ACN) containing 0.1% TFA.

[0062] The results showed that after purification, radio-HPLC analysis confirmed [¹] 8 The radiochemical purities of F]AlF-NOTA-KHH-01 were all greater than 95%, and their retention times were approximately 9.0 minutes and 10.8 minutes, respectively. Figure 5 )

[0063] (2) Lipid / water partition coefficient and plasma protein binding rate (PPB):

[0064] Take 5 KBq The mixture was added to a system consisting of 0.5 mL n-butanol and 0.5 mL water (pH = 7.4). The mixture was vortexed vigorously for 15 minutes, then centrifuged at 12500 rpm for 5 minutes to ensure complete separation of the two phases. Subsequently, four 100 µL aliquots were taken from both the organic and aqueous phases. The radioactivity of each aliquot was measured using a gamma counter, and the counts per minute (CPM) were recorded. The Log P value was calculated based on these measurements. The Log P value was calculated as follows: log P = log [(average CPM of the n-butanol phase) / (average CPM of the aqueous phase)].

[0065] To determine plasma protein binding rate (PPB), 18.5 MBq of... The sample was incubated with mouse plasma at 37°C for 1 hour. Then, 100 µL aliquots were taken from the plasma, and the total radioactivity was measured using a gamma counter. To ensure the scientific validity of the calculations, this sampling was repeated four times. Subsequently, proteins were precipitated with acetonitrile, and the radioactivity in the supernatant and protein precipitate was measured separately. Plasma protein binding rate is expressed as the percentage of protein-bound radioactivity relative to the total plasma radioactivity.

[0066] The results show: [ 18The log P-value of F]AlF-NOTA-KHH-01 is -2.67, further confirming [ 18 The hydrophilicity of F]AlF-NOTA-KHH-01. Furthermore, based on three independent repeated experiments, […]. 18 The plasma protein binding rate (PPB) of F]AlF-NOTA-KHH-01 was 42.13%, indicating that the probe exists mainly in free form in vivo and is rapidly cleared by the kidneys.

[0067] (3) Cellular uptake blocking experiment:

[0068] In the cell blockade experiment, A549α7-nAChR cells were stored at a density of 1 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in six-well plates and cultured for 24 hours. After aspirating the culture medium, each well was washed three times with 1 mL of PBS. In the inhibition group (n=4), 100 nmol of the cold precursor (NOTA-KHH-01) was added to each well. Subsequently, approximately 0.1 MBq dissolved in 1 mL of DMEM was added to each well. 18 F]AlF-NOTA-KHH-01 was incubated for 30 minutes and 60 minutes, respectively. After washing, the cells were quantified using a gamma counter (Wizard 2480, Perkin Elmer Instruments Inc., USA). The results were also compared... 18 Differences in cellular uptake of F]AlF-NOTA-KHH-01 between A549 cells and A549α7-nAChR cells.

[0069] The blocking experiment verified that [ 18 F]AlF-NOTA-KHH-01 is specific for human α7-nAChR cells. Blockade analyses in different cell lines showed that, compared to the control group, the blockade group had significantly reduced cellular radioactive uptake at 30 and 60 minutes after incubation with the radiotracer. Figure 6 Significant differences were also observed in cell uptake between A549 cells and A549α7nAChR cells (30 min: 217.25 ± 14.64 vs 106.75 ± 10.05 CPM / 10). 5 Cells, P=0.0006; 60 min: 228.50 ± 13.41 vs 102.00 ± 11.19 CPM / 10 5 Cells, P=0.0004), further confirming the specificity of this tracer ( Figure 6 ).

[0070] Example 4: Radionuclide Imaging Probe [ 18In vivo PET / CT imaging of tumor-bearing mice with F]AlF-NOTA-KHH-01

[0071] Six- to eight-week-old female BALB / c mice were used for inoculation with breast cancer cells (4T1 tumor cells), and BALB / c nude mice were used for inoculation with non-small cell lung cancer (A549), A549α7-nAChR, pheochromocytoma (PC12), and cholangiocarcinoma (HUCCT1 cells). Mice were anesthetized with 5% isoflurane and maintained anesthesia with 1% isoflurane, then placed on a small animal warming pad to maintain body temperature. 100 μL of cell suspension (totaling 1 × 10⁻⁶ cells) was aspirated using an insulin syringe. 6 (cells). After disinfecting the skin with alcohol swabs, the cells were subcutaneously inoculated. Tumor volume was monitored using calipers and calculated using the formula (length × width²) / 2. When the tumor volume reached approximately 200 mm³, mice were injected with a tracer for biodistribution studies and positron emission tomography / computed tomography (PET / CT) imaging.

[0072] (1) PET imaging was performed on mice bearing subcutaneous xenograft tumors to evaluate [ 18 Can F]AlF-NOTA-KHH-01 visualize tumors expressing different levels of α7-nAChR in vivo? PET / CT scan results show that... 18 F]AlF-NOTA-KHH-01 showed significant accumulation at the tumor site. Figure 7 A), pre-injection of unlabeled NOTA-KHH-01 can significantly reduce [ 18 Tumor accumulation of F]AlF-NOTA-KHH-01 (P=0.006, Figure 7 B). Furthermore, PET / CT imaging showed that A549α7-nAChR tumors had higher uptake than A549 tumors; the tumor-to-liver ratio at 60 minutes was 3.7 for A549 tumors, compared to 1.5 for A549 tumors and 1.8 for the blockade group. Figure 7 CD), indicating that non-small cell lung cancer overexpressing α7-nAChR can significantly take up and be blocked. These findings confirm [ 18 The specificity of F]AlF-NOTA-KHH-01 for α7-nAChR.

[0073] (2) Radionuclide imaging probes [ 18 Validation of F]AlF-NOTA-KHH-01 in multiple tumor models

[0074] The results are as follows Figure 8As shown, PET / CT scan results in various tumor models (A549, A549α7-nAChR, 4T1, and HUCCT1) indicate that, [¹] 8 F]AlF-NOTA-KHH-01 exhibits good tumor uptake and an ideal tumor / background ratio. In vivo PET imaging results show that... 18 The F]AlF-NOTA-KHH-01 probe exhibited significant and sustained high uptake in A549 cell tumors stably overexpressing α7-nAChR (A549α7-nAChR), with clear imaging occurring 1 hour after injection and the signal remaining stable for 4 hours. In contrast, in parental A549 tumors and 4T1 and HUCCT1 tumors with low α7-nAChR expression, probe uptake was extremely low or the signal was rapidly cleared early on. These results confirm that the probe can specifically target tumors with high α7-nAChR expression, exhibiting good in vivo retention and low non-specific uptake, demonstrating promising potential for PET imaging applications.

[0075] (3) In the biodistribution study, A549α7-nAChR tumor-bearing mice (n=5 per group) were injected with 3.7 MBq of radioactive tracer via the tail vein. 18 [F]AlF-NOTA-KHH-01. Blood samples were collected at 30, 60, and 120 minutes post-injection. Mice were then euthanized, and tumors and major tissues (including brain, heart, lungs, liver, spleen, pancreas, kidneys, stomach, small intestine, large intestine, muscle, bone, and tail) were removed, rinsed, and weighed. The radioactivity of all samples was quantified using a gamma counter and recorded as counts per minute (CPM). After correction for injection time decay, these values ​​were converted to percentages of injected dose per gram of tissue (%ID / g). Final data are expressed as mean ± standard deviation.

[0076] The results showed that [the efficacy of A549α7-nAChR cells was evaluated in mice bearing these cells]. 18 Biodistribution of F]AlF-NOTA-KHH-01 (n=5, Figure 9The kidneys were the dominant site of radioactivity uptake, with values ​​of 9.14 ± 2.38 %ID / g at 30 minutes, 6.42 ± 1.09 %ID / g at 60 minutes, and 4.71 ± 1.88 %ID / g at 120 minutes, indicating rapid urinary clearance of the tracer. In normal tissues, tracer accumulation in the spleen showed a continuously increasing trend, reaching 2.45 ± 1.17 %ID / g at 120 minutes. Tumor uptake was also significant, peaking at 30 minutes post-injection (1.86 ± 0.40 %ID / g). The tumor / muscle ratios at 0.5, 1, and 2 hours post-injection were approximately 3.5, 15.1, and 81.8, respectively, with corresponding tumor / liver ratios of 1.5, 1.6, and 1.6. Uptake was low in most normal organs; 2 hours post-injection, radioactivity in parts of the brain, heart, lungs, pancreas, digestive tract, and muscles had decreased below the gamma counter detection limit.

[0077] (4) Dynamic PET / CT imaging was performed in nude rats bearing PC12 tumors. First, an indwelling needle was inserted into the anesthetized rats, and then a CT scan was performed before the injection of radiopharmaceuticals. The rats were then moved to the PET scan position, and 7.4 MBq of [ ] was injected immediately upon initiation of the PET scan. 18 [F]AlF-NOTA-KHH-01. The acquired list-pattern PET data was reconstructed into 20 frames within 60 minutes: 20 × 180 seconds. Time-radiation curves for tumors, kidneys, livers, and muscles were generated based on the dynamic data.

[0078] The results showed that dynamic whole-body images of rats bearing PC12 tumors were reconstructed as maximum intensity projections (MIPs). Renal excretion is [ 18 The main clearance pathway of F]AlF-NOTA-KHH-01. Pharmacokinetic analysis showed a distribution phase half-life of 6.00 ± 2.45 minutes and an elimination phase half-life of 24.75 ± 3.77 minutes. The probe accumulates very little in muscle and bone, resulting in low background radioactivity and high image contrast. High tumor / background contrast was observed as early as 45 minutes after injection, with tumor / muscle ratios and tumor / liver ratios reaching 2.61 ± 0.62, consistent with biodistribution data and stable PET / CT imaging results. Figure 10 ).

[0079] Example 5: [ 18 Toxicity Study of F]AlF-NOTA-KHH-01

[0080] To assess the safety of the probe, 18 healthy female BALB / c-nu / nu mice (16-18 g, 6-8 weeks old) were randomly divided into a saline control group, an acute toxicity group (24 hours after injection), and a chronic toxicity group (7 days after injection); the treatment groups received 37 MBq of […].18 [F]AlF-NOTA-KHH-01. Blood samples were collected for blood biochemical analysis. Heart, liver, spleen, lung, and kidney tissues were taken for histopathological examination.

[0081] The results of liver and kidney function tests showed that ( Figure 11 At 24 h and 7 days after probe injection, serum ALT, AST, BUN, and CREA levels in mice remained within the normal reference range, with no significant abnormal increases. These results indicate that the PET probe targeting α7-nAChR showed no significant hepatotoxicity or renal toxicity at the experimental dose, demonstrating good in vivo biocompatibility.

[0082] Histopathological (H&E staining) safety evaluation results of the radioactive probe targeting α7-nAChR showed that ( Figure 12 ):

[0083] Lungs: The alveolar structure was clear, the alveolar walls were thin, and no signs of inflammatory cell infiltration, congestion, edema, or fibrosis were observed. The lung tissue structure was normal at 24 hours and on Day 7.

[0084] Liver: The liver lobule structure is intact, the hepatocytes are neatly arranged, there is no hepatocyte necrosis, fatty degeneration or inflammatory infiltration, and the morphology of the hepatic sinusoids and central veins is normal.

[0085] Spleen: The white pulp and red pulp are clearly demarcated, and the lymphocytes are evenly distributed without obvious atrophy, necrosis or inflammatory changes.

[0086] Kidney: The glomeruli are intact, the tubular epithelial cells are neatly arranged, there is no tubular dilation, necrosis or interstitial inflammation, and no proteinuria casts or hemorrhage are observed.

[0087] Heart: Myocardial fibers are arranged regularly, with clear transverse striations, and there is no myocardial cell necrosis, inflammatory infiltration, or interstitial edema.

[0088] The above results indicate that, 24 h and 7 days after probe injection, the major organs of mice, such as the heart, liver, spleen, lungs, and kidneys, remained structurally intact, with no obvious inflammation, necrosis, or degenerative lesions observed. This confirms that the PET probe targeting α7-nAChR has good in vivo biocompatibility at the experimental dose.

[0089] The biochemical indicators and histopathological results corroborate each other, confirming at both the functional and histomorphological levels that the PET probe targeting α7-nAChR […]. 18F]AlF-NOTA-KHH-01 showed no significant liver, kidney, or major organ toxicity in experimental animals at effective imaging doses, demonstrating good in vivo biosafety and providing reliable safety evidence for subsequent in vivo imaging studies in animal models and potential clinical translation.

[0090] Example 6: Comparison and verification of tissue morphology and α7-nAChR protein expression in five tumor models

[0091] To perform histological analysis of α7-nAChR expression, tumors were excised from mice and processed through a series of steps. Tissues were fixed in 10% buffered formalin, dehydrated in graded ethanol solutions, embedded in paraffin, and finally stained by immunohistochemistry (IHC). Paraffin-embedded samples were dewaxed in ethanol and antigen retrieval was performed using 0.01 mol / L sodium citrate buffer containing 0.05% Tween. IHC staining of these tissue sections was performed using a primary antibody (PA5-115651, Invitrogen, USA) and a secondary antibody (GB23303, Servicebio, China) against α7-nAChR. The expression levels of α7-nAChR in different tumor models are shown in the table below.

[0092] Table 2. α7-nAChR expression levels in different tumor models

[0093]

[0094] The table above shows that α7-nAChR is expressed to varying degrees in different tumor tissues, with the expression of α7-nAChR in A549 being significantly higher than that in A549 tumors.

[0095] This shows that the enrichment level of the probe in vivo is highly positively correlated with the expression level of α7-nAChR protein in tumor tissue, further proving that the targeting specificity of the probe is determined by the receptor expression level, rather than non-specific adhesion.

[0096] In summary, HE staining and IHC results from different tumor models showed that ( Figure 13 In A549 and PC12 tumor tissues, α7-nAChR protein showed strong positive expression, while its expression level was extremely low or only weakly positive in A549, HUCCT1, and 4T1 tumors. This result is highly consistent with the probe uptake trend observed in in vivo PET imaging and cellular uptake experiments, confirming that the targeted enrichment of the probe depends on the expression level of the α7-nAChR receptor, further validating its targeting specificity.

[0097] Sequence list information:

[0098] DTD Version: V1_3

[0099] Filename: A peptide, radionuclide imaging probe, and its application targeting α7-nAChR.xml

[0100] Software Name: WIPO Sequence

[0101] Software version: 2.1.0

[0102] Generation Date: 2026-06-05

[0103] Basic Information:

[0104] Current application / Intellectual Property Office: CN

[0105] Current application / applicant file name: 12530000431201816X

[0106] Applicant's Name or Title: The First People's Hospital of Yunnan Province

[0107] Applicant's name or organization name / Language: zh

[0108] Applicant's Name or Title / Latin Name: The First People's Hospital of Yunnan Province

[0109] Invention Title: A Peptide and Radionuclide Imaging Probe Targeting α7-nAChR and Its Application (zh)

[0110] Total sequence count: 2

[0111] sequence:

[0112] Serial Number (ID): 1

[0113] Length: 15

[0114] Molecular type: AA

[0115] Feature location / qualifier:

[0116] - source, 1..15

[0117] > mol_type, protein

[0118] > organism, synthetic construct

[0119] residues:

[0120] DVTGHDRVNS WSGGG 15

[0121] Serial Number (ID): 2

[0122] Length: 45

[0123] Molecular type: DNA

[0124] Feature location / qualifier:

[0125] - source, 1..45

[0126] > mol_type, other DNA

[0127] > organism, synthetic construct

[0128] residues:

[0129] gatgttacgg gtcatgatcg tgttaatagt tggtcgggtg gaggt 45

[0130] END

Claims

1. A polypeptide targeting α7-nAChR, characterized in that, The polypeptide is a linear polypeptide 12C-1, with the following molecular structural formula: The amino acid sequence is shown in SEQ ID NO:

1.

2. A radionuclide imaging probe targeting α7-nAChR, characterized in that, It includes the polypeptide targeting α7-nAChR as described in claim 1 and the radionuclide used for labeling.

3. The radionuclide imaging probe targeting α7-nAChR according to claim 2, characterized in that, The radionuclide used for labeling is a diagnostic radionuclide or a therapeutic radionuclide.

4. The radionuclide imaging probe targeting α7-nAChR according to claim 2 or 3, characterized in that, The structural formula of the radionuclide imaging probe targeting α7-nAChR is as follows: 。 5. A method for preparing a radionuclide imaging probe targeting α7-nAChR according to any one of claims 2-4, characterized in that, Includes the following steps: S1, Synthesis of radioactive probe precursor: The polypeptide 12C-1 targeting α7-nAChR as described in claim 1 was modified with polyethylene glycol and coupled with the bifunctional chelating agent pSCN Bn NOTA to obtain the radioactive probe precursor NOA-PEG8-12C-1. S2, [¹ 8 F] Fluoride ion enrichment and purification: [¹] 8 F] ions were enriched on an activated Sep Pak light QMA column, which was pretreated sequentially with 5 mL of physiological saline and 10 mL of double-distilled water, and then eluted with 0.2 mL of acetonitrile solution containing 2% physiological saline at a volume ratio of 50:50 to obtain purified [¹] ions. 8 F] Fluoride ion eluent; S3, [ 18 F] Reaction with precursor: In a reaction flask, the radioactive probe precursor NOTA-PEG8-12C-1 solution obtained in S1 was mixed with AlCl3 solution, followed by the addition of 37 GBq. 18 The F-eluent was prepared with physiological saline / acetonitrile and reacted at 110 °C with magnetic stirring for 15 min to complete the radiolabeling. The precursor solution and AlCl3 solution were prepared with 0.2 M acetate buffer at pH 4. S4, C18 column purification: The C18 column was pre-activated with anhydrous ethanol and double-distilled water; after cooling the reaction solution, the sample was loaded and eluted with 30 mL of double-distilled water to remove free [¹]. 8 F] Fluoride ion impurities were removed, and the target product was then eluted with a 50:50 volume ratio of ethanol / double-distilled water mixture. S5, Product purification: The eluted product solution was filtered through a 0.22 μm filter membrane for sterilization to obtain a PET imaging probe targeting α7-nAChR. 18 F]AlF-NOTA-PEG8-12C-1.

6. Application of a radionuclide imaging probe targeting α7-nAChR in the preparation of formulations for detecting the expression level of α7-nAChR in tumors.

7. Application of a radionuclide imaging probe targeting α7-nAChR in the preparation of a formulation for diagnosing tumors with high expression of α7-nAChR.

8. The application according to claim 7, characterized in that, The application of the radionuclide imaging probe in the preparation of PET imaging agents for diagnosing non-small cell lung cancer, pheochromocytoma, cholangiocarcinoma, and breast cancer.

Images