Function and application of GmRing protein in regulating plant height

Abstract

The application discloses functions and application of GmRing protein in regulating plant plant height, and the GmRing protein is a protein with an amino acid sequence of sequence 1 in a sequence listing. The application finds that overexpression of the GmRing domain can increase the soybean plant height, aims to provide a key target resource for regulating the soybean plant height, and provides a new research idea for directional improvement of the soybean plant height. In the future, new technology for regulating the soybean plant height can be developed by directional gene editing and mutation of a gene containing the domain, a new path for cultivating a soybean variety with a high plant height meeting requirements is provided, and the application has definite application potential.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and more specifically, to the function and application of GmRing protein in regulating plant growth. Background Technology

[0002] Soybeans are a core oilseed, grain crop, and source of plant protein in my country, and their yield and quality are directly related to national food security and agricultural industry development. Plant height is a key agronomic trait of soybeans. Reasonably increasing plant height can optimize the plant canopy structure, increase biomass accumulation, and provide support for yield improvement. At the same time, it is also an important improvement target in soybean targeted breeding to adapt to different planting scenarios and improve production stability.

[0003] Currently, soybean plant height regulation mainly relies on traditional breeding and genetic engineering breeding. Traditional breeding suffers from drawbacks such as long cycles, low selection efficiency, and difficulty in precise targeted regulation, and is prone to negative linkages with agronomic traits, failing to meet the demands of modern breeding for high efficiency and precision. Genetic engineering breeding, as a key means to overcome traditional bottlenecks, focuses on discovering and regulating functional genes related to plant height. However, the current resources of such genes are significantly insufficient, limiting the expansion of soybean plant height regulatory gene resources and technological innovation. Therefore, discovering novel and highly efficient soybean plant height regulatory genes or fragments and constructing a precise regulation technology system are critical issues that urgently need to be addressed in this field.

[0004] Ring proteins are a superfamily of proteins containing conserved Ring domains. They comprise a large number of genes and participate in various physiological processes, including ubiquitination, signal transduction, and gene expression regulation. In soybean, no specific Ring protein domain has been found to directly regulate soybean plant height, and there are no publicly available technologies for overexpressing this specific domain to increase or target soybean plant height. Summary of the Invention

[0005] The purpose of this invention is to provide the application of GmRing protein and its coding sequence in regulating plant growth.

[0006] This invention relates to proteins, specifically proteins as described in A1), A2), or A3): A1) The amino acid sequence is that of the protein in sequence 1 of the sequence listing; A2) A protein that has more than 90% identity with the protein shown in A1) and is related to plant height, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0007] The protein is derived from soybeans.

[0008] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0009] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0010] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0011] In the aforementioned proteins, the 90% or more identity can be at least 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0012] This invention relates to biomaterials related to said protein, which are any one of B1) to B9) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).

[0013] Of the above-mentioned biological materials, B2) describes an expression cassette containing a nucleic acid molecule encoding GmRing. GmRing A gene expression cassette (GmRing) is a DNA cassette capable of expressing GmRing in a host cell. This DNA may include not only a promoter that initiates transcription of the GmRing gene, but also a terminator. GmRing Transcription terminator. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) PlantPhysiology 120:979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1)). 0099169.7), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (I 985Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0014] Existing plant expression vectors can be used to construct structures containing the aforementioned... GmRing Recombinant expression vectors for gene expression cassettes. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as Agrobacterium crown gall induction (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methatrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0015] In the aforementioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0016] Furthermore, B1) The nucleic acid molecule described is a cDNA molecule or DNA molecule whose coding sequence is sequence 1 in the sequence listing.

[0017] This invention relates to a plant growth promoter containing the protein and / or the biological material.

[0018] Any of the following applications of the protein or biological material, P1-P3, shall be within the scope of protection of this invention: P1. Application of the protein or biomaterial in regulating plant height; P2. Application of the protein or biomaterial in the preparation of products that increase plant height; P3. Application of the protein or biological material in cultivating taller plants.

[0019] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0020] Furthermore, the plant is Arabidopsis thaliana or soybean.

[0021] This invention relates to a method for cultivating taller plants, comprising increasing the expression level of the protein or its encoding gene in the target plant to obtain taller plants; wherein the height of the taller plants is greater than that of the target seed plants.

[0022] Furthermore, the target plant is a monocotyledonous plant or a dicotyledonous plant.

[0023] Furthermore, the target plant is Arabidopsis thaliana or soybean.

[0024] The beneficial effects of this invention are as follows: This invention discovers that overexpression of the GmRing domain can increase soybean plant height, aiming to provide a key target resource for regulating soybean plant height. This provides a novel research approach for targeted improvement of soybean plant height. Subsequently, through targeted gene editing, genes containing this domain can be mutated to develop new technologies for regulating soybean plant height, providing a new path for breeding tall soybean varieties that meet specific needs, and demonstrating clear application potential. This invention focuses on the specific protein domain GmRing. If its regulatory function can be clarified and utilized, it will not only enrich the molecular mechanisms of soybean plant height regulation but also provide a novel and efficient resource and technical means for plant height regulation gene fragments. This fills the research gap in the field of specific Ring protein domains in soybean plant height regulation and provides an important prerequisite for subsequent targeted editing, mutation of genes containing this domain, and advancement of targeted improvement of soybean plant height. Attached Figure Description

[0025] Figure 1 Molecular detection and plant height phenotype of transgenic positive materials constructed using GmRing overexpression vectors. Specifically: (A) Construction of GmRing overexpression vectors; (B) Western-Blot detection of GmRing overexpression transgenic materials; (C) Phenotype of GmRing overexpression transgenic plants; (D) Statistical analysis of plant height phenotype of GmRing overexpression transgenic plants. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0028] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0029] The “Williams 82” soybean and Tianlong No. 1 “TL-1” soybean mentioned in the following examples are both well-known and commonly used, as seen in the literature “GmCRY1s Modulate Gibberellin Metabolism to Regulate Soybean ShadeAvoidance in Response to Reduced Blue Light and GmEID1 modulates light signaling through the Evening Complex to control flowering time and yield in soybean”.

[0030] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged. Invention Overview: This invention explores the function of GmRing in the regulation of soybean plant architecture and constructs a GmRing overexpression vector driven by the 35S promoter (e.g., Figure 1 As shown in A), corresponding overexpression transgenic lines were obtained. Immunoblotting results confirmed that the GmRing-GFP fusion protein was expressed in all overexpression lines, while no signal was observed in the wild-type. The Hsp82 internal control content was basically the same in both wild-type and overexpression transgenic materials (e.g., ...). Figure 1 (As shown in B). Phenotypic analysis showed that, compared with the wild-type TL1, the GmRing overexpression line (GmRing-OE1) exhibited a phenotype of increased plant height, compared with the wild-type (e.g., wild-type TL1). Figure 1 As shown in C), further statistical analysis of plant height data from more than 15 transgenic materials revealed that GmRing-OE1 was significantly taller than wild-type TL-1 (as shown in C). Figure 1 (As shown in Figure D, P < 0.001). These results indicate that GmRing can promote soybean plant height elongation. In conclusion, GmRing plays an important biological role in mediating the soybean plant height regulation pathway.

[0032] Example 1: Acquisition of GmRing Sequence This invention provides primers for constructing overexpression vectors, including primers for amplifying GmRing-coding specific sequences: GmRing-F: ATGGAACGAAGTGGCGGAAT (sequence 4); GmRing-R: CCCCGCCTTGGAACTGTTTC (Sequence 5); Universal primers for homologous recombination ligation of pDONRzeo introductory vectors: pDONR-GmRing-F: TACAAAAAAGCAGGCTTCATGGAACGAAGTGGCGGAAT (sequence 6); pDONR-GmRing-R: GTACAAGAAAGCTGGGTCCCCCGCCTTGGAACTGTTTC (sequence 7); 1.1. Extraction of total RNA from soybeans The plant material used was "Williams 82" seedlings grown under full light for 10 days. Total RNA was extracted using the Trizol (TIANGEN) method. The experiment required the use of plastic containers treated with 0.1% DEPC water or RNase-free pipette tips and centrifuge tubes. The steps are as follows: a) Using tweezers, take approximately 0.3 g of fresh leaves from Williams 82 plants grown under full light and quickly transfer them to a 1.5 mL Eppendorf centrifuge tube containing small steel balls. Then, place the tube in liquid nitrogen for rapid freezing. Use a sampler to pulverize the sample (each sample is pulverized at the highest speed for 10-15 s, then cooled again in liquid nitrogen, repeated 3-5 times). b) Add 1 mL of Trizol to the centrifuge tube, quickly invert to mix thoroughly, and let stand at room temperature for about 15 min to fully inhibit RNase activity; c) Add 200 μL of chloroform, mix well, and let stand at room temperature for 10 min; d) Centrifuge at 12000 rpm for 15 min at 4℃, transfer 500 μL of the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of pre-cooled isopropanol, mix by inversion, and let stand at -20℃ for at least 1 h. e) Centrifuge at 12,000 rpm for 10 min at 4℃, discard the supernatant. The RNA will adhere to the tube wall. Then resuspend the RNA twice with 75% ethanol prepared with pre-cooled DEPC water. Centrifuge at 10,000 rpm for 3 min at 4℃ each time, and discard the supernatant. f) Then aspirate the remaining liquid at the bottom and let it stand at room temperature for 3-6 minutes to allow the alcohol to evaporate fully. Note that the time should not be too long, otherwise the RNA will not be easily soluble in water. g) Add 50 μL of DEPC water to dissolve completely, and test the RNA concentration (UV spectrophotometer) and integrity (agarose gel electrophoresis) before storing at -20℃ or -80℃.

[0033] 1.2. Obtaining soybean cDNA The RNA reverse transcription kit uses TransGen Biotech's Transcript One-Step gDNA Removal and cDNA Synthesis Super Mix.

[0034] 1) The reaction system is as follows: Total RNA 50 ng - 5 μg; Oligo (dT) 18 Primer 1 μL; 2×TS Reaction Mix 10 μL; Transcript RT / RI Enzyme Mix1 μL; gDNA Remover 1 μL; RNase-free Waterx uL; Total volume 20 μL.

[0035] 2) The reaction procedure is as follows: 42℃ for 30 min; 85℃ for 5 seconds; 4℃∞; Store the product at -20℃ for later use.

[0036] 1.3. PCR amplification products The template used for PCR is cDNA derived from reverse transcription, which needs to be diluted 20-fold or 50-fold before amplification. The primers used are pDONR-GmRing-F and pDONR-GmRing-R.

[0037] After recovering the product by agarose gelation, it was stored at -20°C for later use.

[0038] 1) The reaction system is as follows: 2×Buffer 25 μL; dNTP 10 μL; ddH2O 10 μL; PrimerF / R 1.5 μL / 1.5 μL; Temple 1 μL; KOD FX 1 μL; Total volume 50 μL.

[0039] 2) The reaction procedure is as follows: 94℃ for 2 min; 98℃ for 10 seconds; The temperature can be adjusted by 30 seconds to 57℃. 68℃ 1 kb / min; cycles35 ×; 68℃ for 5 min; 4℃∞.

[0040] 1.4. Recovery of amplification products (Axygen DNA Gel Recovery Kit) PCR product recovery requires electrophoresis on a 1% agarose gel, followed by observation and image storage using a gel imaging system. The agarose gel containing the target band is excised, and the target fragment is recovered using the Axygen DNA Gel Recovery Kit. The steps are as follows: a) Cut off the agarose gel containing GmRing-Domain, blot the liquid off the surface of the gel with a paper towel, and then chop it up. Calculate the weight of the gel, which is taken as a gel volume (e.g., 100 mg = 100 μL volume); b) Add 3 times the gel volume of buffer DE-A, mix well, and heat at 65°C until the gel block is completely melted; c) Add 0.5 times the volume of buffer DE-A to buffer DE-B and mix thoroughly. When the isolated DNA fragment is less than 400 bp, add an additional gel volume of isopropanol. d) Transfer the mixture from the previous step to a DNA preparation tube and centrifuge at 12,000 g for 1 min. Discard the filtrate. e) Place the preparation tube back into a 2 mL centrifuge tube, add 500 μL buffer W1, centrifuge at 12,000 g for 30 s, and discard the filtrate; f) Place the preparation tube back into a 2 mL centrifuge tube, add 700 μL buffer W2, centrifuge at 12,000 g for 30 s, and discard the filtrate; g) After repeated washing, place the preparation tube back into a 2 mL centrifuge tube, centrifuge at high speed for 5 min, and then remove the preparation tube and place it indoors to allow the alcohol to evaporate completely. h) Place the preparation tube into a clean 1.5 mL centrifuge tube, add 25-30 μL of ddH2O to the center of the membrane, and incubate at room temperature for 5 min. Elute the DNA by centrifuging at 12,000 g for 1 min; a second elution can be performed. Store the recovered product at -20℃ for later use.

[0041] 1.5. Connection Conversion (Gateway® Clonase® II Enzyme mix kit) BP reaction attB-GmRing-Domain 1 μL; pDNOR-Zeo1 μL; BP Enzyme 0.5 μL; The reaction was carried out at 25°C overnight.

[0042] LR reaction pDNOR-Zeo-GmRing-Domain1 μL; pEarleyGate 1011 μL; LR Enzyme 0.5 μL; The reaction was carried out at 25°C overnight.

[0043] 1.6. Screening for positive monoclonal antibodies and sequencing Pick up 6 single clones from the overnight 37°C plates using a toothpick, streak them onto an LB agar plate containing antibiotics, then gently stir the tube containing the PCR reaction mixture a few times with the toothpick, and use primers. attB-F: GTGGGGACAAGTTTGTACAAAAAAGCAGGCTTC (Sequence 8); and attB-R: GTGGGGACCACTTTGTACAAGAAAGCTGGGTC (sequence 9); Perform colony PCR identification. Multiple single clones can be picked and labeled on the plate to increase the probability of obtaining positive clones. Then, incubate the plate overnight at 37°C.

[0044] 1) Reaction system: (2 × Taq MasterMix purchased from Kangwei Company) 2 × Taq MasterMix 5 µL; Primer (F / R) 0.2 / 0.2 µL; Monoclonal plaques -- ddH2O 4.6 µL; 2) Reaction procedure: Preheat at 95℃ for 2 min; denature at 95℃ for 30 s, anneal at 57℃ for 30 s, extend at 72℃ for 30 s (2 kb / min), 35 cycles; final extend at 72℃ for 5 min; store at 12℃.

[0045] PCR products were detected by electrophoresis. Clones containing the target fragment (DNA molecule shown in sequence 2) were streaked onto the corresponding plates and sent for sequencing. Primers for sequencing were used. M13-F: GTAAAACGACGGCCAGT (Sequence 10); M13-R: CAGGAAACAGCTATGAC (Sequence 11); If the sequencing result contains the nucleotides shown in Sequence 2 of the sequence listing, the corresponding monoclonal transformant is a positive monoclonal bacterium. A positive monoclonal bacterial culture is a positive monoclonal bacterium containing the recombinant vector GmRing of Sequence 2.

[0046] 1.7 Extraction of positive monoclonal plasmids For positive single clones with correct sequencing, amplify the bacterial culture, extract plasmids using a kit, and follow these steps: a) Take 2 mL of bacterial culture that has been cultured overnight, centrifuge at 12000g for 1 min, and discard the supernatant.

[0047] b) Add 250 μL of Buffer S1 (containing RNase) and pipette to suspend the bacterial pellet, making sure it is homogeneous.

[0048] c) Add 250 μL of Buffer S2 and gently invert several times to mix thoroughly, allowing the bacterial cells to lyse completely until a clear solution is formed. This step should not exceed 5 minutes to prevent plasmid DNA from being lysed.

[0049] d) Add 350 μL Buffer S3, mix gently and thoroughly several times, and centrifuge at 12000 g for 10 min.

[0050] e) Transfer the supernatant to the preparation tube (placed in a 2 mL centrifuge tube), centrifuge at 12000 g for 1 min, and discard the filtrate.

[0051] f) Place the preparation tube back into the 2 mL centrifuge tube, add 500 μL Buffer W1, centrifuge at 12000 g for 1 min, and discard the filtrate.

[0052] g) Place the preparation tube back into the centrifuge tube, add 700 μL Buffer W2, centrifuge at 12000 g for 1 min, discard the filtrate; repeat once.

[0053] h) Place the preparation tube back into a 2 mL centrifuge tube and centrifuge at 12000 g for 1 min.

[0054] i) Transfer the preparation tube into a clean 1.5 mL centrifuge tube, add 40 μL of ddH2O to the center of the adsorption membrane, and let stand at room temperature for 1 min. Centrifuge at 12000 g for 1 min to elute the plasmid DNA, and obtain the purified recombinant vector plasmid pEarleyGate 101-GmRing.

[0055] Example 2: Obtaining GmRing overexpressing transgenic soybean plants After constructing the plasmid containing GmRing and transforming it into Agrobacterium, soybean transformation was carried out.

[0056] 2.1. Preparation and transformation of Agrobacterium competent cells a) Preparation of Agrobacterium competent cells Single colonies of Agrobacterium EHA105 were picked and placed in 5 mL of LB broth containing the corresponding antibiotic (EHA105 resistance: 100 μg / mL rifampin). The culture was incubated overnight at 28°C. 500 μL of the overnight culture was inoculated into 50 mL of LB broth containing the corresponding antibiotic and incubated at 28°C until the OD600 reached approximately 0.5. The culture was then placed on ice for 30 min. The cells were centrifuged at 5,000 rpm for 10 min at 4°C, and resuspended in 15 mL of pre-chilled 10 mM CaCl2. The resuspended pellet was then centrifuged again at 5,000 rpm for 10 min at 4°C. The pellet was resuspended in 2 mL of pre-chilled 10 mM CaCl2, aliquoted into 100 μL tubes on ice, flash-frozen in liquid nitrogen, and stored at -80°C.

[0057] b) Agrobacterium-mediated transformation Thaw 100 μL of competent cells on ice, add 1 μg of plasmid DNA, mix well, place on ice for 30 min, flash freeze in liquid nitrogen for 3-5 min, and immediately place in a 37°C water bath for 5 min. Add 1 mL of antibiotic-free LB liquid medium, and thaw at 28°C and 160 rpm for 3-5 h. Spread the bacterial culture evenly onto solid medium containing the appropriate antibiotic. Incubate upside down at 28°C.

[0058] 2.2. Soybean Conversion a) Wild-type Tianlong No. 1 soybeans sterilized with chlorine gas produced by the reaction of concentrated hydrochloric acid and sodium hypochlorite were shaken for incubation.

[0059] b) Cut the beans in half, remove part of the germ tip, make a cut in the meristematic area of ​​the bean, and soak it in sterile water. In the afternoon, take out the shaken bacterial solution, centrifuge (4000 rpm, 10 min) to make the OD value of the bacterial solution = 0.4~0.6, pour out the sterile water from the beans, add the prepared bacterial solution, place it in a shaker and shake for 30 min (28℃, about 200 rpm), take it out and blow it for about 10 min, then spread it evenly on co-culture medium and incubate in the dark for 3 days.

[0060] c) After 3 days of dark incubation, the embryos will grow longer. Wash them 4-5 times each with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is completely removed.

[0061] d) Cut off the grown embryo, leaving only 3-4 mm in length. Insert the embryo downwards and the wound side upwards into the solid induction medium at an angle and place it in a greenhouse for light cultivation.

[0062] e) After 10 days of cultivation in the greenhouse, some soybeans began to sprout. Those with sprouts were cut off from the base of the plant and transferred to a new solid induction culture medium. Those without sprouts were discarded.

[0063] f) After culturing in the greenhouse for 10 days, the sprouted beans were subcultured into a new solid induction medium, while the beans that did not sprout were discarded. The beans were then cultured in the greenhouse for another 10 days. The beans were cultured in the solid induction medium for a total of 30 days.

[0064] g) Separate the callus from the bean, discard the bean, scrape off the black surface of the callus, and transfer it to a solid elongation medium. Replace the solid elongation medium every 20 days, and generally subculture 3-4 times, for a total of 60-80 days.

[0065] h) Callus is being screened while it is elongating and being cultured, and seedlings will grow during the screening process.

[0066] i) When the seedlings grow to more than 100 mL, cut them off from the callus and transfer them to the rooting medium.

[0067] j) After the seedlings have been cultured in the culture medium for about 20-30 days, they can be placed in a shaded area to harden off, usually for five days.

[0068] k) Label each seedling with the bean variety, gene name, rooting date, soil cultivation date, and the name of the person who cultivated it. Add an appropriate amount of water, green manure, and slow-release fertilizer, cover with a thin film, and place under light to allow it to adapt to strong light. Remove the film after 3 days.

[0069] Example 3: Identification and Phenotypic Observation of GmRing Overexpression Positive Lines 3.1 Identification of GmRing overexpression positive lines To identify positive overexpression transgenic plants, leaves from the T0 generation transgenic material were collected, added to the extraction buffer of a Basta detection kit (Boyuan Biotechnology), and then homogenized and lysed. The supernatant was then applied to a Basta test strip to detect the presence of the Basta resistance gene fragment (Sequence 3 in the sequence listing). The obtained T0 generation transgenic plants were self-crossed three times to obtain the T3 generation. GmRing Gene overexpression transgenic lines. Western blot analysis was used to detect transgenic progeny expression. The specific steps are as follows: a) Sample preparation: Use a punch to take tender leaves (or other tender tissues) of GmRing overexpressing plant seedlings of uniform size, put them into a 1.5 mL centrifuge tube containing 2-3 steel balls, quickly put them into liquid nitrogen for flash freezing, shake them in a cryogenic sampler to fully break down the plant tissue, and return them to liquid nitrogen for later use. b) Protein sample preparation: Remove the fragmented sample from liquid nitrogen and place it on ice. Let it stand for about 30 seconds to allow it to warm slightly, being careful not to let it thaw for too long to avoid degradation. Quickly add an appropriate amount of 1x loading buffer to the centrifuge tube, vortex rapidly to mix thoroughly, and then place it in a 99°C metal bath for denaturation for 5-10 minutes. After denaturation, return it to ice to cool, then centrifuge at 4°C for 10 minutes. Take the supernatant as the sample to be tested. c) SDS-PAGE electrophoresis: Prepare SDS-PAGE gels in advance. The concentration of the separating gel is selected according to the molecular weight of the target protein, generally 8% (>100 kDa), 10% (40–100 kDa), 12% (20–40 kDa), or 15% (<20 kDa). Add 5–10 μL of the protein supernatant from the upper centrifugation to each well, and place the protein marker in the first well. Add sufficient 1× running buffer to the electrophoresis tank and start electrophoresis. Electrophoresis run procedure: 86 V until the sample enters the separating gel (approximately 30–40 min), then 120 V until the bromophenol blue dye front is close to the bottom of the gel (usually 40–60 min). After electrophoresis, remove the gel and prepare for transfer. d) Semi-wet transfer: Soak filter paper and NC membrane in 1× transfer buffer for 3 min to ensure they are fully wetted (if using PVDF membrane, it needs to be activated by soaking in methanol first). Assemble the transfer "sandwich" in the order of filter paper-membrane-gel-filter paper, rolling each layer from the center outwards three times to remove air bubbles, ensuring close contact between the gel and the membrane. Transfer conditions: 20 V, 50 min (for high molecular weight proteins, the transfer time can be increased appropriately); e) Transfer quality check (optional): Place the membrane in a virgin red solution and gently shake for 1-2 min. Rinse the surface with ddH2O to remove excess virgin red solution. Observe the Rubisco bands to confirm whether the transfer is successful. Take a photo for record-keeping and then rinse with 1×PBST 2-3 times to remove the dye. f) Blocking: Place the membrane in 1×PBST blocking solution containing 5% skim milk powder and gently shake it on a horizontal shaker at room temperature for about 1 hour; g) Primary antibody incubation: Dilute the primary antibody 1:2000 with the 5% skim milk powder / 1×PBST prepared in the previous step (the optimal dilution ratio should be selected according to the antibody instructions for different antibodies). After completely covering the membrane, incubate at room temperature on a horizontal shaker for 1.5 h. After incubation, discard the primary antibody solution and wash the membrane 5 times with sufficient 1×PBST on a horizontal shaker for 6 min each time. h) Secondary antibody incubation: Dilute the secondary antibody 1:5000 (the optimal dilution ratio should be selected according to the antibody instructions for different antibodies) in 5% skim milk powder / 1×PBST, cover the membrane and incubate at room temperature on a horizontal shaker for 1 hour. After incubation, wash the membrane 5 times with 1×PBST for 6 minutes each time to thoroughly remove unbound secondary antibody; i) Colorimetric imaging: Prepare the A / B colorimetric solution according to the instructions for the reagents used, mix them in equal proportions, evenly cover the membrane, and expose and develop. Save the image after development for subsequent analysis.

[0070] 3.2 Observation of plant height phenotype in GmRing overexpression materials GmRing-overexpressing plants and wild-type Tianlong 1 soybean seeds were sown in a plant culture box and grown under long-day conditions (16 hours light and 8 hours darkness) for 14 days. Plant height was measured afterward, with 15 seedlings selected from each line for measurement. Results showed that compared to wild-type Tianlong 1, GmRing-overexpressing plants exhibited significantly greater plant height. Figure 1 C / D) The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

[0071] sequence list Sequence 1: GmRing amino acid sequence MERSGGMVTGSHERNELVRVRHGSDRSSKPLKNLNGQSCQICGDTIGLTATGDVFVACHECGFPLCHSCYEYELKHMSQSCPQCKTAFTSHQEGAEVEGDDDDEDDADDLDNEINYGQGNSSKAG Sequence 2: GmRing encoded sequence ATGGAACGAAGTGGCGGAATGGTAACTGGGTCGCATGAAAGGAACGAACTTGTTAGAGTTAGACACGGCTCTGATAGTAGGTCTAAACCCTTGAAGAATTTGAATGGTCAGAGTTGTCAAATATGTGGTGATACCATTGGATTAACGGCTACTGGTGATGTCTTTGTCGCTTGTCATGAGTGTGGCTTCCCACTTTGTCATTCTTGTTACGAGTATGAGCTGAAACATATGAGCCAGTCTTGTCCCCAGTGCAAGACTGCATTCACAAGTCACCAAGAGGGTGCTGAAGTGGAGGGAGATGATGATGATGAAGACGATGCTGATGATCTAGATAATGAGATCAACTATGGCCAAGGAAACAGTTCCAAGGCGGGG Sequence 3: BASTA resistance gene fragment TCAAATCTCGGTGACGGGCAGGACCGGACGGGGCGGTACCGGCAGGCTGAAGTCCAGCTGCCAGAAACCCACGTCATGCCAGTTCCCGTGCTTGAAGCCGGCCGCCCGCAGCATGCCGCGGGGGGCATATCCGAGCGCCTCGTGCATGCGCACGCTCGGGTCGTTGGGCAGCCCGATGACAGCGACCACGCTCTTGAAGCCCTGTGCCTCCAGGGACTTCAGCAGGTGGGTGTAGAGCGTGGAGCCCAGTCCCGTCCGCTGGTGGCGGGGGGAGACGTACACGGTCGACTCGGCCGTCCAGTCGTAGGCGTTGCGTGCCTTCCAGGGGCCCGCGTAGGCGATGCCGGCGACCTCGCCGTCCACCTCGGCGACGAGCCAGGGATAGCGCTCCCGCAGACGGACGAGGTCGTCCGTCCACTCCTGCGGTTCCTGCGGCTCGGTACGGAAGTTGACCGTGCTTGTCTCGATGTAGTGGTTGACGATGGTGCAGACCGCCGGCATGTCCGCCTCGGTGGCACGGCGGATGTCGGCCGGGCGTCGTTCTGGGCTCAT

Claims

1. Protein, specifically proteins that are A1), A2), or A3): A1) The amino acid sequence is that of the protein in sequence 1 of the sequence listing; A2) A protein that has more than 90% identity with the protein shown in A1) and is related to plant height, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The biological material related to the protein of claim 1 is any one of B1) to B9) below: B1) A nucleic acid molecule encoding the protein of claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Reduce the amount of nucleic acid molecules expressed by the protein of claim 1; B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

3. The related biomaterial according to claim 2, characterized in that: B1) The nucleic acid molecule is a cDNA molecule or DNA molecule whose coding sequence is sequence 1 in the sequence listing.

4. A plant growth promoter, characterized in that: The pharmaceutical preparation contains the protein of claim 1 and / or the biological material of claim 2 or 3.

5. Any one of the following applications of the protein of claim 1, or the biomaterial of claim 2 or 3, P1-P9: P1. The application of the protein of claim 1, or the biomaterial of claim 2 or 3, in regulating plant growth rate; P2. The use of the protein of claim 1, or the biomaterial of claim 2 or 3, in the preparation of products that improve plant height; P3. The application of the protein of claim 1, or the biomaterial of claim 2 or 3, in the cultivation of taller plants.

6. The pharmaceutical preparation according to claim 4, or the application according to claim 5, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant.

7. The pharmaceutical preparation according to claim 4, or the application according to claim 5, characterized in that: The plant in question is either Arabidopsis thaliana or soybean.

8. A method for cultivating taller plants, comprising increasing the expression level of the protein of claim 1 or its encoding gene in a target plant to obtain a taller plant; wherein the height of the taller plant is greater than that of the target seed plant.

9. The method according to claim 8, characterized in that: The target plant is a monocotyledonous plant or a dicotyledonous plant.

10. The method according to claim 9, characterized in that: The target plant is Arabidopsis thaliana or soybean.

Images