Tomato leafminer 5-hydroxytryptamine receptor gene 5-ht2 and application thereof in controlling tomato leafminer

Abstract

The application relates to the field of agricultural biotechnology, in particular to a tomato leaf tier 5-hydroxytryptamine receptor gene 5- HT2 and application thereof in preventing and treating tomato leaf tier. The tomato leaf tier 5-hydroxytryptamine receptor gene codes a protein with an amino acid sequence as shown in SEQ ID NO: 1. The CRISPR / Cas9 technology is used to edit the tomato leaf tier 5-hydroxytryptamine receptor gene, and the edited gene is confirmed by PCR and DNA sequencing 5-HT2 The deletion of the 5-hydroxytryptamine receptor gene will result in the reduction of the egg laying amount and the egg hatching rate of the female insects compared with the control. 5-HT2 The dissection shows that the ootheca tube of the ovary of the female insect is abnormal. 5-HT2 5-HT2 5-HT2 5-HT2 5-HT2 5-HT2 The gene plays a key role in the reproductive behavior of the tomato leaf tier, and provides a target gene for the prevention and treatment of the tomato leaf tier.

Description

Technical Field

[0001] This application relates to the field of agricultural biotechnology, specifically to the 5-HT2 gene of the tomato leafminer moth and its application in controlling the tomato leafminer moth. Background Technology

[0002] Tomato leafminer Tuta absoluta The tomato leafminer (Meyrick), belonging to the family Gelechiidae in the order Lepidoptera, is a globally recognized quarantine pest. It has a wide host range, with reported damage covering 41 genera and 9 families. It primarily infests Solanaceae crops, including tomatoes, potatoes, peppers, and eggplants.

[0003] Biogenic amines are important neurotransmitters and physiological regulators present in insects, maintaining normal growth and development. 5-hydroxytryptamine (5-HT), as a type of biogenic amine, is a core member, serving as both a key neurotransmitter and an important signaling molecule regulating insect metabolism. It primarily transmits nerve signals and regulates various life activities such as growth, development, and reproduction by binding to specific 5-HT receptors within insects. This binding process is a core component of the insect neural regulatory network.

[0004] Currently, no published research has clearly reported the specific identification results or functional analysis of the biogenic amine receptor genes in the tomato leafminer (Tuta absoluta).

[0005] The 5-HT receptors identified in insects mainly belong to three families (5-HT1, 5-HT2, and 5-HT7), and are similar to those in mammals, all belonging to the G protein-coupled receptor (GPCR) family. Currently, research on 5-HT receptors in insects... 5-HT The identification of receptor genes remains insufficient, with extremely limited species coverage. Research is highly concentrated on model insects such as the Drosophila melanogaster, silkworm, and Anopheles gambiae, while research on non-model insect groups that cause serious damage to agricultural production, especially invasive lepidopteran pests, remains unclear. Research on the 5-hydroxytryptamine receptor gene of the tomato leafminer is needed. 5-HT1 Functional studies will help to gain a deeper understanding of its role in regulating the growth and development of the tomato leafminer, in order to provide potential target genes for RNAi control of the tomato leafminer. Summary of the Invention

[0006] The purpose of this invention is to provide a 5-hydroxytryptamine receptor gene for the tomato leafminer moth. 5-HT2 .

[0007] Another object of the present invention is to provide the role of the above-mentioned 5-hydroxytryptamine receptor gene in the development of tomato leafminer larvae.

[0008] According to a specific embodiment of the present invention, the 5-hydroxytryptamine receptor gene of the tomato leafminer was cloned for the first time. 5-HT2 The full-length nucleotide sequence of its cDNA coding region is shown in SEQ ID NO:1: The amino acid sequence encoded by the 5-HT2 gene of the tomato leafminer is shown in SEQ ID NO:2: .

[0009] This invention provides the above-mentioned tomato leafminer. 5-HT2 Applications. The tomato leafminer was edited using CRISPR / Cas9 technology. 5-HT2 Receptor gene, acquired deletion 5-HT1 Homozygous mutants of receptor gene expression, with clear deletion 5-HT2 The recipient gene resulted in a decrease in egg production to 5.83 ± 0.55 eggs compared to the control, and a decrease in the hatching rate to 2.43%. P <0.001). Dissection revealed abnormal development of the ovarian ducts in the female worm's ovary. The results indicate... 5-HT2 Genes play a key role in the reproductive behavior of the tomato leafminer, providing target genes for its control. Attached Figure Description

[0010] Figure 1 Showing tomato leafminer 5-HT2 Expression analysis at different developmental stages; Figure 2 Showing tomato leafminer 5-HT2 The number of eggs laid by the mutant within 7 days and the hatching rate of the eggs; Figure 3 Showing tomato leafminer 5-HT2 anatomical phenotype of mutant ovaries. Detailed Implementation Example 1: Cloning of the full-length cDNA sequence of the 5-HT2 gene of the tomato leafminer

[0011] Three tomato leafminer larvae were placed in 1.5 mL centrifuge tubes and frozen in liquid nitrogen for 5 min. The samples were then homogenized using a grinder to extract RNA, which was stored at -80 °C for later use. The extracted RNA was reverse transcribed into cDNA using a TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for PCR kit. Primers were designed, and PCR amplification was performed using the cDNA as a template. The primers used are as follows: 5-HT2 -F1:5'ACCCTAGGAATGGAAA3' (SEQ ID NO:3); 5-HT2 -R1: 5'CTTGACGGTAATGAATC3' (SEQ ID NO: 4); 5-HT2 -F2: 5'GACACGAGGGACTTGTGGTT3' (SEQ ID NO:5); 5-HT2 -R2: 5'AATACGGTGTCGACTGCTCC3' (SEQ ID NO: 6); 5-HT2 -F3: 5'CGAACGACTAAAGAGACGCCA3' (SEQ ID NO:7); 5-HT2 -R3: 5'GCTGGAGTCCTGTAACCACA3' (SEQ ID NO:8).

[0012] PCR amplification, to obtain 5-HT2 The full-length cDNA coding region of the gene is 1887 bp, and the resulting gene has the nucleotide sequence shown in SEQ ID No: 1. This gene encodes 629 amino acid sequences as shown in SEQ ID No: 2. Example 2: Expression analysis of the 5-HT1 gene at different developmental stages in the tomato leafminer moth

[0013] Eggs, 1st to 4th instar larvae (L1 to L4), pupae, female adults (F), and male adults (M) were collected. RNA extraction and cDNA synthesis were performed as in Example 1. Quantitative real-time PCR was then performed.

[0014] The relative expression level of mRNA is used as 2 -△△Ct The method involved calculation: (∆∆CT = (CT target gene - CT reference gene) treatment group - (CT target gene - CT reference gene) control group). Significance was analyzed using the open-source JASP software, and one-way ANOVA was employed for significant difference analysis. Significant differences were represented using letter notation.

[0015] The primers for real-time quantitative PCR detection are shown below. The results indicate that... 5-HT2 Gene mRNA is expressed at all stages, with high expression during the oviposition stage. Figure 1 ).

[0016] q5-HT2 -F: 5'GGAGCAGTCGACACCGTATT3' (SEQ ID NO:9); q5-HT2 -R: 5'ACCAAAGCTGGACCCTCTTC3' (SEQ ID NO:10); RPL5 -F: 5'CAGTCGTCGAGCCAGCAACA3' (SEQ ID NO: 11); RPL5 -R: 5'TCCCGCATTGAAGGAGACCA3' (SEQ ID NO: 12). Example 3: Identification of the function of the 5-HT1 gene in the tomato leafminer

[0017] To ensure the mutation rate in the gene editing experiment, three sgRNAs were designed, and their sequences are shown below: 5-HT2 sgRNA1: 5'CCTCTATGGTCACTTGGGACGAA3' (SEQ ID NO: 13); 5-HT2 sgRNA2: 5'AAATGCCCGGCCGCAACAGACGG3' (SEQ ID NO: 14); 5-HT2 sgRNA3: 5'CCGCACCATTCTAGAAACTCTAG3' (SEQ ID NO: 15).

[0018] Total RNA extraction and cDNA synthesis: Same as in Example 1. sgRNA template synthesis, PCR product purification, in vitro sgRNA synthesis and purification. sgRNA was synthesized and purified using a kit, following the kit instructions.

[0019] Eggs collected from tomato leaves within two hours were sequentially attached to coverslips with thin strips of double-sided tape, arranged longitudinally in a line. The coverslips containing the eggs were placed on a slide, and a Cas9 protein-sgRNA mixture was injected into the embryos using a microinjection platform. The coverslips containing the injected eggs were marked, and the embryos were transferred to 150mm disposable culture dishes. Water-soaked cotton balls were placed in the dishes, and the dishes were incubated.

[0020] Using CRISPR / Cas9 technology to obtain tomato leafminer deletion 5-HT2 Homozygous mutants of receptor gene expression, such as Figure 2 and Figure 3 As shown, Figure 2 Figure (a) in the figure shows the spawning rate statistics within 7 days; Figure 2 Figure (b) in the diagram is a schematic diagram of the egg hatching rate. Figure 2 , Figure 3 aa is 5-HT2 Homozygous mutant; Aa is 5-HT2 Heterozygous mutant; AA is wild-type. Clear deletion. 5-HT2 The recipient gene resulted in a decrease in egg production to 5.83 ± 0.55 eggs compared to the control, and a hatching rate of 2.43%. Dissection revealed abnormal development of the ovarian ducts in the female ovaries. This invention discovered... 5-HT2 Genes play a key role in the reproductive behavior of the tomato leafminer, providing target genes for its control.

[0021] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.

Claims

1. The 5-hydroxytryptamine receptor gene for the tomato leafminer moth, characterized in that, The 5-hydroxytryptamine receptor gene of the tomato leafminer encodes a protein with the amino acid sequence shown in SEQ ID NO:

1.

2. The tomato leafminer 5-hydroxytryptamine receptor gene according to claim 1, characterized in that, The nucleotide sequence of the 5-hydroxytryptamine receptor gene of the tomato leafminer is shown in SEQ ID NO:

2.

3. The application of the 5-hydroxytryptamine receptor gene for tomato leafminer as described in claim 1 for the control of tomato leafminer.

4. A method for controlling tomato leafminer, characterized in that, The method includes the step of silencing the 5-hydroxytryptamine receptor gene of the tomato leafminer moth, wherein the 5-hydroxytryptamine receptor gene encodes a protein with the amino acid sequence shown in SEQ ID NO:

1.

5. The method for controlling tomato leafminer according to claim 4, characterized in that, The 5-hydroxytryptamine receptor gene of the tomato leafminer was edited using CRISPR / Cas9 technology.

6. A method for interfering with the ovarian development characteristics of female tomato leafminer moths, characterized in that, The method includes the step of silencing the 5-hydroxytryptamine receptor gene in the tomato leafminer moth, wherein the interference with the ovarian development characteristics of female tomato leafminers includes: Reduce egg production; Reduce the hatching rate of eggs; and This causes abnormal development of the ovarian ducts in female insects.

Images