EcN-M5 probiotic bacteria with GLP-1 secretion function and application thereof in PMOS

Abstract

This invention relates to the field of biomedicine and discloses a method for preparing a strain of *Escherichia coli* Nissle 1917-derived EcN-M5 that efficiently expresses the A8G variant of glucagon-like peptide-1 (GLP-1) and its application in the prevention and / or treatment of polyendocrine metabolic ovarian syndrome (PMOS). This strain was deposited at the China Center for Type Culture Collection (CCTCC) on May 18, 2026, with the accession number CCTCC NO::M 2026990. This invention organically combines the mucosal immunomodulatory function of EcN with the metabolic regulatory function of GLP-1 using synthetic biology methods, achieving stable and continuous secretion of GLP-1 in the intestine. Animal experiments show that EcN-M5 can reduce body fat percentage in PMOS mice, improve glucose and lipid metabolism and insulin resistance, alleviate hyperandrogenemia, restore estrous cycle disorders, and is accompanied by increased serum IL22, gut microbiota remodeling, and specific activation of the tryptophan-indole metabolic pathway.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for preparing Escherichia coli Nissle 1917-derived strain EcN-M5 and its application in the prevention and / or treatment of polyendocrine metabolic ovarian syndrome (PMOS). Background Technology

[0002] Polycystic ovary syndrome (PMOS) is a common reproductive endocrine and metabolic disorder in women of reproductive age. Its main clinical features include hyperandrogenemia, ovulation disorders, and polycystic ovarian morphology, often accompanied by obesity, insulin resistance, and glucose and lipid metabolism disorders. PMOS not only affects patients' reproductive health but is also closely related to long-term complications such as type 2 diabetes, metabolic syndrome, and cardiovascular disease, seriously impacting women's health throughout their lives. Due to the complex pathogenesis and high clinical heterogeneity of PMOS, there is currently a lack of effective treatment strategies that can simultaneously address reproductive abnormalities and metabolic disorders and achieve long-term stable improvement.

[0003] Currently, clinical interventions for PMOS mainly include lifestyle management, hormone-regulating drugs, insulin sensitizers, and GLP-1-related drugs. While these treatments can improve clinical manifestations such as menstrual disorders, hyperandrogenism, insulin resistance, and obesity to some extent, they are still primarily symptom control and single-aspect interventions, and cannot simultaneously cover the multiple pathological aspects of PMOS, including metabolic disorders, chronic low-grade inflammation, intestinal barrier abnormalities, and gut microbiota imbalance.

[0004] Interleukin-22 (IL-22) is an important immune factor for maintaining mucosal barrier integrity, promoting intestinal epithelial repair, and regulating local inflammatory responses, playing a crucial role in intestinal barrier protection and mucosal homeostasis. Previous studies have reported that *Escherichia coli* Nissle 1917 (EcN) can participate in regulating the host intestinal mucosal immune response and can activate or promote IL-22-related mucosal protection pathways, thereby contributing to intestinal barrier maintenance and intestinal homeostasis restoration. Therefore, EcN, as a gut microbiota, not only possesses probiotic properties, genetic operability, and intestinal delivery potential, but also has a biological basis for participating in gut microbiota-mucosal immune regulation. However, EcN itself mainly focuses on gut microbiota and mucosal immune regulation, and still cannot fully cover metabolic abnormalities such as insulin resistance, obesity, and glucose and lipid metabolism disorders in PMOS.

[0005] GLP-1 receptor agonists have shown promise in the intervention of PMOS-related metabolic disorders in recent years, particularly in reducing weight, improving insulin resistance, and regulating glucose metabolism. However, current GLP-1 therapies mainly rely on long-term exogenous administration, leading to issues such as poor adherence and high treatment costs. Furthermore, natural GLP-1 is readily degraded by dipeptidyl peptidase-4 (DPP-4). Therefore, how to continuously provide GLP-1 functional peptides locally in the gut while simultaneously addressing PMOS-related intestinal barrier abnormalities, gut microbiota imbalance, and immune microenvironment dysregulation remains a critical challenge in current technologies.

[0006] Clearly, current technologies lack an engineered probiotic technology that uses EcNΔΔ or its derivatives as a chassis to express and / or secrete GLP-1 or DPP-4-resistant GLP-1 mutants for the prevention, alleviation, or treatment of PMOS-related metabolic abnormalities, reproductive endocrine abnormalities, and gut microbiota-immune disorders. Therefore, developing an oral, live biological therapeutic product that combines "probiotic chassis mucosal immunomodulatory effects" and "GLP-1-like functional peptide metabolic regulatory effects" is of significant application value for expanding comprehensive intervention strategies for PMOS.

[0007] Therefore, we propose an EcN-M5 probiotic strain with GLP-1 secretion function and its application in PMOS. Summary of the Invention

[0008] The purpose of this invention is to provide an EcN-M5 probiotic strain with GLP-1 secretion function and its application in PMOS, in order to solve the technical problems of existing PMOS therapy that cannot simultaneously address reproductive endocrine abnormalities and metabolic disorders, and that exogenous GLP-1 drugs require long-term injection and are prone to failure.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] An Escherichia coli-derived bacterium, EcN-M5, is classified as Escherichia coli Nissle 1917 EcN-M5 and is deposited at the China Center for Type Culture Collection (CCTCCNO:: M 2026990) on May 18, 2026.

[0011] The strain uses *Escherichia coli* Nissle 1917, with endogenous recessive plasmids pMUT1 and pMUT2 removed, as its host bacterium and contains the recombinant plasmid pUCSJM-S3 constructed based on the pUCSJM backbone. pUCSJM-S3 contains a GLP-1 (A8G) secretory expression cassette, which, along the transcriptional direction, sequentially includes the heterozygous constitutive promoter P_Hyb derived from the J23119 and J23101 promoters, a ribosome binding site, and the PelB-GLP-1 (A8G) fusion coding sequence. The PelB-GLP-1 (A8G) fusion coding sequence is a nucleotide sequence optimized based on the codon usage preferences of *E. coli* Nissle 1917. The GLP-1 (A8G) is obtained by replacing Ala8 with Gly in natural human GLP-1 (7–37).

[0012] GLP-1(A8G) is the GLP-1-A8G mutant, which is a mutant formed by replacing the 8th alanine in GLP-1 with glycine.

[0013] The nucleotide sequence of the heterozygous constitutive promoter P_Hyb is shown in SEQ ID NO:1, the nucleotide sequence of the ribosome binding site is shown in SEQ ID NO:2, and the PelB-GLP-1(A8G) fusion coding sequence is shown in SEQ ID NO:3.

[0014] A recombinant plasmid, wherein the recombinant plasmid uses pUCSJM as its backbone and contains a GLP-1 (A8G) secretory expression cassette; the secretory expression cassette includes, along the transcriptional direction, a heterozygous constitutive promoter P_Hyb derived from the J23119 promoter and the J23101 promoter, a ribosome binding site, and a PelB-GLP-1 (A8G) fusion coding sequence; the PelB-GLP-1 (A8G) fusion coding sequence is a nucleotide sequence optimized based on the codon usage preference of *E. coli* Nissle 1917; wherein the nucleotide sequence of the heterozygous constitutive promoter P_Hyb is shown in SEQ ID NO:1, the nucleotide sequence of the ribosome binding site is shown in SEQ ID NO:2, and the PelB-GLP-1 (A8G) fusion coding sequence is shown in SEQ ID NO:3; the recombinant plasmid is named pUCSJM-S3.

[0015] SEQ ID NO:1

[0016] TTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGC

[0017] SEQ ID NO:2

[0018] GTACAGAGACCAGATCTTTTAACTTTAAGAAGGAGATATACATGAAAGAGGAGAAATACTAG

[0019] SEQ ID NO:3

[0020] ATGAAGTATCTATTACCGACAGCAGCAGCAGGCCTACTTTTATTAGCAGCACAACCCGCCATGGCACACGGAGAAGGAACGTTCACTAGTGATGTATCATCTTACCTCGAAGGACAAGCAGCAAAAGAGTTTATCGCATGGTTAGTTAAAGGCCGCGGTTAA

[0021] The method for obtaining the *E. coli*-derived strain EcN-M5 is characterized by the following steps: introducing an A8G amino acid substitution into pUCSJM-S2 containing the P_Hyb-PelB-natural human GLP-1(7–37) secretory expression cassette to obtain a recombinant plasmid pUCSJM-S3 containing the P_Hyb-PelB-GLP-1(A8G) secretory expression cassette; introducing pUCSJM-S3 into *E. coli* Nissle 1917 host bacteria (with endogenous recessive plasmids pMUT1 and pMUT2 removed), and screening to obtain positive transformants carrying pUCSJM-S3.

[0022] GLP-1(7–37) refers to the amino acid fragment from position 7 to position 37 of GLP-1.

[0023] A pharmaceutical composition comprising any of the engineered Escherichia coli-derived strains EcN-M5 and pharmaceutically acceptable excipients; wherein the pharmaceutically acceptable excipients include one or more of carriers, diluents, protectants, lyophilization protectants, stabilizers, excipients and embedding materials; wherein the pharmaceutical composition is a lyophilized powder, capsule, granule, microcapsule, suspension or other orally acceptable dosage form suitable for oral administration.

[0024] The use of the Escherichia coli-derived strain EcN-M5 or the pharmaceutical composition described herein in the preparation of a medicament or health product for the prevention, relief and / or treatment of polyendocrine metabolic ovarian syndrome.

[0025] The aforementioned drugs or health products are used to improve metabolic abnormalities caused by polyendocrine metabolic syndrome.

[0026] The metabolic abnormalities are one or more of the following: abnormal weight gain, obesity, insulin resistance, impaired glucose tolerance, elevated fasting blood glucose, dyslipidemia, and abnormal body composition distribution.

[0027] The aforementioned drugs or health products are used to improve reproductive endocrine abnormalities caused by polyendocrine metabolic ovarian syndrome;

[0028] The reproductive endocrine abnormalities include one or more of the following: ovulation disorders, polycystic ovarian changes, decreased number of corpora lutea, estrous cycle disorders, hyperandrogenemia, and abnormal luteinizing hormone to follicle-stimulating hormone ratio.

[0029] This invention has at least the following beneficial effects:

[0030] The EcN-M5 strain provided by this invention organically combines the mucosal immune-regulating function of probiotics with the metabolic regulatory function of GLP-1 through genetic engineering. This enables stable and continuous secretion of GLP-1 in the intestine, overcoming the easy degradation of natural GLP-1. It also significantly improves PMOS-related metabolic disorders, effectively controls weight, and alleviates insulin resistance. Furthermore, it can repair PMOS-related reproductive endocrine abnormalities and restore ovarian function. Additionally, it can reshape the gut microbiota structure and specifically activate the tryptophan-indole metabolic pathway. Simultaneously, it improves dyslipidemia and reduces long-term cardiovascular risk. The chassis strain used in this invention is the known safe probiotic EcN, and the constructed engineered strain EcN-M5 shows no significant difference in growth characteristics from the chassis strain, exhibiting genetic stability. This provides a reliable seed resource guarantee for subsequent industrial fermentation production and quality control. Attached Figure Description

[0031] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1To evaluate the GLP-1 expression capacity and in vitro probiotic properties of engineered strains derived from *Escherichia coli* Nissle 1917ΔΔ. The study included: (A) a schematic diagram of the construction of engineered strains M1–M4; (B) growth curves of *Trichoderma WT* and engineered strains M1–M4; (C) ELISA quantitative analysis of GLP-1 secretion in the culture supernatant of *Trichoderma WT* and engineered strains M1–M4; (D) construction of the GLP-1 (A8G) mutant engineered strain M5; (E) growth curves of *Trichoderma WT* and engineered strains M2 and M5; (F) ELISA quantitative analysis of GLP-1 secretion in the culture supernatant of *Trichoderma WT* and engineered strains M2 and M5; (G) acid tolerance of *Trichoderma WT* and engineered strains; and (H) bile salt tolerance of *Trichoderma WT* and engineered strains. Each experiment was performed in triplicate. Data are expressed as mean ± standard error, and statistical analysis was performed using one-way ANOVA combined with Tukey's multiple comparison test. *P < 0.05, **P < 0.01, ***P < 0.001.

[0033] Figure 2 Flowchart for establishing the PMOS mouse model and the intervention with engineered bacteria.

[0034] Figure 3 EcN-GLP-1 improved body composition, glucose homeostasis, and insulin sensitivity in PMOS mice. The following parameters were considered: (A) weight gain (%); (B) food intake; (C) body fat percentage; (D) fat mass; (E) lean body mass; (F) oral glucose tolerance test (OGTT) and its area under the curve (AUC); (H) insulin tolerance test (ITT) and its area under the curve (AUC); (J) fasting blood glucose level; (K) fasting insulin level; and (L) HOMA-IR index. The control group consisted of normal mice treated with sterile PBS; the PMOS group consisted of PMOS model mice treated with sterile PBS; the EcN group consisted of PMOS mice treated with EcNΔΔ; and the EcN-GLP-1 group consisted of PMOS mice treated with EcN-M5. In Figures A and CL, each data point represents one mouse (n=6 per group); in Figure B, food intake is calculated per cage and standardized to grams per mouse per day (n=2 cages per group). Statistical significance was assessed using two-way ANOVA to evaluate the F and H indices, and one-way ANOVA to evaluate the AE, G, and IL indices, followed by Tukey's multiple comparison test. *P<0.05, **P<0.01, ***P<0.001.

[0035] Figure 4EcN-GLP-1 can improve ovulation dysfunction and endocrine disorders in PMOS mice. (A) Representative image of ovarian tissue stained with HE; (B) Proportion of regular estrous cycles; (C) Representative image of estrous cycle monitoring; (D) Number of cystic follicles; (E) Number of corpora lutea; (F) Serum luteinizing hormone (LH) level; (G) Serum follicle-stimulating hormone (FSH) level; (H) Serum testosterone (T) level; (I) Serum IL-22 level; (J) Serum GLP-1 level; (K) Serum triglyceride (TG) level. The control group consisted of normal mice treated with sterile PBS; the PMOS group consisted of PMOS model mice treated with sterile PBS; the EcN group consisted of PMOS mice treated with EcNΔΔ; and the EcN-GLP-1 group consisted of PMOS mice treated with EcN-M5. Data are expressed as mean ± standard error (n=6 per group). Statistical significance was determined using one-way ANOVA combined with Tukey's multiple comparison test, with *P<0.05, **P<0.01, and ***P<0.001.

[0036] Figure 5 EcN-GLP-1 can improve the diversity and reshape the community structure of the gut microbiota in PMOS mice. (A) Chao1 index; (B) Shannon index; (C) Bray-Curtis distance; (D) Principal component analysis (PCoA) based on Bray-Curtis dissimilarity; (EG) Relative abundance of dominant taxa at the phylum (E), genus (F), and species (G) levels; (H) Differentially abundant biomarker taxa identified by LEfSe analysis (LDA value > 2.0); (I) Differentially abundant taxa identified by t-test. The control group consisted of normal mice treated with sterile PBS; the PMOS group consisted of PMOS model mice treated with sterile PBS; the EcN group consisted of PMOS mice treated with EcNΔΔ; and the EcN-GLP-1 group consisted of PMOS mice treated with EcN-M5. Data are presented as mean ± standard error (n = 6 mice per group). The statistical significance of the (AC) figure was determined by the Kruskal-Wallis test: *P<0.05, **P<0.01, ***P<0.001.

[0037] Figure 6Probiotic intervention can remodel the cecal metabolome of PMOS mice and partially restore tryptophan-indole metabolism. (A) OPLS-DA score map of non-targeted cecal metabolomics profiles in the control group, PMOS group, EcN group, and EcN-GLP-1 group; (B) OPLS-DA score map of non-targeted cecal metabolomics profiles in the EcN group and EcN-GLP-1 group; (C) Disease reversal analysis of metabolite changes in the PMOS group after probiotic intervention; (D) Directional recovery (DA) score based on KEGG pathway; (E) Heatmap of Log2 fold change of targeted tryptophan-indole metabolite set in different comparisons; (F) Relative abundance of tryptophan, 3-indolepyruvate, 3-indoleacrylic acid, and indoleacetaldehyde in the four groups (control group, PMOS group, EcN group, and EcN-GLP-1 group); (G) Heatmap of correlation between specific tryptophan-indole metabolites and indole module scores with host immune indicators, reproductive endocrine indicators, and glucose and lipid metabolism indicators; (H) Representative phenotypic indicators (GLP-1). Spearman scatter plots of the correlation between testosterone, HOMA-IR, and IL-22 scores and tryptophan or indole module scores. The control group consisted of normal mice treated with sterile PBS; the PMOS group consisted of PMOS model mice treated with sterile PBS; the EcN group consisted of PMOS mice treated with EcNΔΔ; and the EcN-GLP-1 group consisted of PMOS mice treated with EcN-M5. Data are expressed as mean ± standard error (n=6 mice per group). Statistical significance was determined using one-way ANOVA (F-plot) and Tukey's multiple comparison test; *P<0.05, **P<0.01, ***P<0.001. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0039] Example 1: Construction of EcN engineered bacteria that secrete GLP-1

[0040] The Escherichia coli Nissle 1917-derived strain with endogenous recessive plasmids pMUT1 and pMUT2 removed was used as the chassis strain and denoted as EcNΔΔ.

[0041] Based on the need for local expression and / or secretion of GLP-1 in the intestine, expression frameworks with different plasmid backbones and secretion signal peptide combinations were designed.

[0042] The plasmid backbone includes pUCSJM and pUC19; the secretion signal peptide includes MalE and PelB.

[0043] The nucleic acid sequence encoding GLP-1 was combined with the aforementioned plasmid backbone and signal peptide to construct four candidate expression vectors: pUCSJM-S1, pUCSJM-S2, pUC19-S1, and pUC19-S2. Referring to the table below, pUCSJM-S1 is a pUCSJM-derived plasmid carrying malE-GLP-1; pUCSJM-S2 is a pUCSJM-derived plasmid carrying pelB-GLP-1; pUC19-S1 is a pUC19-derived plasmid carrying malE-GLP-1; and pUC19-S2 is a pUC19-derived plasmid carrying pelB-GLP-1.

[0044]

[0045] The four recombinant plasmids were introduced into the EcNΔΔ chassis strain, respectively, to obtain four engineered strains M1, M2, M3, and M4. Figure 1 In A), M1 is the EcNΔΔ carrying pUCSJM-S1, M2 is the EcNΔΔ carrying pUCSJM-S2, M3 is the EcNΔΔ carrying pUC19-S1, and M4 is the EcNΔΔ carrying pUC19-S2.

[0046] Growth curves showed that GLP-1 expression in the engineered strains had no effect on their growth: the chassis strain EcNΔΔ (i.e., WT) and the engineered strains (M1, M2, M3, and M4) all entered the logarithmic growth phase after 4 hours of culture and reached the stationary phase after 8 hours. Figure 1 (B in the middle).

[0047] The secreted GLP-1 content in the culture supernatant was then quantified by ELISA. All four strains were able to secrete GLP-1, while no secretion was detected in the chassis strains. Figure 1 In C); where pUCSJM(P J23101 / J23119 The M2 strain, whose backbone is bound to the PelB signal peptide, secreted the highest amount (23.9 pg / mL), significantly exceeding that of the M1, M3, and M4 strains, indicating that this combination is the optimal strategy for GLP-1 secretion.

[0048] Natural GLP-1 is easily inactivated by DPP-4-mediated N-terminal cleavage; therefore, we introduced an alanine → glycine substitution (A8G) at the cleavage site of the GLP-1 sequence in strain M2 to obtain strain M5 that can secrete the DPP-4 cleavage variant GLP-1 (A8G). Figure 1 (D in the table below).

[0049]

[0050] M5's growth was comparable to that of M2 and the chassis strain (WT). Figure 1 In the E group, the GLP-1 secretion level was not significantly different from that in the M2 group (23.3 vs 23.9 pg / mL), indicating that Ala8Gly substitution did not affect bacterial growth or peptide secretion. Figure 1 The F in the text). Wild-type and engineered strains exhibited excellent acid and bile salt tolerance under different pH values ​​and bile salt concentrations. Figure 1 (G and H in the text). Finally, strain M5 was selected as the therapeutic strain (hereinafter referred to as EcN-GLP-1) for subsequent in vivo evaluation.

[0051] We have biopreserved the M5 strain, classifying it as *Escherichia coli* Nissle 1917 EcN-M5, and deposited it at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:: M 2026990. The deposit date is May 18, 2026, and the deposit address is Wuhan University, Wuhan, China.

[0052] Example 2: Establishment of a PMOS mouse model and intervention with engineered bacteria

[0053] Three-week-old female C57BL / 6J mice were selected as experimental animals. A PMOS mouse model was established using dehydroepiandrosterone (DHEA) combined with a high-fat diet. The DHEA dosage was 6 mg / 100 g body weight; the high-fat diet was a 60% high-fat diet provided by Research Diets, Inc., USA.

[0054] During the modeling process, DHEA was injected simultaneously with gavage intervention for 30 consecutive days. Experimental animals were divided into three groups: Control (normal control group); PMOS (model group); EcN (chassis strain EcNΔΔ intervention group); and EcN-GLP-1 (M5 engineered strain intervention group). The normal control group was given a standard diet, appropriate solvent injection, and PBS gavage; the other groups were induced with DHEA and a 60% high-fat diet, and then gavaged with PBS, EcNΔΔ, and M5 engineered strains, respectively.

[0055] During the intervention, changes in mouse body weight and food intake were recorded, and after the intervention, relevant indicators such as metabolism, reproductive endocrinology, ovarian pathology, gut microbiota diversity, and metabolites were detected.

[0056] See Figure 2The results showed that DHEA combined with a high-fat diet could successfully induce the PMOS-like mouse phenotype, and the abnormal phenotypes in mice were improved to varying degrees after intervention with chassis strain EcNΔΔ and EcN-GLP-1 engineered bacteria.

[0057] Example 3: Effects of EcN-GLP-1 engineered bacteria on body component distribution and insulin resistance in PMOS mice

[0058] We evaluated the improvement effect of EcN-GLP-1 in the PMOS mouse model.

[0059] During the entire DHEA / HFD induction period, mice were administered PBS by gavage (control and PMOS groups), EcNΔΔ by gavage (EcN group), or M5 engineered bacteria by gavage (EcN-GLP-1 group). Over the 30-day intervention period, all groups showed weight gain, but the untreated PMOS group exhibited the most significant weight gain; EcN-GLP-1 significantly inhibited this excessive weight gain (139% vs 176%, P<0.01), while EcN treatment failed to produce this effect. Figure 3 A). Mice treated with EcN-GLP-1 also had reduced daily food intake ( Figure 3 B), this lean phenotype is mainly due to a reduction in fat rather than a reduction in lean body mass: its body fat percentage and fat quality are significantly lower than those of the PMOS and EcN groups ( Figure 3 C, D), while lean body mass is maintained ( Figure 3 E). EcN-GLP-1 also improves glucose homeostasis.

[0060] During the OGTT, the blood glucose level in PMOS mice was significantly higher than that in the control group; while EcN-GLP-1 effectively inhibited postprandial blood glucose fluctuations. Figure 3 F); Correspondingly, the area under the curve (AUC) of the EcN-GLP-1 group was significantly lower than that of the PMOS group and the EcN group (1054 vs 1318 and 1203, respectively; P < 0.001 and P < 0.01). Figure 3 G). EcN-GLP-1 significantly improved the impaired hypoglycemic response in PMOS mice ( Figure 3 H, I). Furthermore, EcN-GLP-1 significantly reduced fasting blood glucose, fasting insulin, and the HOMA-IR index in PMOS mice (HOMA-IR: 4.41 vs 2.28, P < 0.001). Figure 3These results indicate that EcN-GLP-1 can improve body composition, glucose intolerance, and insulin resistance in DHEA / HFD-induced PMOS mice.

[0061] Example 4: The effect of EcN-GLP-1 engineered bacteria on improving reproductive endocrine disorders and ovarian pathological changes in PMOS mice

[0062] We evaluated the effects of EcN-GLP-1 on the reproductive phenotype of PMOS mice. Histological HE staining of the ovaries showed that the ovaries of PMOS mice contained numerous cystic follicles and a small number of corpora lutea; while EcN-GLP-1 significantly increased the number of corpora lutea and decreased the number of cystic follicles. Figure 4 In the A, D, and E groups: the number of corpora lutea increased from 1.3 in PMOS mice to 4.0 in the EcN-GLP-1 group (P < 0.01). Consistent with this result, all PMOS mice exhibited irregular estrous cycles (100%), while EcN-GLP-1 improved the regularity of estrous cycles in most PMOS mice, reducing the proportion of irregular estrous cycles to 16.7% ( ). Figure 4 (B and C in the text). EcN-GLP-1 also alleviated hormonal imbalances in PMOS mice: it improved gonadotropin imbalances, decreased LH levels, and increased FSH levels (…). Figure 4 (F and G in the text). Further research found that IL-22, which was reduced in PMOS mice, was significantly increased in both the EcN and EcN-GLP-1 treatment groups (F and G in the text). Figure 4 (H); while serum GLP-1 levels were lowest in the PMOS group and highest in the EcN-GLP-1 group ( Figure 4 The presence of 'I' in the system is consistent with enhanced systemic GLP-1 immunoreactivity. EcN-GLP-1 also improved dyslipidemia in PMOS mice, reducing triglycerides (I). Figure 4 It reduces K and LDL cholesterol, and increases HDL cholesterol.

[0063] These results indicate that EcN-GLP-1 can improve ovulation function in PMOS mice and alleviate endocrine and lipid disorders.

[0064] Example 5: EcN-GLP-1 can reshape the gut microbiota of PMOS mice

[0065] 16S rRNA sequencing revealed a significant dysbiosis in the gut microbiota of PMOS mice: compared with the control group, two α-diversity indices (Chao1 and Shannon) were significantly dysbiotic. Figure 5Both A and B in the data decreased; β-diversity analysis showed that the microbial community of the PMOS group was significantly separated from the control group along the first principal axis ( Figure 5 (C and D in the original text). Both EcN and EcN-GLP-1 could partially restore α-diversity and revert the overall community structure towards the control group, with EcN-GLP-1 showing a more significant effect. At the phylum level, the microbiota was dominated by Firmicutes and Bacteroidetes, but their proportions had been altered in PMOS mice and were partially restored after EcN-GLP-1 treatment. Figure 5 E); these compositional changes are equally evident at the genus and species levels (in the text). Figure 5 In the F and G groups: PMOS group mice showed relative proliferation of multiple bacterial genera (including Romboutsia), while the EcN-GLP-1 group was dominated by Lactobacillus (including Lactobacillus johnsonii, Lactobacillus murineis, and Bifidobacterium pseudolongum); as expected of the oral administration of the strains, the number of E. coli in mice treated with EcN increased in both groups, which indicates that the bacteria were introduced via gavage rather than as a result of endogenous remodeling.

[0066] To identify and differentiate representative microorganisms from each group, we performed LEfSe analysis and pairwise differential abundance analysis. Figure 5 The H and I in the text are mentioned. Compared with the control group, the PMOS group's gut microbiota was characterized by an enrichment of pro-inflammatory and bile-resistant Bifidobacterium, as well as Corynebacterium, Enterobacter, and Clostridium erythropoiesis, which have been reported as members of the gut microbiota with pro-inflammatory or potentially pathogenic effects. Simultaneously, the beneficial commensal butyrate-producing bacteria (including Burkholderia serratifolia, Butyricococcus, and Odorbacterium) in PMOS mice were significantly reduced; this deficiency is associated with tryptophan-kynurenine metabolism disorder. Both interventions altered this dysbiosis, but EcN-GLP-1 achieved a more significant regulatory effect. LEfSe analysis showed that the EcN-GLP-1 group was characterized by Lactobacillus, Lactobacillus, and Akkermansia. Figure 5 The H in the text); paired comparisons showed that, compared to the EcN group, *Lactobacillus reuteri* exhibited selective enrichment in EcN-GLP-1 mice (…). Figure 5 I).

[0067] Notably, the microbial communities selectively enriched by EcN-GLP-1 were all closely associated with the microbial tryptophan-indole metabolic pathway. *Lactobacillus* can convert tryptophan into indole derivatives with aryl hydrocarbon receptor (AhR) activity (such as indole-3-acetaldehyde and indole-3-lactic acid), and the abundance of *Lactobacillus* is positively correlated with the number of indole metabolites (including indole-3-acetic acid, indole-3-propionic acid, and indole-3-lactic acid). *Lewis* is a typical representative of this metabolic activity; its indole derivatives can activate AhR and induce IL-22 secretion. *Ackermania* can also produce tryptophan-derived metabolites (such as indole-3-acetaldehyde), which can activate the AhR / IL-22 signaling pathway. Given that this EcN-GLP-1-enriched, indole-associated microbial community characteristic indicates a shift in microbial tryptophan metabolism, we subsequently analyzed the cecal metabolome to determine whether this change in metabolic composition is accompanied by a corresponding change in microbial metabolic output.

[0068] Example 6: EcN-GLP-1 is associated with the targeted restoration of PMOS-altered cecal metabolites.

[0069] To elucidate the metabolic changes underlying PMOS and probiotic interventions, we performed untargeted metabolomics analysis on the cecal contents of four groups of mice. OPLS-DA analysis showed significant differences between the PMOS group and the control group, indicating significant metabolic disorders in the PMOS group mice. Figure 6 A in the text). Both the EcN group and the EcN-GLP-1 group differed from the PMOS group ( Figure 6 (B) In the differential metabolite analysis (VIP > 1, P < 0.05), a total of 1,001 metabolites were identified between the PMOS group and the control group, 223 metabolites were identified between the EcN group and the PMOS group, 334 metabolites were identified between the EcN-GLP-1 group and the PMOS group, and 111 metabolites were identified between the EcN-GLP-1 group and the EcN group. These results indicate that the EcN-GLP-1 group exhibits a stronger metabolic regulatory effect than the EcN group.

[0070] Analysis of disease-reversing metabolites showed that among 1,001 exploratory disease-related metabolites (original P-value < 0.05 and |fold change| ≥ 1.2), EcN reversed 78 metabolites, while EcN-GLP-1 reversed 92; and the median reversal index of EcN-GLP-1 was significantly higher than that of EcN (P = 0.036). These results indicate that EcN-GLP-1 has a slight but significant advantage over EcN in restoring the altered metabolic state in the PMOS group.

[0071] Directional differential abundance (DA) scores showed that the PMOS group exhibited negative DA scores in multiple host-microbe co-metabolic pathways and amino acid / lipid metabolism pathways, including histidine metabolism, glycerol ester metabolism, tryptophan metabolism, bile secretion, phenylalanine metabolism, tyrosine metabolism, glycerophospholipid metabolism, and primary bile acid biosynthesis. Figure 6 (D) EcN caused only slight positive changes in some metabolic pathways; while EcN-GLP-1 showed more significant positive recovery in tryptophan metabolism, phenylalanine metabolism, tyrosine metabolism, bile secretion, and glycerophospholipid metabolism. Notably, tryptophan metabolism was only restored by EcN-GLP-1, while no significant changes were observed under EcN treatment.

[0072] Since tryptophan metabolism is the pathway with the most specific action of EcN-GLP-1 and is directly related to the IL-22 / AhR axis, we further analyzed 31 tryptophan-indole related metabolites ( Figure 6 In comparison between the PMOS group and the control group, the levels of multiple tryptophan-indole metabolites in PMOS mice were decreased, including 3-hydroxy-3-methoxyindole, 7,8-dihydro-7,8-dihydroxykynurenic acid, 5-hydroxyindoleacetic acid, and oxidized fatty acids; while microbial-associated indole compounds, indole-3-lactic acid and indolepyruvate were also significantly decreased (P < 0.05). EcN-GLP-1 selectively increased multiple tryptophan-indole metabolites compared to the PMOS group: tryptophan and 3-indoleacrylic acid were significantly increased, while indoleacetaldehyde, indole-3-lactic acid, indolepyruvate, and 5-hydroxytryptophan showed an increasing trend (P < 0.05). Figure 6 (F in the text).

[0073] To assess the relationship between changes in tryptophan-indole metabolism and PMOS-related phenotypes, we performed Spearman correlation analysis on indole module scores and key indole metabolites in the PMOS, EcN, and EcN-GLP-1 groups, and their correlation with IL-22, GLP-1, glycolipid markers, and gonadal axis markers. Figure 6 The indole module score was positively correlated with IL-22 and high-density lipoprotein cholesterol, and negatively correlated with HOMA-IR, testosterone, luteinizing hormone (LH), triglycerides, and low-density lipoprotein cholesterol, with the most significant negative correlations to testosterone, HOMA-IR, and triglycerides. Furthermore, tryptophan was positively correlated with GLP-1. Overall, these results indicate that PMOS is accompanied by decreased activity of a portion of the microbial tryptophan-indole metabolic pathway selectively upregulated by EcN-GLP-1, and that this metabolic module is associated with IL-22, insulin resistance, hyperandrogenemia, and dyslipidemia.

[0074] Based on the above embodiments, it can be seen that:

[0075] This invention addresses the pain points of natural GLP-1 being rapidly degraded by dipeptidyl peptidase-4 (DPP-4), the need for long-term and repeated administration of exogenous GLP-1 drugs, and poor patient compliance. We mutated the alanine → glycine (A8G) site of GLP-1 to obtain a GLP-1 mutant resistant to DPP-4 cleavage. This mutant is continuously secreted in situ in the intestine by engineered bacteria, eliminating the need for frequent exogenous administration and avoiding the potential side effects of high-dose systemic administration, thus significantly improving the duration of action of GLP-1.

[0076] This invention uses Escherichia coli Nissle 1917-derived strain (EcNΔΔ) with endogenous recessive plasmids pMUT1 and pMUT2 knocked out as the chassis. It not only fully retains the probiotic properties, intestinal colonization ability, and mucosal immune regulation function of EcN itself (which can upregulate IL-22 and maintain the integrity of the intestinal barrier), but also endows it with GLP-1 secretion function through genetic engineering. For the first time, it achieves the dual effects of "intestinal immune regulation + metabolic regulation", which makes up for the deficiency of ordinary EcN in improving metabolic disorders such as PMOS-related obesity and insulin resistance.

[0077] Current clinical interventions for PMOS primarily focus on symptomatic control of single aspects (such as regulating hormone levels or improving insulin resistance alone), failing to address the multiple pathological mechanisms involved in PMOS, including metabolic disorders, reproductive endocrine abnormalities, intestinal barrier damage, gut microbiota dysbiosis, and chronic low-grade inflammation. Our EcN-M5 works synergistically through a dual pathway: on one hand, the secreted GLP-1 directly improves obesity, insulin resistance, and abnormal glucose and lipid metabolism; on the other hand, it specifically remodels the gut microbiota, enriching beneficial indole-producing bacteria such as Lactobacillus, activating the aryl hydrocarbon receptor (AhR) / IL-22 signaling pathway, improving intestinal barrier function, downregulating chronic inflammation, and consequently regulating the hypothalamic-pituitary-gonadal axis, improving reproductive endocrine abnormalities such as hyperandrogenemia and ovulation disorders, filling the gap in current technologies that cannot simultaneously address both reproductive and metabolic abnormalities in PMOS.

[0078] Through systematic screening and verification, we determined that the pUCSJM plasmid backbone combined with the PelB secretion signal peptide is the optimal combination for GLP-1 expression and secretion, achieving a GLP-1 secretion level of 23.3 pg / mL. The A8G mutation did not negatively affect the growth of the strain, and the engineered bacteria fully retained the natural acid and bile salt resistance of EcN, making it suitable for oral intestinal delivery. It has high bioavailability and strong in vivo stability, meeting the application requirements of in vivo biological therapy products.

[0079] Meanwhile, in vivo experiments in the PMOS mouse model confirmed that, compared with the blank chassis EcNΔΔ intervention, the comprehensive efficacy of EcN-M5 was significantly improved: ① Metabolic level: It can significantly inhibit abnormal weight gain in model mice, reduce body fat percentage, improve glucose tolerance, and reduce the insulin resistance index (HOMA-IR) compared with the model group; ② Reproductive level: It can increase the number of corpora lutea from 1.3 in the model group to 4.0, reduce the proportion of estrous cycle disorders from 100% to 16.7%, and correct gonadotropin imbalance and reduce testosterone levels; ③ Intestinal and metabolic level: It can specifically restore the activity of the tryptophan-indole metabolic pathway, upregulate the level of beneficial indole metabolites, and improve dyslipidemia, with significantly better effects than traditional EcN probiotic intervention.

[0080] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. An Escherichia coli-derived bacterium, EcN-M5, characterized in that, The Escherichia coli-derived strain EcN-M5 is classified as Escherichia coli Nissle 1917 EcN-M5, and is deposited at the China Center for Type Culture Collection (CCTCC) with the accession number CCTCC NO:M 2026990 on May 18, 2026.

2. The *Escherichia coli*-derived strain EcN-M5 according to claim 1, characterized in that, The strain uses *Escherichia coli* Nissle 1917, with endogenous recessive plasmids pMUT1 and pMUT2 removed, as its host bacterium and contains the recombinant plasmid pUCSJM-S3 constructed based on the pUCSJM backbone; pUCSJM-S3 contains a GLP-1-A8G secretory expression cassette, which, along the transcriptional direction, sequentially includes J... 23119 Promoter and J 23101 The promoter-derived heterozygous constitutive promoter P_Hyb, ribosome binding site, and PelB-GLP-1-A8G fusion coding sequence; the PelB-GLP-1-A8G fusion coding sequence is a nucleotide sequence optimized based on codon usage preferences of E. coli Nissle 1917; the GLP-1-A8G is obtained by replacing the 8th amino acid Ala in the amino acid fragment from the 7th to the 37th amino acid position of natural human GLP-1 with Gly.

3. The *Escherichia coli*-derived strain EcN-M5 according to claim 2, characterized in that, The nucleotide sequence of the heterozygous constitutive promoter P_Hyb is shown in SEQ ID NO:1, the nucleotide sequence of the ribosome binding site is shown in SEQ ID NO:2, and the PelB-GLP-1-A8G fusion coding sequence is shown in SEQ ID NO:

3.

4. A recombinant plasmid, characterized in that, The recombinant plasmid uses pUCSJM as its backbone and contains a GLP-1-A8G secretory expression cassette; the secretory expression cassette includes, along the transcriptional direction, J... 23119 Promoter and J 23101 The recombinant plasmid comprises a promoter-derived heterozygous constitutive promoter P_Hyb, a ribosome binding site, and a PelB-GLP-1-A8G fusion coding sequence; the PelB-GLP-1-A8G fusion coding sequence is a nucleotide sequence optimized based on the codon usage preference of *E. coli* Nissle 1917; wherein, the nucleotide sequence of the heterozygous constitutive promoter P_Hyb is shown in SEQ ID NO:1, the nucleotide sequence of the ribosome binding site is shown in SEQ ID NO:2, and the PelB-GLP-1-A8G fusion coding sequence is shown in SEQ ID NO:3; the recombinant plasmid is named pUCSJM-S3.

5. A method for preparing Escherichia coli-derived strain EcN-M5 according to any one of claims 1-3, characterized in that, Includes the following steps: A8G amino acid substitution was introduced into pUCSJM-S2 containing the P_Hyb-PelB-GLP-1-A8G secretion expression cassette fragment 7-37 to obtain recombinant plasmid pUCSJM-S3 containing the P_Hyb-PelB-GLP-1-A8G secretion expression cassette; pUCSJM-S3 was introduced into Escherichia coli Nissle 1917 host bacteria with endogenous recessive plasmids pMUT1 and pMUT2 removed, and positive transformants carrying pUCSJM-S3 were screened.

6. A pharmaceutical composition, characterized in that, The pharmaceutical composition includes engineered Escherichia coli-derived strain EcN-M5 as described in any one of claims 1-3 and pharmaceutically acceptable excipients; the pharmaceutically acceptable excipients include one or more of carriers, diluents, protectants, lyophilization protectants, stabilizers, excipients, and embedding materials; the pharmaceutical composition is a lyophilized powder, capsule, granule, microcapsule, suspension, or other orally acceptable dosage form suitable for oral administration.

7. The use of the Escherichia coli-derived strain EcN-M5 as described in any one of claims 1-3 or the pharmaceutical composition as described in claim 6 in the preparation of a medicament or health product for the prevention, relief and / or treatment of polyendocrine metabolic ovarian syndrome.

8. The application according to claim 7, characterized in that, The aforementioned drugs or health products are used to improve metabolic abnormalities caused by polyendocrine metabolic syndrome. The metabolic abnormalities are one or more of the following: abnormal weight gain, obesity, insulin resistance, impaired glucose tolerance, elevated fasting blood glucose, dyslipidemia, and abnormal body composition distribution.

9. The application according to claim 7, characterized in that, The aforementioned drugs or health products are used to improve reproductive endocrine abnormalities caused by polyendocrine metabolic ovarian syndrome; The reproductive endocrine abnormalities include one or more of the following: ovulation disorders, polycystic ovarian changes, decreased number of corpora lutea, estrous cycle disorders, hyperandrogenemia, and abnormal luteinizing hormone to follicle-stimulating hormone ratio.

Images