Chrysanthemum terebinthinus TcUGT1, TcUGT6 gene and application thereof in chrysanthemic acid-UDP-glucose synthesis

Abstract

The present application relates to a chrysanthemum TcUGT1, TcUGT6 gene and its application in chrysanthemic acid-UDP-glucose synthesis. The present application first clones two glycosyltransferase genes TcUGT1 and TcUGT6 from chrysanthemum. By introducing the two genes into host cells such as E. coli, S. cerevisiae, B. subtilis, Y. lipolytica or C. glutamicum, the synthesis of chrysanthemic acid-UDP-glucose is realized, the toxicity of chrysanthemic acid to host cells is reduced, and the synthesis yield of chrysanthemic acid is improved. Experiments have proved that the two genes have the function of catalyzing the synthesis of chrysanthemic acid glycosylation product, and the proteins expressed by the two genes can catalyze the synthesis of chrysanthemic acid-UDP-glucose product. The present application fills the research gap of microbial biosynthesis of chrysanthemic acid glycosylation product, and has good research potential and broad application prospect.

Description

Technical Field

[0001] This invention belongs to the fields of synthetic biology and metabolic engineering technology, and relates to a pyrethrum TcUGT1 and TcUGT6 gene and its application in the synthesis of chrysanthemic acid-UDP-glucose. Specifically, it relates to the amino acid sequences of two glycosyltransferase genes (TcUGT1 and TcUGT6) that catalyze the formation of chrysanthemic acid-UDP-glucose from chrysanthemic acid, including the production application of the genes in the synthesis of chrysanthemic acid in Saccharomyces cerevisiae and Escherichia coli, as well as a method for preparing chrysanthemic acid-UDP-glucose. Background Technology

[0002] Pyrethroids are a type of insecticide derived from pyrethrum ( Tanacetum cinerariifolium Pyrethroids are natural insecticides, primarily derived from plant extracts. They are formed by the condensation of acid and alcohol ligands, with the acid ligands including chrysanthemic acid and dichrysanthemic acid. Chrysanthemic acid is the backbone component of the acid ligand and is an important monoterpene acid compound with a cyclopropane structure. Due to its unique chemical structure, chrysanthemic acid itself possesses insecticidal activity and is therefore considered a natural insecticide, exhibiting significant insecticidal capabilities in agriculture. Furthermore, chrysanthemic acid is a key raw material for the synthesis of pyrethroid insecticides such as allethrin and deltamethrin. The glycosylation process of chrysanthemic acid, by introducing glycosyl groups, significantly reduces its toxicity to host cells and increases host cell survival, greatly contributing to the yield of the final product, chrysanthemic acid, thus demonstrating significant research value and application potential in the field of biosynthesis. However, research on the synthesis of chrysanthemic acid through heterologous expression systems is virtually nonexistent, especially its application in model microorganisms such as *Saccharomyces cerevisiae* and *Escherichia coli*, for which no research reports have been found.

[0003] Similar to chrysanthemin, the production of chrysanthemin currently faces significant challenges. Despite the broad application prospects of chrysanthemin glycosylation products, they still encounter similar difficulties as chrysanthemin production. On the one hand, traditional synthetic methods have significant limitations in terms of efficiency, cost, and environmental friendliness. Chemical synthesis typically requires multiple steps and harsh reaction conditions, resulting in low synthesis efficiency and numerous byproducts. This not only increases production costs but also puts considerable pressure on the environment. On the other hand, while bio-fermentation can alleviate these problems to some extent, the cytotoxicity of chrysanthemin inhibits the growth of the fermentation strain, becoming a rate-limiting step in the production process and making it difficult to further increase yield, thus limiting the possibility of large-scale industrial application. Furthermore, existing technologies still fall short of practical requirements in terms of product purity and yield, necessitating the development of new technological pathways to overcome these bottlenecks. Therefore, exploring efficient, economical, and environmentally friendly chrysanthemin glycosylation synthesis methods has become one of the key research directions.

[0004] The limitations of traditional chrysanthemic acid synthesis methods have spurred an urgent need for new technologies and strategies. Both chemical synthesis and bio-fermentation methods suffer from low efficiency, high costs, and insufficient environmental friendliness, severely hindering the industrial application of chrysanthemic acid glycosylation products. Especially in the context of current green chemistry and sustainable development, developing efficient, economical, and environmentally friendly synthetic methods has become a research hotspot. Meanwhile, with the rapid development of genetic engineering technology, the functional analysis and optimization of key gene amino acid sequences have provided novel solutions for chrysanthemic acid glycosylation synthesis.

[0005] Therefore, there is an urgent need for a high-yield synthesis method of chrysanthemic acid based on genetic engineering technology. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides pyrethrum TcUGT1 and TcUGT6 genes and their application in the synthesis of chrysanthemic acid-UDP-glucose. This invention provides two novel, highly efficient functional gene amino acid sequences that can be used in chassis cells such as *Escherichia coli*, *Saccharomyces cerevisiae*, *Bacillus subtilis*, *Yersinia lipolyticis*, and *Corynebacterium glutamicum* to produce chrysanthemic acid-UDP-glucose, thus solving the problem of inefficient synthesis and production of chrysanthemic acid in existing technologies.

[0007] This invention innovatively cloned two glycosyltransferase genes, TcUGT1 and TcUGT6, from pyrethrum and demonstrated that they can efficiently catalyze the synthesis of chrysanthemic acid glycosylation products in chassis cells such as *Escherichia coli*, *Saccharomyces cerevisiae*, *Bacillus subtilis*, *Yersinia lipolyticis*, and *Corynebacterium glutamicum*. This discovery fills a research gap in this field and provides a theoretical basis and technical support for the development of novel biosynthetic pathways.

[0008] The objective of this invention can be achieved through the following methods: In a first aspect, the present invention provides a pyrethrum TcUGT gene-encoded protein, wherein the pyrethrum TcUGT gene-encoded protein includes one or more of the TcUGT1 gene-encoded protein and the TcUGT6 gene-encoded protein; wherein the amino acid sequence of the TcUGT1 gene-encoded protein is the sequence shown in SEQ ID No. 1, or has at least 85% sequence identity with SEQ ID No. 1, and contains the conserved region shown in amino acids 228-453 of SEQ ID No. 1, and has the activity of catalyzing chrysanthemic acid glycosylation to form chrysanthemic acid-UDP-glucose; the amino acid sequence of the TcUGT6 gene-encoded protein is the sequence shown in SEQ ID No. 2, or has at least 85% sequence identity with SEQ ID No. 2, and contains the conserved region shown in amino acids 187-439 of SEQ ID No. 2, and has the activity of catalyzing chrysanthemic acid glycosylation to form chrysanthemic acid-UDP-glucose.

[0009] For example, sequences with at least approximately 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0010] The protein encoded by the pyrethrum TcUGT gene has the activity of catalyzing the glycosylation of chrysanthemic acid to form chrysanthemic acid-UDP-glucose.

[0011] Secondly, the present invention provides an application of the protein encoded by the pyrethrum TcUGT gene in the synthesis of chrysanthemic acid-UDP-glucose.

[0012] In this invention, the protein encoded by the pyrethrum TcUGT gene is a glycosyltransferase that can catalyze the reaction of chrysanthemic acid with a glycosyl donor to generate chrysanthemic acid-UDP-glucose.

[0013] Thirdly, the present invention provides a pyrethrum TcUGT gene, wherein the pyrethrum TcUGT gene includes one or more of the TcUGT1 gene and the TcUGT6 gene; wherein the nucleotide sequence of the TcUGT1 gene is shown in SEQ ID No. 3, and the nucleotide sequence of the TcUGT6 gene is shown in SEQ ID No. 4. Both the TcUGT1 gene and the TcUGT6 gene belong to the glycosyltransferase gene family.

[0014] As one embodiment of the present invention, the forward and reverse primers for extending the TcUGT1 gene are shown in SEQ ID No. 5-6, and the forward and reverse primers for extending the TcUGT6 gene are shown in SEQ ID No. 7-8, respectively.

[0015] Fourthly, the present invention provides a recombinant expression vector containing the pyrethrum TcUGT gene.

[0016] Fifthly, the present invention provides a host cell comprising the recombinant expression vector described above.

[0017] As one embodiment of the present invention, the host cell is selected from any one of Escherichia coli, Saccharomyces cerevisiae, Bacillus subtilis, Yarrowia lipolytica, and Corynebacterium glutamicum.

[0018] In a sixth aspect, the present invention provides a whole-cell catalytic system, which is prepared by inducing expression in the host cell.

[0019] In a seventh aspect, the present invention provides a method for producing chrysanthemic acid-UDP-glucose using the host cell or whole-cell catalytic system, the method comprising whole-cell catalysis and heterologous expression fermentation.

[0020] As one embodiment of the present invention, the whole-cell catalysis includes the following steps: S1. The whole-cell catalytic system and the substrate are mixed in a reaction buffer to carry out the catalytic reaction; S2. Separate and / or purify chrysanthemic acid-UDP-glucose from the reaction system.

[0021] As one embodiment of the present invention, in step S1, the reaction buffer contains: 40-60 mM Tris-HCl (pH 7.5), 3-6 mM MgCl2, 3-6% (v / v) glycerol, and 1-2 mM DTT; the conditions for the catalytic reaction are: reaction temperature 25-30℃, rotation speed 200-250 rpm, and reaction time 12-24 h.

[0022] In one embodiment of the present invention, in step S1, the substrate includes chrysanthemic acid or a chrysanthemic acid precursor, and a glycosyl donor; the glycosyl donor includes UDP-glucose or UDP-galactose.

[0023] In another embodiment of the present invention, the heterologous expression fermentation includes the following steps: inoculating the host cells into a fermentation medium, fermenting under suitable conditions, inducing TcUGT gene expression, so that the host cells directly utilize glycosyl donors (such as UDP-glucose) produced by their own metabolism to convert exogenously added or self-synthesized chrysanthemic acid into chrysanthemic acid-UDP-glucose during growth, and separating and purifying chrysanthemic acid-UDP-glucose from the fermentation product. The chassis cells of the host cells are selected from any one of Escherichia coli, Saccharomyces cerevisiae, Bacillus subtilis, Yersinia lipolytica, and Corynebacterium glutamicum. The fermentation conditions can be routinely optimized according to the selected chassis cells, for example, temperature 25-37℃, pH 6.0-8.0, fermentation time 24-72 hours, and an inducer (such as IPTG) can be added for induced expression.

[0024] Compared with the prior art, the present invention has the following beneficial effects: This invention marks the first time that two glycosyltransferase genes, TcUGT1 and TcUGT6, have been cloned from pyrethrum. By expressing these two genes separately in recombinant host cells, the catalytic glycosylation of chrysanthemic acid was achieved, forming chrysanthemic acid-UDP-glucose. This reduced the toxicity of chrysanthemic acid to host cells and increased the synthesis yield of chrysanthemic acid. TcUGT1 and TcUGT6 can serve as key genes for improving chrysanthemic acid synthesis, providing a new approach for preparing engineered strains with high chrysanthemic acid production. They have good potential for industrial application and meet the growing consumer demand. Attached Figure Description

[0025] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 Phylogenetic analysis of the TcUGT1 and TcUGT6 genes; Figure 2 A schematic diagram of the pathway for the synthesis of chrysanthemic acid-UDP-glucose catalyzed by TcUGT1 and TcUGT6; Figure 3 The catalytic efficiencies of TcUGT1, TcUGT6, and the control group in the synthesis of chrysanthemic acid-UDP-glucose are given. Detailed Implementation

[0026] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0028] The liquid culture medium in this embodiment of the invention is as follows: LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride; Kana-LA medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, 50 μg / mL kanamycin; Kana-LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 50 μg / mL kanamycin; Sc-Ura liquid medium: 20 g / L yeast extract, 40 g / L peptone, 40 g / L glucose, 1.5 g / L amino acid mixture (-Ura), 6.7 h / L YNB (containing ammonium sulfate); Fermentation liquid culture medium: 20 g / L yeast extract, 40 g / L peptone, 40 g / L glucose, 20 g / L galactose.

[0029] Example 1: Bioinformatics analysis of the TcUGT1 and TcUGT6 genes of pyrethrum Using pyrethrum leaves, stems, roots, and flowers as experimental materials, transcriptome analysis of pyrethrum tissues was performed using next-generation high-throughput sequencing (RNS-seq). Two differentially expressed genes were identified, and the proteins expressed by these genes exhibit characteristics of plant glycosyltransferase family members. These two genes were named TcUGT1 and TcUGT6, respectively. Analysis of the TcUGT1 and TcUGT6 genes was conducted using relevant databases and bioinformatics software. The main findings are as follows: (1) CD-search searches for conserved domains of TcUGT1 and TcUGT6 proteins; (2) ProtParam analysis of the basic physicochemical properties of TcUGT1 and TcUGT6 proteins; (3) Muscle 5.1 software was used to perform homology comparison of TcUGT1 and TcUGT6 proteins, and Fasttree 2.1.11 software was used to construct a phylogenetic tree; 1. Analysis of conserved domains in proteins encoded by TcUGT1 and TcUGT6 genes We used CD-search in NCBI to search for conserved domains of the proteins encoded by the TcUGT1 and TcUGT6 genes. The results are shown in Table 1. Both TcUGT1 and TcUGT6 proteins possess a conserved UDPGT domain at their C-terminus, located at 228-453 aa and 187-439 aa, respectively. Both TcUGT1 and TcUGT6 proteins belong to the plant UGT protein family and participate in the glycosylation modification of plant secondary metabolites. They are also involved in plant responses to abiotic stress and are core chemical mechanisms for plant adaptation and survival competition. TcUGT1 and TcUGT6 proteins are typical plant UGT family proteins.

[0030] Table 1. Conserved domain analysis of TcUGT1 and TcUGT6 proteins

[0031] 2. Physicochemical properties analysis of proteins encoded by TcUGT1 and TcUGT6 genes The basic physicochemical properties of TcUGT1 and TcUGT6 proteins were predicted and analyzed using ExPaSy-ProtParam. The results are shown in Table 2: TcUGT1 protein contains 476 amino acids, with a relative molecular mass of 53.21 KD, a theoretical isoelectric point of 5.50, and an instability parameter of 45.08, classifying it as an unstable protein; its average hydrophobicity is -0.037, classifying it as a soluble protein. Its amino acid sequence is shown in SEQ ID No. 1. TcUGT6 protein contains 463 amino acids, with a relative molecular mass of 51.58 KD, a theoretical isoelectric point of 5.94, and an instability parameter of 36.13, classifying it as a stable protein; its average hydrophobicity is -0.176, classifying it as a soluble protein. Its amino acid sequence is shown in SEQ ID No. 2.

[0032] Table 2 Physicochemical properties analysis of TcUGT1 and TcUGT6 proteins

[0033] 3. Protein sequence alignment To comprehensively analyze the structural characteristics of the proteins encoded by TcUGT1 and TcUGT6, this invention selected UGT protein sequences from different plants (UGT71, UGT84, UGT85, UGT86, UGT87, and UGT89) based on reported plant UGT family protein sequences in the literature. Homology sequence alignment was performed using Muscle software, and a phylogenetic tree was constructed using Fasttree software. The results are as follows: Figure 1The results showed that TcUGT1 had the highest homology with MpMUGT3a_UGT71 from Mentha piperita, which is a member of the UGT71 family. TcUGT6 had the highest homology with Lj7g07210_UGT84 from Handroanthusimpetiginosus, which is a member of the UGT84 family.

[0034] Example 2: Cloning and functional verification of the TcUGT1 and TcUGT6 genes of pyrethrum To verify whether the screened pyrethrum TcUGT1 and TcUGT6 genes (sequences shown in SEQ ID No. 3-4, respectively) have the function of catalyzing the formation of chrysanthemic acid from chrysanthemic acid to chrysanthemic acid-UDP glucose (reaction pathway as follows) Figure 2 The above-mentioned genes need to be cloned from the pyrethrum genome and expressed heterologously as proteins.

[0035] 2.1 Total RNA was extracted from flower tissues at the S2 and S4 stages of pyrethrum. cDNA was then synthesized via reverse transcription and used as a template for cloning the full-length sequences of the aforementioned genes. Using the predicted full-length CDS sequences of the TcUGT1 and TcUGT6 genes from transcriptome sequencing as templates, the full-length sequences were designed and amplified. The primer sequences for PCR amplification are as follows: Used to amplify TcUGT1 Forward primer F: CTTTAAGAAGGAGATATATGGAAAAACAGAAACTAGAGG (SEQ ID No. 5) Reverse primer R: CAGTGGTGGTGGTGGTGGTGTTAAATCAAATCATCGACTAGG (SEQ ID No. 6) Used to amplify TcUGT6 Forward primer F: ctttaagaaggagatatATGAAACCAAAAGCTATGGAGATAAAAG (SEQ ID No. 7) Reverse primer R: CAGTGGTGGTGGTGGTGGTGTCACTTGTGTATGTCCTTTAATGC (SEQ ID No. 8) PCR reactions were performed using the Vazyme Phanta® Max Super-Fidelity DNA Polymerase system. The reaction conditions included: pre-denaturation at 95°C for 3 min; followed by 35 cycles, each consisting of 95°C for 15 s, annealing at 55-60°C for 15 s, extension at 72°C for 2 min, and a final extension at 72°C for 5 min. The resulting PCR products were purified and recovered using a Gel DNA Extraction Mini Kit. The PCR product fragments were ligated into the pET-28a (Merck Millipore, 69864) expression vector using the Gibson assembly method to obtain the Gibson assembly reaction products.

[0036] 2.2 Transform pET-28a(+)-TcUGT1 and pET-28a(+)-TcUGT6 into E. coli (such as DH5α) suitable for plasmid amplification. The specific steps are as follows: 500 ng of the Gibson assembly reaction product was added to competent E. coli (such as DH5α) cells in the logarithmic growth phase. After mixing by pipetting and aspiration, the cells were incubated in a 42°C water bath for about 1.5 min. The transformed cells were then plated on the corresponding Kana-LA medium and cultured at 37°C for 1 day to obtain single-clonal transformants.

[0037] 2.3 Inoculate single-clone transformants into Kana-LB liquid medium and culture until the logarithmic growth phase. Take 5 mL of culture medium, centrifuge, and collect the bacterial cells. Extract plasmid DNA using the Plasmid DNA Extraction Micro Kit, and transform the pET-28a(+)-TcUGT1 and pET-28a(+)-TcUGT6 plasmids into suitable E. coli strains for protein expression (such as RosettaDE3), following the same transformation steps as in 3.2. Inoculate single-clone transformants into Kana-LB liquid medium to obtain seed culture.

[0038] 2.4 The seed culture was inoculated into 1 L LB medium at a ratio of 1% and cultured at 37℃ and 220 rpm. After approximately 4 h of culture, IPTG (isopropyl galactothioglycoside) was added to the culture system to a final concentration of 0.1 mM for protein induction expression. The culture was then maintained at 18℃ and 220 rpm for 18 h. The bacterial cells were collected by centrifugation at 4000 rpm for 8 min, and resuspended in 5 mL of enzyme reaction buffer. Subsequently, the bacterial cells were disrupted using an ultrasonic cell disruptor, with a 3 s sonication interval followed by a 6 s pause, for a total of 15 min. The recombinant protein was purified by nickel column affinity chromatography using the 6x-His tag of the vector, and the protein concentration was determined. 2.5 The obtained recombinant proteins were subjected to in vitro enzymatic reactions. The reaction system was as follows: 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 5% (v / v) glycerol, 1 mM DTT, 20-50 μM pyrrolizidine phosphate, and 5 μg purified TcUGT1 and TcUGT6 proteins. The reaction system was incubated at 25℃ and 220 rpm for 12 h.

[0039] 2.6 After the reaction was completed, an equal volume of methanol solvent was added to the system to terminate the reaction. After thorough shaking and mixing, the mixture was centrifuged at 13000g for 10 min, and the supernatant was collected as the sample to be tested. Detection and analysis were performed using liquid chromatography-mass spectrometry (LC-MS). Extraction and analysis were performed based on the characteristic ion fragments of the target compound, chrysanthemin ([M+HCOOH-H]-, EIC=375). The results are as follows: Figure 3 As shown, without the addition of TcUGT1 and TcUGT6 proteins, co-incubation of chrysanthemic acid and UDP-glc (glycosyl donor) did not yield any detectable target compound. However, combinations with TcUGT1 and TcUGT6 proteins respectively produced chrysanthemic acid-UDP-glucose, with TcUGT6 protein exhibiting the highest catalytic efficiency. This indicates that the addition of TcUGT1 and TcUGT6 proteins catalyzes the production of chrysanthemic acid-UDP-glucose from chrysanthemic acid. Since chrysanthemic acid-UDP-glucose is highly soluble in water, this reduces the accumulation of chrysanthemic acid monomers within cells and lowers cytotoxicity.

[0040] Example 3: TcUGT1 and TcUGT6 genes enable whole-cell catalytic synthesis of chrysanthemic acid-UDP-glucose from chrysanthemic acid in different microbial chassis. To verify whether the TcUGT1 and TcUGT6 genes of pyrethrum can be used in bacteria including Escherichia coli (E. coli) Escherichia coli ) strain, Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) strain, Bacillus subtilis ( Bacillus subtilis ) strain, Yarrowia lipolytica ( Yarrowia lipolytica ) strains and Corynebacterium glutamicum ( Corynebacterium glutamicum To enable it to function, the TcUGT1 and TcUGT6 genes need to be transferred into the above five chassis, and their ability to synthesize chrysanthemic acid-UDP-glucose needs to be compared and analyzed.

[0041] 3.1 Construction of recombinant expression vectors Based on the sequences of the two genes (TcUGT1 and TcUGT6) obtained in Example 2, primers were designed according to the multiple cloning sites of each vector. The TcUGT1 and TcUGT6 genes were cloned into the above expression vectors using the Gibson assembly method (NEBuilder HiFi DNA Assembly Master Mix, NEB, catalog number E2621) to construct the following recombinant expression vectors: The expression vector for Escherichia coli was pET28a (Merck Millipore, 69864-M); The expression vector for Bacillus subtilis is pMA5 (MoBiTec, pMA5-vec). The expression vector for Corynebacterium glutamicum was pXMJ19 (Addgene, 74849); The expression vector for Saccharomyces cerevisiae was pESC-URA (Agilent, 217402); Yeast lipophila expression vector: pINA1296 (Addgene, 107543).

[0042] 3.2 Preparation of recombinant cells The recombinant expression vectors were transformed into the corresponding cell lines to obtain recombinant cells. Positive transformants were obtained through antibiotic screening, and PCR verification confirmed the correct insertion of the target gene. The PCR amplification products were analyzed by agarose gel electrophoresis, and the determination was based on whether the band size met expectations. Verified transformants were mixed with glycerol and stored at -80℃ for later use.

[0043] Vector integration verification for each gene used universal primers, as follows: Primer pair used for the E. coli expression vector pET28a: Forward primer F: TAATACGACTCACTATAGGG (SEQ ID No. 9) Reverse primer R: GCTAGTATTGCTCAGCGG (SEQ ID No. 10) Primer pair used for Bacillus subtilis expression vector pMA5: Forward primer F: CGAAAGGGTTATGTGCTGCG (SEQ ID No. 11) Reverse primer R: GACAGCGTGAGCGTGGTTTTA (SEQ ID No. 12) Primer pair used for Corynebacterium glutamicum expression vector pXMJ19: Forward primer F: AATGAGATCTTTCGTTTGGATC (SEQ ID No. 13) Reverse primer R: CGACGGGTTCTTTTTTCCAC (SEQ ID No. 14) Primer pair used for the Saccharomyces cerevisiae expression vector pESC-URA: Forward primer F: ATTTTCGGTTTGTATTACTTC (SEQ ID No. 15) Reverse primer R: TGTTTTTCGTTTACCAAAAAATG (SEQ ID No. 16) Yersinia lipophila expression vector: pINA1296. Primer pair used: Forward primer F: GGCTAACTTAAATTCCATATGG (SEQ ID No. 17) Reverse primer R: GCTCAGAACTTCTCAAGGC (SEQ ID No. 18) 3.3 Preparation of Multi-Chassis Whole-Cell Catalysts This embodiment adopts a "make-to-use" strategy, directly transforming the constructed recombinant plasmid into commercial host bacteria. After induction of expression, the bacterial cells are collected as whole-cell catalysts without the need for strain preservation.

[0044] 3.3.1 Preparation of Escherichia coli whole-cell catalyst Add 500 ng of pET-28a(+)-TcUGT1 (or TcUGT6) recombinant plasmid to 50 μL of E. coli Rosetta(DE3) competent cells, incubate on ice for 30 min, heat shock at 42℃ for 90 s, and incubate on ice for 2 min. Add 950 μL of LB medium, thaw at 37℃ for 1 h, then plate onto Kana-LA plates and incubate overnight at 37℃. Pick single colonies and inoculate into 5 mL of Kana-LB medium for overnight culture as seed culture. Inoculate the seed culture at 1% (v / v) into 1 L of Kana-LB medium and culture at 37℃ and 220 rpm until OD600≈0.6-0.8. Add IPTG (Sigma, I6758) to a final concentration of 0.1 mM and induce at 18℃ for 18 h. Collect bacterial cells by centrifugation at 4000 rpm for 8 min, wash twice with 50 mM Tris-HCl (pH 7.5) and resuspend to obtain whole-cell E. coli catalyst.

[0045] 3.3.2 Preparation of Bacillus subtilis whole-cell catalyst The pMA5-TcUGT1 (or TcUGT6) plasmid was introduced into *B. subtilis* WB800N competent cells via electroporation (2.5 kV, 5 ms). Cells were then revived with 1 mL LB medium and 0.5 M sorbitol for 3 h, plated on Kana-LA plates, and incubated overnight at 37°C. Single colonies were picked to prepare a seed culture, which was inoculated at 2% onto 1 L Kana-LB medium and incubated at 37°C until OD600 ≈ 0.8. IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 30°C for 16 h. The cells were collected by centrifugation, washed, and resuspended to obtain whole-cell catalysts from *Bacillus subtilis*.

[0046] 3.3.3 Preparation of whole-cell catalyst from Corynebacterium glutamicum The pXMJ19-TcUGT1 (or TcUGT6) plasmid was electroporated into *C. glutamicum* ATCC 13032 competent cells (treated with 2% glycine to weaken the cell wall). After electroporation, the cells were added to BHIS medium, heat-shocked at 46°C for 6 min, and recovered at 30°C for 2 h. The cells were then plated on Cm-BHI plates and cultured at 30°C for 2 days. Single colonies were picked to prepare a seed culture, which was inoculated at 2% into 1 L of BHI (containing Cm) and cultured at 30°C until OD600≈0.8. IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 25°C for 20 h. The cells were collected by centrifugation, washed, and resuspended to obtain whole-cell catalysts for *Corynebacterium glutamicum*.

[0047] 3.3.4 Preparation of whole-cell catalyst from Saccharomyces cerevisiae pESC-URA-TcUGT1 (or TcUGT6) was transformed into *S. cerevisiae* CEN.PK2 using the lithium acetate method. The transformed cells were plated on SD-URA plates and incubated at 30°C for 2-3 days. Single colonies were picked and inoculated into SD-URA medium for 24 h as seed culture. This seed culture was then inoculated at 2% of the seed culture into 1 L of SD-URA medium and incubated at 30°C until OD600 ≈ 1.0. The cells were collected by centrifugation and resuspended in 1 L of YPGal (containing 2% galactose) and induced at 30°C for 24 h. The cells were then collected by centrifugation, washed, and resuspended to obtain the whole-cell catalyst of *Saccharomyces cerevisiae*.

[0048] 3.3.5 Preparation of whole-cell catalyst from Yersinia lipolytica pINA1296-TcUGT1 (or TcUGT6) was transformed into Y. lipolytica Po1f using the lithium acetate method, plated on YNB-Leu plates, and incubated at 28°C for 2-3 days. Single colonies were picked to prepare seed culture, which was inoculated at 2% into 1 L of YNB-Leu plate and incubated at 28°C until OD600≈1.0. The cells were collected by centrifugation, washed, and resuspended to obtain the whole-cell catalyst of Y. lipolytica.

[0049] 3.4 Whole-cell catalytic synthesis of chrysanthemic acid-glucose 3.4.1 Catalytic Reaction System The whole-cell catalysts for each chassis prepared in step 2 were used for catalytic reactions, and the systems are shown in Table 3: Table 3

[0050] Reaction conditions: 25℃, 220 rpm, reaction time 12 h. Empty vector-transformed strains in each chassis were used as negative controls.

[0051] 3.4.2 Sample preparation and LC-MS detection After the reaction was completed, an equal volume of methanol was added to terminate the reaction. The supernatant was collected by centrifugation at 13000×g for 10 min. LC-MS (Thermo Q Exactive) was used for detection on a Waters ACQUITY BEH C18 column in ESI negative ion mode. Quantitative analysis was performed based on the characteristic ion of chrysanthemic acid-glucose ([M+HCOOH-H]-, EIC=375).

[0052] Table 4. Statistics on whole-cell catalysis of different chassis

[0053] As shown in Table 4, the target product was not detected in the control group (without any integrated UGT gene), while chrysanthemic acid-UDP-glucose was detected in all chassis transformed with the TcUGT and TcUGT6 genes, indicating that it can be stably expressed in different chassis. These results demonstrate that strains expressing the TcUGT1 and TcUGT6 genes derived from pyrethrum can synthesize chrysanthemic acid-UDP-glucose and have good potential for industrial application.

[0054] Example 4: Heterologous expression and fermentation of TcUGT1 and TcUGT6 genes in different microbial chassis to synthesize chrysanthemic acid-UDP-glucose. To verify whether the pyrethrum TcUGT1 and TcUGT6 genes can function in Escherichia coli, Saccharomyces cerevisiae, Bacillus subtilis, Yarrowia lipolytica, and Corynebacterium glutamicum through heterologous expression fermentation (i.e., directly utilizing the host cell's own metabolism to achieve chrysanthemic acid glycosylation during fermentation), the TcUGT1 and TcUGT6 genes were transferred into the above five types of chassis cells, and their chrysanthemic acid-UDP-glucose synthesis capacity was compared and analyzed.

[0055] 4.1 Construction of recombinant expression vectors Similar to Example 3.1, based on the TcUGT1 and TcUGT6 gene sequences obtained in Example 2, the target genes were cloned into the corresponding expression vectors using the Gibson assembly method: Escherichia coli expression vector: pET28a, Bacillus subtilis expression vector: pMA5, Corynebacterium glutamicum expression vector: pXMJ19, Saccharomyces cerevisiae expression vector: pESC-URA, and Yersinia lipolyticis expression vector: pINA1296.

[0056] After construction, the recombinant expression vectors that were verified to be correct by sequencing were named as follows: pET28a-TcUGT1 / pET28a-TcUGT6, pMA5-TcUGT1 / pMA5-TcUGT6, pXMJ19-TcUGT1 / pXMJ19-TcUGT6, pESC-URA-TcUGT1 / pESC-URA-TcUGT6, and pINA1296-TcUGT1 / pINA1296-TcUGT6.

[0057] 4.2 Preparation of recombinant host cells The recombinant expression vectors described above were transformed into the corresponding chassis cells using the same transformation method as in Example 3.2, resulting in recombinant host cells. Positive transformants were obtained through antibiotic screening and verified by PCR using the universal primers (SEQ ID No. 9-18) listed in Example 3.2 to confirm correct insertion of the target gene. The verified transformants were mixed with glycerol and stored at -80°C for later use.

[0058] 4.3 Heterologous expression fermentation This embodiment employs a "fermentation-in situ transformation" strategy. During the fermentation culture of recombinant host cells, chrysanthemic acid is added to the culture medium as a substrate while inducing the expression of the TcUGT gene. This allows the host cells to directly utilize glycosyl donors such as UDP-glucose produced by their own metabolism to convert chrysanthemic acid into chrysanthemic acid-UDP-glucose during growth, and finally separate and purify the product from the fermentation broth.

[0059] 4.3.1 Heterologous expression and fermentation of Escherichia coli Recombinant *E. coli* host cells containing pET28a-TcUGT1 (or TcUGT6) were inoculated into 5 mL of Kana-LB medium and cultured overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then inoculated at 1% (v / v) into 1 L of Kana-LB medium and cultured at 37°C and 220 rpm until OD600 ≈ 0.6–0.8. IPTG was added to a final concentration of 0.1 mM, and chrysanthemic acid was added to a final concentration of 50 μM. The culture was continued at 18°C ​​for 24 h. After fermentation, the supernatant was collected by centrifugation at 4000 rpm for 10 min for product detection.

[0060] 4.3.2 Heterologous expression and fermentation of Bacillus subtilis Recombinant Bacillus subtilis host cells containing pMA5-TcUGT1 (or TcUGT6) were inoculated into 5 mL of Kana-LB medium and cultured overnight at 37°C and 220 rpm to obtain the seed culture. The seed culture was then inoculated at 2% (v / v) into 1 L of Kana-LB medium and cultured at 37°C and 220 rpm until OD600 ≈ 0.8. IPTG was added to a final concentration of 0.5 mM, and chrysanthemic acid was added to a final concentration of 50 μM. The culture was continued at 30°C for 24 h. After fermentation, the supernatant was collected by centrifugation at 4000 rpm for 10 min for product detection.

[0061] 4.3.3 Heterologous expression and fermentation of Corynebacterium glutamicum Recombinant host cells of *Corynebacterium glutamicum* containing pXMJ19-TcUGT1 (or TcUGT6) were inoculated into 5 mL of BHI (chloramphenicol-containing) medium and cultured at 30°C and 200 rpm for 24 h to obtain the seed culture. The seed culture was then inoculated at 2% (v / v) into 1 L of BHI (chloramphenicol-containing) medium and cultured at 30°C and 200 rpm until OD600 ≈ 0.8. IPTG was added to a final concentration of 0.5 mM, and chrysanthemic acid was added to a final concentration of 50 μM. The culture was continued at 25°C for 36 h. After fermentation, the supernatant was collected by centrifugation at 4000 rpm for 10 min for product detection.

[0062] 4.3.4 Heterologous expression fermentation of Saccharomyces cerevisiae Recombinant Saccharomyces cerevisiae host cells containing pESC-URA-TcUGT1 (or TcUGT6) were inoculated into 5 mL of SD-URA medium and cultured at 30°C and 220 rpm for 24 h to obtain the seed culture. The seed culture was then inoculated at 2% (v / v) into 1 L of SD-URA medium and cultured at 30°C and 220 rpm until OD600≈1.0. The cells were collected by centrifugation and resuspended in 1 L of YPGal (containing 2% galactose) medium, with chrysanthemic acid added to a final concentration of 50 μM. The cells were then cultured at 30°C for another 48 h. After fermentation, the supernatant was collected by centrifugation at 4000 rpm for 10 min for product detection.

[0063] 4.3.5 Heterologous expression and fermentation of Yersinia lipophila Recombinant host cells of *Yarrowia lipolyticis* containing pINA1296-TcUGT1 (or TcUGT6) were inoculated into 5 mL of YNB-Leu medium and cultured at 28°C and 220 rpm for 24 h to obtain the seed culture. The seed culture was then inoculated into 1 mL of YNB-Leu medium at 2% (v / v) and cultured at 28°C and 220 rpm until OD600 ≈ 1.0. Chrysanthemic acid was added to a final concentration of 50 μM, and the culture was continued at 28°C for another 48 h. After fermentation, the supernatant was collected by centrifugation at 4000 rpm for 10 min for product detection.

[0064] 4.4 Product Detection and Analysis The same LC-MS method as in Example 3.4.2 was used for detection, with the fermentation supernatant of each chassis empty vector transformed strain as a negative control.

[0065] The results are shown in Table 5. In all five chassis cell types, chrysanthemic acid-UDP-glucose was detected in the fermentation supernatant of recombinant host cells expressing TcUGT1 or TcUGT6 after heterologous expression fermentation, while the target product was not detected in the fermentation supernatant of the empty vector control strain. These results indicate that the TcUGT1 and TcUGT6 genes can achieve in situ synthesis of chrysanthemic acid-UDP-glucose through heterologous expression fermentation in various prokaryotic and eukaryotic microorganisms.

[0066] Table 5. Statistics on heterologous expression fermentation in different chassis

[0067] This embodiment successfully verified that the TcUGT1 and TcUGT6 genes from pyrethrum can synthesize chrysanthemic acid-UDP-glucose through heterologous expression fermentation in five chassis cells: *Escherichia coli*, *Saccharomyces cerevisiae*, *Bacillus subtilis*, *Yersinia lipolyticis*, and *Corynebacterium glutamicum*. Compared with the whole-cell catalysis method in Example 3, heterologous expression fermentation eliminates the steps of cell collection and resuspension, simplifying the operation process and making it more suitable for industrial-scale production. The above results indicate that host cells integrating the TcUGT1 and TcUGT6 genes from pyrethrum can achieve efficient synthesis of chrysanthemic acid-UDP-glucose regardless of whether whole-cell catalysis or heterologous expression fermentation is used, demonstrating good potential for industrial application.

[0068] Example 5: Cloning and functional verification of the pyrethrum TcUGT6 gene mutant To investigate the effect of the conservation of the TcUGT6 gene sequence on its catalytic function in the formation of chrysanthemic acid-UDP-glucose from chrysanthemic acid, this embodiment, based on Example 2, performed site-directed mutagenesis on the TcUGT6 gene to obtain mutants with 90% (TcUGT6_V90), 85% (TcUGT6_V85), and 80% (TcUGT6_V80) sequence identity with the wild-type TcUGT6 (SEQ ID No. 4), respectively. Their nucleotide sequences are shown in SEQ ID Nos. 19-21, respectively. These mutants were obtained through whole-gene synthesis and constructed into pET-28a(+) expression vectors. The methods for obtaining the TcUGT1 gene, constructing the expression vector, and purifying the protein were the same as in Example 2.

[0069] 5.1 Construction of mutant expression vectors and protein expression The synthesized TcUGT6_V90, TcUGT6_V85, and TcUGT6_V80 gene fragments were ligated into the pET-28a(+) vector using the Gibson assembly method, transformed into *E. coli* DH5α, and the plasmids were extracted after sequencing verification. The recombinant plasmids were then transformed into Rosetta DE3 expression strains, and IPTG expression was induced according to the methods in Examples 2.3–2.4 (0.1 mM IPTG, 18°C ​​for 18 h). The recombinant proteins were purified by nickel column affinity chromatography. SDS-PAGE electrophoresis showed that all three mutant proteins were expressed in soluble form, with molecular weights consistent with wild-type TcUGT6 (approximately 52 kDa).

[0070] 5.2 In vitro enzymatic reaction and product detection The purified TcUGT6 mutant protein was subjected to in vitro enzymatic reactions with substrates chrysanthemic acid and UDP-glucose, respectively. The reaction system was the same as in Example 2.5: 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 5% (v / v) glycerol, 1 mM DTT, 50 μM chrysanthemic acid, 50 μM UDP-glucose, 5 μg purified TcUGT6 mutant protein (or wild-type TcUGT6), and the reaction was carried out at 25°C and 220 rpm for 12 h. The following controls were also set up: Positive control group 1: TcUGT6 Negative control group 2: No UGT protein added (only chrysanthemic acid + UDP-glc) Blank control: Reaction buffer only Experimental Group 1: TcUGT6_V90 Experimental Group 2: TcUGT6_V85 Experimental Group 3: TcUGT6_V80 After the reaction was completed, an equal volume of methanol was added to terminate the reaction as described in Example 2.6. The supernatant was collected by centrifugation, and the characteristic ions of the target product, chrysanthemic acid-UDP-glucose ([M+HCOOH-H), were extracted using LC-MS. - The results showed that a significant chrysanthemic acid-UDP-glucose signal was detected in negative control group 1, while the product signal of experimental group 1 (TcUGT6_V90) was approximately 78% of the peak area of ​​the product in negative control group 1, indicating that the mutant retained most of its catalytic activity. In contrast, the peak area of ​​the product in experimental group 2 (TcUGT6_V85) was only about 25% of that in negative control group 1, indicating a significant decrease in activity, but still significantly higher than that in negative control group 2. The peak area of ​​the product in experimental group 3 (TcUGT6_V80) was not significantly different from that in negative control 2, indicating that the mutant almost completely lost its ability to catalyze the glycosylation of chrysanthemic acid. These results indicate that the conservation of the TcUGT6 gene sequence is crucial to its function in catalyzing the formation of chrysanthemic acid-UDP-glucose from chrysanthemic acid: high activity is maintained when sequence identity is ≥90%, activity decreases significantly when identity drops to 85%, and function is essentially lost when identity is ≤80%. These results provide a basis for sequence tolerance in the engineering modification of glycosyltransferases in the pyrethroid biosynthesis pathway.

[0071] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A Chrysanthemum cinerariaeifolium TcUGT gene encoded protein, characterized in that, The pyrethrum TcUGT gene-encoded protein includes one or more of the TcUGT1 gene-encoded protein and the TcUGT6 gene-encoded protein; wherein, the amino acid sequence of the TcUGT1 gene-encoded protein is the sequence shown in SEQ ID No. 1, or has at least 85% sequence identity with SEQ ID No. 1, and contains the conserved region shown in amino acids 228-453 of SEQ ID No. 1, and has the activity of catalyzing chrysanthemic acid glycosylation to form chrysanthemic acid-UDP-glucose; the amino acid sequence of the TcUGT6 gene-encoded protein is the sequence shown in SEQ ID No. 2, or has at least 85% sequence identity with SEQ ID No. 2, and contains the conserved region shown in amino acids 187-439 of SEQ ID No. 2, and has the activity of catalyzing chrysanthemic acid glycosylation to form chrysanthemic acid-UDP-glucose.

2. The application of the protein encoded by the pyrethrum TcUGT gene as described in claim 1 in the synthesis of chrysanthemic acid-UDP-glucose.

3. A Chrysanthemum cinerariafium TcUGT gene, characterized in that, The pyrethrum TcUGT gene includes one or more of the TcUGT1 gene and the TcUGT6 gene; wherein the nucleotide sequence of the TcUGT1 gene is shown in SEQ ID No. 3, and the nucleotide sequence of the TcUGT6 gene is shown in SEQ ID No.

4.

4. The Chrysanthemum cinerariafium TcUGT gene of claim 3, characterized in that, The forward and reverse primers used to extend the TcUGT1 gene are shown in SEQ ID No. 5-6, and the forward and reverse primers used to extend the TcUGT6 gene are shown in SEQ ID No. 7-8, respectively.

5. A recombinant expression vector, characterized in that, It contains the pyrethrum TcUGT gene as described in claim 3.

6. A host cell, characterized in that, The recombinant expression vector as described in claim 5 is included, wherein the host cell is selected from any one of Escherichia coli, Saccharomyces cerevisiae, Bacillus subtilis, Yersinia lipolytica, and Corynebacterium glutamicum.

7. A whole cell catalytic system characterized in that, The whole-cell catalytic system is prepared by inducing expression in the host cell described in claim 6.

8. A method for producing chrysanthemic acid-UDP-glucose using the host cell of claim 6 or the whole cell catalytic system of claim 7, characterized in that, The method includes whole-cell catalysis or heterologous expression fermentation.

9. The method according to claim 8, characterized in that, The whole-cell catalysis includes the following steps: S1. The whole-cell catalytic system and the substrate are mixed in a reaction buffer to carry out the catalytic reaction; S2. Separate and / or purify chrysanthemic acid-UDP-glucose from the reaction system; The reaction buffer comprises: 40-60 mM Tris-HCl, 3-6 mM MgCl2, 3-6% (v / v) glycerol, and 1-2 mM DTT; the catalytic reaction conditions are: reaction temperature 25-30℃, rotation speed 200-250 rpm, and reaction time 12-24 h; the substrate includes chrysanthemic acid or a chrysanthemic acid precursor, and a glycosyl donor; the glycosyl donor includes UDP-glucose or UDP-galactose.

10. The method according to claim 8, characterized in that, The heterologous expression fermentation includes the following steps: inoculating host cells into a fermentation medium, fermenting and culturing, inducing TcUGT gene expression, converting chrysanthemic acid into chrysanthemic acid-UDP-glucose, and separating and purifying chrysanthemic acid-UDP-glucose from the fermentation product. The fermentation culture was carried out at a temperature of 25-37℃, a pH of 6.0-8.0, and a fermentation time of 24-72 hours, with expression induced by the addition of an inducer.

Images