A cas12a protein and applications thereof

Abstract

The application belongs to the technical field of biology and particularly relates to a Cas12a protein and application thereof. The amino acid sequence of the Cas12a protein is shown as SEQ ID NO:1. The Cas12a protein of the application can recognize more suboptimal PAM sequences, targets more genomic sites, and expands the application range of CRISPR-Cas12a.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a Cas12a protein and its applications. Background Technology

[0002] The CRISPR-Cas system is currently the most widely used gene editing system in the biomedical field, with typical representatives being the CRISPR-Cas9 and CRISPR-Cas12a systems. In the CRISPR-Cas system, Cas nucleases recognize specific protospacer adjacent motif (PAM) sequences and, guided by sgRNA or crRNA, recognize and cleave the target nucleic acid sequence, resulting in a DNA double-strand break. When a DNA double-strand break occurs in a cell, the cell initiates DNA damage repair mechanisms, primarily including non-homologous end-joining (NHEJ) and homology-directed repair (HDR). NHEJ typically induces base insertion or deletion at the DNA double-strand break and is commonly used for target gene knockout; when a homologous template is present, HDR in the cell can be used to achieve site-specific gene insertion and precise introduction of target mutations.

[0003] Cas9's targeted cleavage creates blunt-end cuts in DNA, causing small insertion or deletion mutations. Depending on the specific pattern of insertion or deletion, it may preserve the target gene's reading frame or generate in-frame mutations, resulting in a protein product that retains some function, but cannot completely knock out the target gene. Cas12a's targeted cleavage creates sticky ends in DNA, causing larger insertion or deletion mutations than Cas9, more easily disrupting the target gene's reading frame and thus completely knocking it out. Furthermore, Cas12a possesses RNase activity, capable of processing tandem crRNA precursors into mature CRISPR RNA (crRNA) by cleaving conserved direct repeat sequences, enabling simultaneous knockout of multiple target genes or multiplex knockout of a single target gene. Moreover, CRISPR-Cas12a exhibits higher cleavage specificity than CRISPR-Cas9. Therefore, Cas12a is an ideal tool for gene knockout applications.

[0004] In addition to targeted cleavage activity, the Cas12a system also has random cleavage activity on non-target single-stranded DNA molecules, known as trans cleavage activity. Nucleic acid detection systems developed based on trans cleavage activity have shown good detection performance and application potential in the field of molecular diagnostics.

[0005] Currently, the most widely used gene knockout and nucleic acid detection system is LbCas12a from Lachnospiraceae bacterium. LbCas12a recognizes the PAM sequence of TTTV, but its narrow PAM range limits its application in gene editing and nucleic acid detection. Therefore, finding a new Cas12a system from a new genus that recognizes a wider PAM range can not only further enrich the existing Cas12a toolbox, but also expand the application scope of the Cas12a system. Summary of the Invention

[0006] On one hand, the present invention provides a Cas12a protein, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0007] In some embodiments, the Cas12a protein is GhCas12a.

[0008] In one exemplary embodiment, the Cas12a protein is GhCas12a of the gastrophilaceae bacterium g__HBA2883.

[0009] On one hand, the present invention provides a fusion protein or conjugate comprising the Cas12 protein fused to or conjugated to a protein active domain or a non-protein active domain.

[0010] In some embodiments, the protein active functional domain is selected from peptides and protein structural domains; in some embodiments, the non-protein active functional domain is selected from nucleic acid molecules, small molecule cytotoxic agents, small molecule immunomodulators, and small molecule pathway regulators; in some embodiments, the peptide is selected from affinity tags, reporter tags, and fusion tags; in some embodiments, the protein structural domain is selected from cytosine deaminase domains, adenine deaminase domains, translational regulatory domains, transcriptional regulatory domains, nuclease domains, epigenetic regulatory domains, guided editing domains, recombinase domains, reverse transcriptase domains, transposase domains, and transcription factor domains.

[0011] On one hand, the present invention provides a nucleic acid molecule, said nucleic acid molecule being selected from at least one of the following:

[0012] 1) A nucleic acid molecule encoding the Cas12a protein; or

[0013] A nucleic acid molecule complementary to the nucleic acid molecule encoding the Cas12a protein described above;

[0014] 2) Encode the fusion protein or conjugate described herein.

[0015] In some implementations, the nucleic acid molecule is DNA or RNA.

[0016] On one hand, the present invention provides an expression vector comprising the aforementioned nucleic acid molecule.

[0017] On one hand, the present invention provides a recombinant cell, the recombinant cell comprising the aforementioned nucleic acid or the aforementioned expression vector.

[0018] In some embodiments, the recombinant cells are eukaryotic or prokaryotic cells; in some embodiments, the recombinant cells are plant cells, animal cells, or fungal cells; in some embodiments, the recombinant cells are Escherichia coli cells.

[0019] On one hand, the present invention provides a CRISPER-Cas system, characterized in that it includes the Cas12a protein; or the fusion protein or conjugate.

[0020] In some embodiments, it further includes at least one of the following: crRNA, tracrRNA, and chimeric RNA formed by crRNA and tracrRNA; in some embodiments, the sequence of said crRNA comprises the sequence shown in any of SEQ ID NO: 2-3.

[0021] On one hand, the present invention provides a kit comprising the Cas12a protein, the fusion protein or conjugate, the nucleic acid molecule, the expression vector, the recombinant cells and / or the CRISPER-Cas system.

[0022] On one hand, the present invention provides a pharmaceutical composition comprising the Cas12a protein, the fusion protein or conjugate, the nucleic acid molecule, the expression vector, the recombinant cell and / or the CRISPER-Cas system, and pharmaceutically acceptable carriers and / or excipients.

[0023] On the one hand, the present invention provides the application of the Cas12a protein, the fusion protein or conjugate, the nucleic acid molecule, the expression vector, the recombinant cell, the CRISPER-Cas system, the kit, or the pharmaceutical composition, such as at least any one of a1-a4:

[0024] a1. Gene editing for non-diagnostic and therapeutic purposes;

[0025] a2. Nucleic acid testing for non-diagnostic or therapeutic purposes;

[0026] a3. To prepare drugs for gene editing;

[0027] a4. Prepare kits for nucleic acid detection.

[0028] This invention also provides a gene editing method, which uses the CRISPER-Cas system described in this invention to edit target DNA, specifically including the following steps:

[0029] ① Design target-specific crRNAs based on the nucleic acid sequences of the target genes;

[0030] ② Introduce the CRISPER-Cas system and target-specific crRNA described in this invention into the cells to be edited;

[0031] ③ Detection of editing efficiency in cells to be edited.

[0032] The present invention also provides a nucleic acid detection kit, which includes crRNA that specifically binds to target nucleic acids, GhCas12a protein, single-stranded DNA nucleic acid probe and reaction buffer.

[0033] The target nucleic acid can be genomic DNA, cDNA, viral DNA, etc.

[0034] The single-stranded DNA nucleic acid probe may contain any sequence, except for polyG (polyguanosine monophosphate).

[0035] The Cas12a protein of this invention can recognize more suboptimal PAM sequences and target more genomic sites, thus expanding the application scope of CRISPR-Cas12a. Attached Figure Description

[0036] Figure 1 The top image shows the structure of plasmid pET28a-GhCas12a in Example 1; the bottom image shows the SDS-PAGE gel images of GhCas12a and LbCas12a proteins in Example 1.

[0037] Figure 2 This is for the detection of GhCas12a-targeted dsDNA cleavage activity in Example 2.

[0038] Figure 3 This refers to the cleavage activity of GhCas12a on different PAM sequence target sites in Example 2.

[0039] Figure 4 This refers to the relative cleavage activity of GhCas12a against different PAM sequence target sites in Example 2.

[0040] Figure 5 This is an example of detecting the targeted cleavage activity of GhCas12a at different temperatures in Example 2.

[0041] Figure 6 This is for the activity detection of GhCas12a trans-cleavage ssDNA reporter in Example 3.

[0042] Figure 7 This is an activity test of ssDNA reporter trans-cleavage of different sequences by GhCas12a in Example 3.

[0043] Figure 8 This is a screening of the buffer solution in the GhCas12a trans-cleavage reaction system in Example 3.

[0044] Figure 9 This study examines the editing ability of GhCas12a in 293T and Hepa1-6 cells in Example 4.

[0045] Figure 10 This study describes the detection of cytosine editing efficiency at different positions in the four target sites C1 to C4 of GhCas12a-CBE in Example 5. Specifically, C12, C13, and C14 represent the editing efficiency of C1 at positions 12, 13, and 14 within the C1 crRNA editing window; C10 represents the editing efficiency of C10 within the C2 crRNA editing window; C8 and C10 represent the editing efficiency of C8 and C10 within the C3 crRNA editing window; and C8, C10, C12, and C13 represent the editing efficiency of C8, C10, C12, and C13 within the C4 crRNA editing window.

[0046] Figure 11 This study describes the detection of adenine editing efficiency at different positions in the four target sites A1 to A4 of GhCas12a-ABE in Example 6. Specifically, A11 represents the editing efficiency of position 11 (A) within the A1 crRNA editing window; A7, A14, and A17 represent the editing efficiency of positions 7, 14, and 17 (A) within the A2 crRNA editing window; A10 represents the editing efficiency of position 10 (A) within the A3 crRNA editing window; and A9 and A11 represent the editing efficiency of positions 9 and 11 (A) within the A4 crRNA editing window.

[0047] Figure 12 The results show the homology comparison between GhCas12a and LbCas12a in Example 7. Detailed Implementation

[0048] The following embodiments are merely preferred embodiments of this application and should not be construed as limiting the scope of protection of this application. Any non-substantial changes and substitutions made by those skilled in the art based on this application shall fall within the scope of protection claimed by this application.

[0049] Unless otherwise stated, the methods and materials used in the embodiments are conventional materials and methods in the art.

[0050] Example 1

[0051] 1.1 Construction of the pET28-GhCas12a prokaryotic expression vector

[0052] The amino acid sequence of GhCas12a is shown in SEQ ID NO: 1, specifically derived from Cas12a of *Gastranaerophilaceae* bacterium g__HBA2883. The nucleic acid sequence encoding GhCas12a was codon-optimized using a prokaryotic expression system (specifically *Escherichia coli*), and the optimized gene sequence is shown in SEQ ID NO: 4. This sequence was then delivered to BGI Genomics for gene synthesis. A nuclear localization signal and a protein purification tag sequence were added to the GhCas12a gene sequence, and these were combined to construct the pET28a prokaryotic expression plasmid, resulting in the plasmid pET28a-GhCas12a (plasmid structure shown in...). Figure 1 (See the image above). The amino acid sequence of the nuclear localization signal is SEQ ID NO: 5, the nucleic acid sequence of the nuclear localization signal is SEQ ID NO: 6, and the protein purification tag is a 6*His tag. pET28a-GhCas12a was transformed into DH5α Escherichia coli. After overnight culture, single colonies were picked for expansion culture, and plasmids were extracted. The concentration and purity of the extracted plasmids were determined, and then frozen at -20°C for later use.

[0053] 1.2 Expression and purification of GhCas12a protein

[0054] The pET28a-GhCas12a plasmid was transformed into BL21(DE3) Escherichia coli. After overnight culture, single colonies were picked for expansion culture. When the OD value of the expanded culture reached 0.6, IPTG with a final concentration of 1 mM was added to induce protein expression. After induction at 16℃ for 16 h, the bacterial culture was collected, centrifuged, and the supernatant was discarded. An appropriate amount of Buffer A (25 mM Tris-HCl pH 8.0, 500 mM NaCl, 10% Glycerol) was added to fully resuspend the precipitate. The bacterial cells were lysed by sonication. The lysate was centrifuged at 10,000 rpm and 4℃ for 40 min. The collected supernatant was the crude extract of GhCas12a protein.

[0055] The crude extract of GhCas12a protein was incubated overnight at 4°C with equilibrated Ni-NTA agarose. The next day, a gradient elution was performed with imidazole concentrations of 0 mM, 10 mM, 50 mM, 80 mM, and 250 mM. After elution, samples of each imidazole concentration were run by SDS-PAGE electrophoresis. The imidazole eluates with higher concentrations and better purity of the target protein were combined and concentrated. An appropriate amount of the concentrate was used for SDS-PAGE identification, and the protein concentration was determined using a NanoPhotometer® NP80. Finally, the protein concentrate was aliquoted and frozen at -80°C for later use. LbCas12a protein was prepared according to the method in Example 1.2 of patent CN110551846B. The amino acid sequence of LbCas12a used in the example is shown in SEQ ID NO: 30. The SDS-PAGE gel images of purified GhCas12a and LbCas12a proteins are shown below. Figure 1 As shown.

[0056] Example 2

[0057] In this embodiment, the targeted cleavage activity of GhCas12a on dsDNA was detected.

[0058] 2.1 Construction of dsDNA plasmids containing target sites

[0059] GhCas12a targeting sequence T3 Target is TTTA CGTCGCCGTCCAGCTCGACC (SEQ ID NO: 31), where the underlined TTTA is the PAM sequence, was synthesized into an oligo containing the DNA sequence GCTTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCC (SEQ ID NO: 32) and its reverse complementary sequence. The oligo was then annealed (program: 95℃, 5 min; 95℃-85℃ at -2℃ / s; 85℃-25℃ at -0.1℃ / s; hold at 16℃), and then ligated into the blunt-ended vector pEASY®-Blunt Cloning Kit (Fullmetal: CB101). The ligation system was: 1 μL vector, 5 μL annealing product; ligation at 25℃ for 10 min, followed by transformation, bacterial picking, and identification. Plasmids were extracted from positive clones by shaking and their concentration determined for later use; the plasmid was named pEASY-TTTA-Target3.

[0060] 2.2 Preparation of linear dsDNA containing target site sequences

[0061] Using the pEASY-TTTA-Target3 plasmid prepared in step 2.1 as a PCR template, amplification was performed using primer F: CGCGTTGGCCGATTCATTAATG (SEQ ID NO: 33) and primer R: GGTCGAGGTGCCGTAAAGC (SEQ ID NO: 34). After the amplification product was identified as a single band by agarose gel electrophoresis, the amplification product was purified using the EZNA Cycle-pure Kit (omegaD6492). The purified product was then used after determining its concentration and purity. The purified product was named dsDNA-TTTA-Target3 (SEQ ID NO: 29).

[0062] 2.3 Detection of the targeted cleavage activity of GhCas12a protein on dsDNA

[0063] Synthesize T3 crRNA targeting T3:

[0064] TAATTTCTACTATTGTAGATCGTCGCCGTCCAGCTCGACC (SEQ ID NO: 35). The reaction solution shown in Table 1 was prepared in a 20 μL reaction system. The reaction was carried out at 37℃ for 0 min, 0.5 min, 1 min, 5 min, 10 min, 15 min, 30 min, and 60 min, respectively. The reaction was then terminated, and an appropriate amount of the reaction solution was taken for agarose gel electrophoresis identification.

[0065] Table 1

[0066] * The specific components of Cleave Buffer (10X) are: 150 mM KCl, 20 mM HEPES, 10 mM MgCl2, 0.5 mM DTT, 1% Glycerol, pH 7.5.

[0067] Relevant results are as follows Figure 2 As shown. Figure 2 The results showed that GhCas12a cleaved the 767 bp dsDNA-TTTA-Target3 (SEQ ID NO: 29) band into two bands of 292 bp and 475 bp, and the cleavage efficiency increased with increasing reaction time. This indicates that GhCas12a can effectively cleave the targeted dsDNA.

[0068] 2.4 PAM Sequencing of dsDNA Targeted by GhCas12a Protein

[0069] The PAM sequence TTTA in T3 Target was replaced with TTTT, TTTG, TTTC, CTTA, GTTA, ATTA, TCTA, TGTA, TATA, TTCA, TTGA, TTAA, CCTA, TCCA, and CCCA, respectively. Plasmid construction was performed according to 2.1, linear dsDNA preparation was performed according to 2.2, and the cleavage activity of GhCas12a and LbCas12a at different PAM sequence target sites was determined according to 2.3. The results are as follows: Figure 3 As shown.

[0070] GhCas12a and LbCas12a proteins exhibit comparable cleavage activity at the TTTA PAM sequence target site. Defining the cleavage efficiency of the TTTA PAM sequence target site as 100%, the relative cleavage efficiency of each PAM sequence relative to the TTTA PAM sequence was calculated, and the results are as follows: Figure 4 As shown. Figure 4 The results showed that the optimal PAM sequences (relative cleavage activity greater than 90%) identified by GhCas12a were 5'-TTTA, 5'-TTTG, and 5'-TTTC, consistent with LbCas12a; the second-best PAM sequences (relative cleavage activity greater than 60%) were 5'-TTTT, 5'-CTTA, 5'-GTTA, 5'-TCTA, and 5'-TTCA, which were more extensive than the second-best PAM sequences (5'-TTTT and 5'-TTCA) identified by LbCas12a.

[0071] 2.5 Determination of reaction temperature for GhCas12a protein-targeted cleavage of dsDNA

[0072] The cleavage activity of GhCas12a at the target site was determined under different temperature conditions according to the reaction system described in 2.3. The reaction temperatures were set at 5℃, 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, 65℃, and 70℃. The relevant results are as follows: Figure 5 As shown. Figure 5 The results showed that GhCas12a had targeted cleavage activity in the temperature range of 15℃ to 70℃, with the highest cleavage activity in the range of 30℃ to 50℃.

[0073] Example 3

[0074] In this embodiment, the trans-cleavage activity of GhCas12a protein was detected, and the ssDNA reporter and buffer in the trans-cleavage reaction system were optimized.

[0075] 3.1 Identification of GhCas12a trans-cleavage activity

[0076] For example, in 2.3, synthesize T3 crRNA targeting T3 with GhCas12a:

[0077] TAATTTCTACTATTGTAGATCGTCGCCGTCCAGCTCGACC (SEQ ID NO: 35), and

[0078] LbCas12a targets Lb-T3 crRNA:

[0079] TAATTTCTACTAAGTGTAGATCGTCGCCGTCCAGCTCGACC (SEQ ID NO: 36).

[0080] In a 20 μL reaction system, the reaction solutions shown in Table 2 were prepared. After thorough mixing of all components, the system was incubated at 37°C. The fluorescence intensity in the reaction system was measured using a full-wavelength microplate reader, with measurements taken every 5 minutes for 2 hours to monitor fluorescence kinetics. The excitation wavelength was 485 nm, and the emission wavelength was 520 nm. The trans-cleavage activity of the Cas12a protein was characterized by the fluorescence intensity generated after the ssDNA reporter was cleaved.

[0081] Table 2

[0082] *ssDNA reporter is ssDNA labeled with 6-carboxyfluorescein (6-FAM) and a fluorescence quencher (BHQ1), with the sequence FAM-TTATT-BHQ1.

[0083] Relevant results are as follows Figure 6 As shown, Figure 6 The results showed that GhCas12a protein effectively cleaves ssDNA reporter under T3 crRNA (red) guidance; and the trans cleavage activity of GhCas12a protein under Lb-T3 crRNA (green) guidance was comparable to that of T3 crRNA (red), while the trans cleavage activity of LbCas12a protein under T3 crRNA (blue) guidance was comparable to that of Lb-T3 crRNA (black), indicating that the crRNA backbones of GhCas12a and LbCas12a can be used interchangeably.

[0084] 3.2 Sequence preference determination of GhCas12a trans-cleavage of ssDNA

[0085] Four ssDNA reporter sequences (PolyA, PolyT, PolyC, and PolyG) were synthesized. The sequences for PolyA (FAM-AAAAAA-BHQ1), PolyT (FAM-TTTTTT-BHQ1), PolyC (FAM-CCCCCC-BHQ1), and PolyG (FAM-GGGGGG-BHQ1) were as follows: PolyA (FAM-AAAAAA-BHQ1), PolyT (FAM-TTTTTT-BHQ1), PolyC (FAM-CCCCCC-BHQ1), and PolyG (FAM-GGGGGG-BHQ1). The reaction system and conditions were as described in section 3.1. The relevant results are as follows: Figure 7 As shown. Figure 7 The results showed that GhCas12a could effectively cleave the ssDNA reporter of PolyA, PolyT and PolyC, but could not cleave the ssDNA reporter of PolyG.

[0086] 3.3 Buffer system screening for GhCas12a trans-cleavage of ssDNA

[0087] Prepare the reverse cleavage buffer according to the table below. Replace the reaction buffer in 3.1 with the buffer in Table 3 below. Follow the reaction system and conditions as in 3.1. Finally, take the fluorescence value detected for 60 minutes as the reaction value. The relevant results are as follows: Figure 8 As shown. Figure 8 The results showed that, compared to the NEBuffer™ 3.1 used in the original system, the custom-configured Buffer 9 and Buffer 10 in the buffer list had higher trans-cleavage activity.

[0088] Table 3

[0089] Example 4

[0090] In this embodiment, the ability of the GhCas12a editing system to perform gene editing in mammalian cells was tested.

[0091] 4.1 Construction of pCMV-GhCas12a and pGL3-U6-Gh crRNA eukaryotic expression vectors

[0092] The nucleic acid sequence encoding GhCas12a was codon-optimized for a mammalian expression system. The optimized gene sequence is shown in SEQ ID NO: 7. This sequence was then used for gene synthesis, and a nuclear localization signal sequence was added before and after the GhCas12a gene sequence. The resulting plasmid was constructed into a eukaryotic expression vector carrying the CMV promoter (Addgene#138489), yielding the plasmid pCMV-GhCas12a (structure shown in Figure 7). Figure 9 As shown in the figure above, the amino acid sequence of the nuclear localization signal NLS is shown in SEQ ID NO: 8.

[0093] The crRNA backbone sequence of GhCas12a (SEQ ID NO: 2) was synthesized and constructed into the vector backbone of pGL3-U6-sgRNA (Addgene#51133) to obtain the plasmid pGL3-U6-Gh crRNA.

[0094] pCMV-GhCas12a and pGL3-U6-Gh crRNA plasmids were transformed into DH5α Escherichia coli. After overnight culture, single colonies were picked and expanded. Then, plasmids were extracted. The concentration and purity of the extracted plasmids were determined and frozen at -20°C for later use.

[0095] 4.2 Construction of site-targeted Gh crRNA plasmids

[0096] The crRNA sequences targeting the 293T cell genome are shown in SEQ ID NO:9-11, and the crRNA sequences targeting the mouse Hepa1-6 cell genome are shown in SEQ ID NO:12-14. AGAT was added to the 5' end of the crRNA sequence as the upstream sequence, and AAAA was added to the 5' end of the crRNA reverse complementary sequence as the downstream sequence. After oligo synthesis, the upstream and downstream sequences were annealed (program: 95℃, 5 min; 95℃-85℃ at -2℃ / s; 85℃-25℃ at -0.1℃ / s; hold at 16℃). The resulting vector was then ligated into the pGL3-U6-Gh crRNA vector digested with BsaI (NEB: R3733L). The digestion system was: pGL3-U6-Gh crRNA 2 μg; CutSmart buffer (NEB: B7204S) 6 μL; BsaI 1 μL; ddH2O to a final volume of 60 μL, digested overnight at 37℃. The ligation system consisted of: 3 μL Solution I (Takara: 6022Q); 1 μL of the digested vector; and 6 μL of the annealing product. Ligation was performed at 16℃ for 30 min, followed by transformation, bacterial picking, and identification. Plasmids (Axygene: AP-MN-P-250G) were extracted from positive clones by shaking, and their concentration was determined for later use.

[0097] 4.3 Cell Culture and Transfection

[0098] HEK293T cells and Hepa1-6 cells were cultured in DMEM complete medium supplemented with 10% serum and 1% penicillin-dextrose antibiotics. 24-well plates were seeded the day before transfection to achieve a cell density of approximately 80%. 600 ng of pCMV-GhCas12a plasmid and 300 ng of site-targeting Gh crRNA plasmids (crRNA sequences for sites 1 to 6 are shown in SEQ ID NO: 9-14) were transfected into HEK293T cells using the crRNA plasmids from sites 1 to 3, following the instructions for LipoMax (SUDGEN) transfection reagent. Hepa1-6 cells were transfected using the crRNA plasmids from sites 4 to 6, following the instructions for Lipofectamine transfection reagent. TM Transfection was performed according to the Invitrogen 3000 instructions. After 6 hours of transfection, the medium was replaced with fresh medium, and 3 days after transfection, transfected positive cells were sorted by flow cytometry.

[0099] 4.4 GhCas12a Editing Efficiency Test

[0100] After centrifuging the collected cells to remove the supernatant, lysis buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris pH 8.0, 0.5% Nonidet P-40, 0.5% Tween 20, 100 μg / ml protease K) was added for lysis (program: 68℃, 30 min; 16℃, 5 min; 98℃, 2 min; hold at 16℃). The target sequence was then amplified using the cell lysis buffer as a template. The amplification system consisted of: 2×buffer (Vazyme: P505) 25 μL; dNTP 1 μL; Forward Primer (10 μmol / L) 1 μL; Reverse Primer (10 μmol / L) 1 μL; Cell lysis product 1 μL; DNA polymerase (Vazyme: P505) 0.5 μL; ddH2O to a final volume of 50 μL. After identification by agarose gel electrophoresis, the amplified products were sent for Sanger sequencing. The Sanger sequencing peaks were analyzed using the online software DECODR v3.0 (https: / / decodr.org / ) for indel analysis.

[0101] Relevant results are as follows Figure 9 As shown. Figure 9The results showed that GhCas12a generated Indels at sites 1 to 3 of the human 293T cell genome with efficiencies of 76.4%, 83.7%, and 21.5%, respectively; and at sites 4 to 6 of the mouse Hepa1-6 cell genome with efficiencies of 44.2%, 24.45%, and 16.5%, respectively. This indicates that the GhCas12a gene editing system can produce effective edits in mammalian cells.

[0102] Example 5

[0103] In this embodiment, the ability of GhCas12a to produce C-to-T base editing in mammalian cells after fusion with cytosine deaminase was tested.

[0104] 5.1 Plasmid Construction of GhCas12a-CBE Base Editor

[0105] Using pCMV-AncBE4max (Addgene#112094) as the base plasmid, the APOBEC deaminase in the plasmid was replaced with A3A Y130F (nucleic acid sequence shown in SEQ ID NO:15), and the Cas9 deaminase in the plasmid was replaced with dGhCas12a nuclease (nucleic acid sequence shown in SEQ ID NO:16). Primers were designed according to the instructions of ClonExpress MultiS One StepCloning Kit (Vazyme, C113-01) to construct the GhCas12a-CBE vector.

[0106] The amino acid sequence of GhCas12a-CBE is shown in SEQ ID NO:17.

[0107] The nucleic acid sequence of GhCas12a-CBE is shown in SEQ ID NO:18.

[0108] 5.2 Construction of GhCas12a-CBE site-targeting crRNA plasmid

[0109] The crRNA sequence of GhCas12a-CBE targeting the genome of 293T cells is shown in SEQ ID NO:19-22. The plasmid construction method was performed according to 4.2 (plasmid structure as shown). Figure 10 (As shown in the image above).

[0110] 5.3 Cell Culture and Transfection

[0111] Refer to the 293T cell culture and transfection method in section 4.3.

[0112] 5.4 Testing of C-to-T Editing Efficiency

[0113] Following the cell lysis and product amplification methods described in section 4.4, the amplified products were sent for Sanger sequencing after being identified as normal by agarose gel electrophoresis. The Sanger sequencing peaks were analyzed for C-to-T editing efficiency using the online software EditR 1.0.10 (https: / / moriaritylab.shinyapps.io / editr_v10 / ).

[0114] Relevant results are as follows Figure 10 As shown. Figure 10 The results showed that GhCas12a-CBE achieved the highest editing efficiency of 24% at the C1 target site, 38.6% at the C2 target site, 31.3% at the C3 target site, and 35.3% at the C4 target site. This indicates that GhCas12a-CBE can produce effective C-to-T editing in mammalian cells.

[0115] Example 6

[0116] In this embodiment, the ability of GhCas12a to produce A-to-G base editing in mammalian cells after fusion with adenine deaminase was tested.

[0117] 6.1 Plasmid Construction of GhCas12a-ABE Base Editor

[0118] Using pCMV-ABE8e (Addgene#138489) plasmid as the base plasmid, dGhCas12a nuclease (nucleic acid sequence as shown in SEQ ID NO:16) was used to replace the Cas9 deaminase in the plasmid. Primers were designed according to the instructions of ClonExpress MultiS One StepCloning Kit (Vazyme, C113-01) to construct the GhCas12a-ABE vector.

[0119] The amino acid sequence of GhCas12a-ABE is shown in SEQ ID NO:23.

[0120] The nucleic acid sequence of GhCas12a-ABE is shown in SEQ ID NO:24.

[0121] 6.2 Construction of GhCas12a-ABE site-targeting crRNA plasmid

[0122] The crRNA sequence of GhCas12a-ABE targeting the genome of 293T cells is shown in SEQ ID NO:25-28. The plasmid construction method is as described in 4.2 (plasmid structure as shown). Figure 11 (As shown in the image above).

[0123] 6.3 Cell Culture and Transfection

[0124] Refer to the 293T cell culture and transfection method in section 4.3.

[0125] 6.4 Testing A-to-G Editing Efficiency

[0126] Following the cell lysis and product amplification methods described in section 4.4, the Sanger sequencing results of the amplified products were analyzed for A-to-G editing efficiency using EditR 1.0.10 (https: / / moriaritylab.shinyapps.io / editr_v10 / ).

[0127] Relevant results are as follows Figure 11 As shown. Figure 11 The results showed that GhCas12a-ABE achieved an editing efficiency of 35% at the A1 target site, a maximum editing efficiency of 51% at the A2 target site, an editing efficiency of 30% at the A3 target site, and a maximum editing efficiency of 38.3% at the A4 target site. This indicates that GhCas12a-ABE can produce effective A-to-G editing in mammalian cells.

[0128] Example 7

[0129] The GhCas12a in this invention has a full length of 1228 amino acids, which is consistent with the amino acid sequence length of the most widely used LbCas12a. The sequence similarity between the two is 44.1%, as shown in the sequence alignment results. Figure 12 . Figure 12 A solid red box indicates that the amino acid at that position is exactly the same; a blue empty box indicates that the amino acids are similar; a black dot indicates that there is no corresponding amino acid; and black amino acid text indicates that the amino acids are completely different.

Claims

1. A Casl2a protein, characterized in that, The amino acid sequence of the Cas12a protein is shown in SEQ ID NO:

1.

2. The Cas12a protein as described in claim 1, characterized in that, The Cas12a protein is GhCas12a.

3. A fusion protein or conjugate, characterized in that, The fusion protein or conjugate comprises the Cas12 protein as described in any one of claims 1-2, which is fused to or conjugated to a protein active domain or a non-protein active domain. Optionally, the protein active functional domain is selected from peptides and protein structural domains; Optionally, the non-protein active functional domain is selected from nucleic acid molecules, small molecule cytotoxic agents, small molecule immunomodulators, and small molecule pathway regulators; Optionally, the polypeptide is selected from affinity tags, reporter tags, and fusion tags; Optionally, the protein domains are selected from cytosine deaminase domains, adenine deaminase domains, translational regulatory domains, transcriptional regulatory domains, nuclease domains, epigenetic regulatory domains, guided editing domains, recombinase domains, reverse transcriptase domains, transposase domains, and transcription factor domains. Optionally, the amino acid sequence of the fusion protein or conjugate is as shown in SEQ ID NO: 17 or 23.

4. A nucleic acid molecule, characterized in that, The nucleic acid molecule is selected from at least one of the following: 1) A nucleic acid molecule encoding the Cas12a protein as described in any one of claims 1-2; or A nucleic acid molecule complementary to the nucleic acid molecule encoding the Cas12a protein according to any one of claims 1-2; 2) Encoding the fusion protein or conjugate as described in claim 3; Optionally, the nucleic acid molecule is DNA or RNA.

5. An expression carrier, characterized in that, The expression vector includes the nucleic acid molecule as described in claim 4.

6. A recombinant cell, characterized in that, The recombinant cells comprise the nucleic acid as described in claim 4, or the expression vector as described in claim 5; Optionally, the recombinant cells are eukaryotic cells or prokaryotic cells; Optionally, the recombinant cells are plant cells, animal cells, or fungal cells; Optionally, the recombinant cells are Escherichia coli cells.

7. A CRISPER-Cas system, characterized in that, Includes the Cas12a protein as described in any one of claims 1-2; or the fusion protein or conjugate as described in claim 3; Optionally, it also includes at least one of the following: crRNA, tracrRNA, and chimeric RNA formed from crRNA and tracrRNA; Optionally, the sequence of the crRNA comprises the sequence shown in any of SEQ ID NO: 2-3.

8. A reagent kit, characterized in that, Includes the Cas12a protein as described in any one of claims 1-2, the fusion protein or conjugate as described in claim 3, the nucleic acid molecule as described in claim 4, the expression vector as described in claim 5, the recombinant cell as described in claim 6, and / or the CRISPER-Cas system as described in claim 7.

9. A pharmaceutical composition, characterized in that, Includes the Cas12a protein as described in any one of claims 1-2, the fusion protein or conjugate as described in claim 3, the nucleic acid molecule as described in claim 4, the expression vector as described in claim 5, the recombinant cell as described in claim 6, and / or the CRISPER-Cas system as described in claim 7, and Pharmaceutically acceptable carriers and / or excipients.

10. The use of the Cas12a protein of any one of claims 1-2, the fusion protein or conjugate of claim 3, the nucleic acid molecule of claim 4, the expression vector of claim 5, the recombinant cell of claim 6, the CRISPER-Cas system of claim 7, the kit of claim 8, or the pharmaceutical composition of claim 9, as of at least any one of a1-a4: a1. Gene editing for non-diagnostic and therapeutic purposes; a2. Nucleic acid testing for non-diagnostic or therapeutic purposes; a3. To prepare drugs for gene editing; a4. Prepare kits for nucleic acid detection.

Images