A tandem cbm fusion kappa-carrageenase and its application in eucheuma degradation

Abstract

The application discloses a kind of series CBM fusion κ-carrageenase κCar2 and its application in Gracilaria degradation, belong to enzyme engineering and high-value utilization technology field of seaweed biomass.The mature enzyme amino acid sequence of κCar2 is as shown in SEQ ID NO:1, and the coding nucleotide sequence is as shown in SEQ ID NO:2.κCar2 is additionally inserted linker and CBM in series on the basis of wild type OUC-CgkA-ZL4 mature enzyme, and forms the fusion enzyme of continuous double CBM arrangement.Compared with wild type, the κ-carrageenan adsorption capacity, specific activity, substrate affinity and catalytic efficiency of κCar2 are improved.κCar2 is compounded with cellulase and xylanase, and can synergistically degrade Gracilaria cell wall, release κ-carrageenan tetrasaccharide, glucose, xylose, free amino acid and mineral element, provide engineering enzyme, composite enzyme preparation and application method for high-value utilization of Gracilaria.

Description

Technical Field

[0001] This invention belongs to the technical fields of enzyme engineering and high-value utilization of seaweed biomass, specifically involving a tandem CBM fusion κ-carrageenase, a nucleic acid molecule encoding the enzyme, a recombinant expression vector, engineered bacteria, a compound enzyme preparation, and the application of the tandem CBM fusion κ-carrageenase in the degradation of Euphorbia lactea and the preparation of κ-carrageenan tetrasaccharides. Background Technology

[0002] Kirin vegetable ( Kappaphycus alvarezii *Euphorbia lactea* is an important economic red algae and a crucial raw material for the industrial production of κ-carrageenan. Besides κ-carrageenan, *Euphorbia lactea* also contains cellulose, hemicellulose, protein, free amino acids, and minerals such as sodium, potassium, magnesium, and calcium, showing potential applications in food, feed, agriculture, and the high-value utilization of seaweed biomass. However, the cell wall structure of *Euphorbia lactea* is relatively dense, with the sulfated galactomannan matrix, cellulose backbone, hemicellulose, and other polysaccharide components intertwined, making it difficult to fully release κ-carrageenan and other available components under mild conditions, thus limiting the efficient utilization of *Euphorbia lactea* resources.

[0003] Currently, the main processing methods for *Euphorbia milii* and other red algae raw materials include acid treatment, alkali treatment, heat treatment, mechanical crushing, and combinations of the above methods. While these methods can disrupt the algal tissue structure to some extent and improve the release efficiency of target components, they typically suffer from problems such as harsh reaction conditions, insufficient selectivity, high energy consumption, and heavy post-processing burdens. They may also lead to the destruction of κ-carrageenan oligosaccharide structures, complex product compositions, or reduced functional activity. In contrast, enzymatic treatment offers advantages such as mild reaction conditions, strong substrate selectivity, and better preservation of product structure. Specifically, κ-carrageenase can specifically cleave the κ-carrageenan backbone and is an important tool enzyme for preparing κ-carrageenan oligosaccharides; cellulase and xylanase can act on the cellulose and hemicellulose components in the cell wall, respectively, helping to promote the destruction of the algal cell wall structure.

[0004] However, existing κ-carrageenases are mostly studied using soluble κ-carrageenan as a substrate, and their application in the complex cell wall system of natural *Euphorbia milii* remains limited. Due to the complex structure, high viscosity, limited diffusion, and intertwined polysaccharide components of natural *Euphorbia milii* substrates, conventional κ-carrageenases often exhibit problems such as insufficient substrate localization, inadequate binding to sulfated polysaccharide matrices, limited catalytic efficiency, and poor single-enzyme degradation effects during actual algal degradation. The carbohydrate-binding domain (CBM) can participate in the recognition, binding, and localization of polysaccharide substrates. By engineering the CBM domain of κ-carrageenase and constructing a composite enzyme system with cellulase and xylanase, it is hoped that the enzyme's efficiency in reacting with natural *Euphorbia milii* substrates can be enhanced, achieving a mild and efficient release of multiple components such as κ-carrageenan oligosaccharides, monosaccharides, free amino acids, and mineral elements.

[0005] Existing technologies disclose a carbohydrate-binding domain, PpCBM, that specifically binds to κ-carrageenan, and demonstrate that the interaction of a single PpCBM with κ-carrageenase or its end fusion can improve the substrate affinity, relative catalytic efficiency, and temperature stability of κ-carrageenase (CN113265384B). However, this technology mainly involves the application of a single CBM domain and its end fusion, and does not disclose or suggest further tandem linker-CBM fragments within κ-carrageenases containing CBM to form a continuous double CBM structure. Since the number, position, and spatial arrangement of CBMs can affect enzyme folding, substrate binding, and catalytic efficiency, existing technologies that enhance enzyme performance with a single CBM do not directly demonstrate that a tandem structure within a continuous double CBM can produce further performance improvements. Therefore, it remains necessary to develop κ-carrageenan engineered enzymes with specific continuous double CBM arrangements. Summary of the Invention

[0006] To address the limitations of existing technologies in the further engineering of CBM-containing κ-carrageenases and their limited catalytic efficiency in the complex cell wall system of *Euphorbia milii*, this invention aims to provide a tandem CBM-fused κ-carrageenase, κCar2. κCar2 is formed by tandemly inserting a set of linker-CBM fragments into the original domain arrangement of the wild-type OUC-CgkA-ZL4 mature enzyme, creating a continuous double CBM structure. This enhances its adsorption capacity, apparent substrate affinity, and catalytic efficiency for κ-carrageenan and *Euphorbia milii* cell wall substrates.

[0007] Another object of the present invention is to provide a complex enzyme preparation containing the κCar2 and its application in the degradation of Euphorbia lactea, so as to achieve the synergistic release of κ-carrageenan, glucose, xylose, free amino acids and mineral elements.

[0008] To achieve the above-mentioned objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a tandem CBM fusion κ-carrageenase. The tandem CBM fusion κ-carrageenase is κCar2, the mature enzyme amino acid sequence of which is shown in SEQ ID NO:1, and the encoding nucleotide sequence is shown in SEQ ID NO:2.

[0009] The κCar2 is an engineered enzyme obtained by tandemly inserting a set of linker-CBM fragments into the C-terminus of the original CBM domain of the wild-type OUC-CgkA-ZL4 maturation enzyme; after insertion, the linker-CBM fragments form a continuous double linker-CBM arrangement in the κCar2 maturation enzyme. The amino acid sequence of the wild-type OUC-CgkA-ZL4 maturation enzyme is shown in SEQ ID NO:3, and the encoding nucleotide sequence is shown in SEQ ID NO:4; the nucleotide sequence of the linker is shown in SEQ ID NO:5, and the amino acid sequence is shown in SEQ ID NO:6; the nucleotide sequence of the CBM is shown in SEQ ID NO:7, and the amino acid sequence is shown in SEQ ID NO:8.

[0010] In a second aspect, the present invention provides a nucleic acid molecule encoding the tandem CBM fusion κ-carrageenase, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0011] Thirdly, the present invention provides a recombinant expression vector comprising the aforementioned nucleic acid molecule.

[0012] Preferably, the vector backbone of the recombinant expression vector is pET-28a(+).

[0013] Fourthly, the present invention provides an engineered bacterium containing the recombinant expression vector described above.

[0014] Preferably, the host cell of the engineered bacteria is Escherichia coli BL21(DE3).

[0015] Fifthly, the present invention provides a method for preparing the tandem CBM fusion κ-carrageenase, comprising the following steps: cloning the nucleic acid molecule into an expression vector, transforming it into a host cell, and obtaining the tandem CBM fusion κ-carrageenase after induction of expression and purification.

[0016] Preferably, the induced expression conditions include: at OD 600 When the concentration is 0.6-0.8, add IPTG to a final concentration of 0.05-0.15 mM, and induce expression at 15-25℃ for 12-24 h.

[0017] Sixthly, the present invention also provides a compound enzyme preparation for the degradation of *Euphorbia milii*, the compound enzyme preparation comprising the aforementioned tandem CBM fusion κ-carrageenase, cellulase, and xylanase. When used to treat *Euphorbia milii* raw materials, the compound enzyme preparation can synergistically disrupt the cell walls of *Euphorbia milii* and promote the release of multiple components.

[0018] Preferably, the amounts of cellulase, tandem CBM-fused κ-carrageenase, and xylanase are 60-100 U / g, 10-30 U / g, and 40-80 U / g, respectively, based on the dry weight of *Euphorbia milii*. More preferably, the amounts of the three are 80 U / g, 20 U / g, and 60 U / g, respectively.

[0019] In a seventh aspect, the present invention also provides a method for degrading Euphorbia milii, comprising treating Euphorbia milii raw materials with the aforementioned compound enzyme preparation.

[0020] Preferably, the treatment conditions include: temperature 40-50℃, pH 6.0-7.0, treatment time 9-15 h, and material-to-liquid ratio 1:20-1:60 (g:mL); more preferably, the temperature is 45℃, pH is 6.5, treatment time is 12 h, and material-to-liquid ratio is 1:40.

[0021] Preferably, the resulting enzymatic hydrolysis product contains κ-carrageenanthose, glucose, xylose, free amino acids, and mineral elements; the yield of κ-carrageenanthose is 30-40 mg / g of dried Euphorbia tirucalli.

[0022] Eighthly, the present invention also provides the use of the tandem CBM fusion κ-carrageenase, the nucleic acid molecule, the recombinant expression vector, the engineered bacteria, or the complex enzyme preparation in the preparation of *Euphorbia tirucalli* enzymatic hydrolysate, κ-carrageenan tetrasaccharide, red algae oligosaccharide products, food ingredients, feed ingredients, or agricultural compositions.

[0023] Compared with the prior art, the present invention has the following beneficial effects: Unlike existing approaches that modify single CBM domains and their ends, this invention adds a set of linker-CBM fragments in tandem to the original domain arrangement of the wild-type OUC-CgkA-ZL4 mature enzyme, forming a tandem CBM fusion κ-carrageenase κCar2 with a continuous double CBM arrangement. Experimental results show that κCar2 can achieve soluble expression and maintain κ-carrageenase activity.

[0024] Compared with wild-type OUC-CgkA-ZL4, κCar2 showed improved adsorption capacity for κ-carrageenan, indicating that the continuous double CBM arrangement is beneficial to enhancing the binding and localization between the enzyme and the κ-carrageenan substrate.

[0025] The specific activity of κCar2 is 8.9595 × 10⁻⁶.7 U / mol, compared to 6.5451 × 10⁻⁶ for wild-type OUC-CgkA-ZL4. 7 U / mol increased by 36.89%; κCar2 K m The concentration was 2.20 mg / mL, lower than the wild type's 2.45 mg / mL; κCar2 k cat / K m(app) The value was 2.94 mL / mg / s, higher than the wild type's 2.21 mL / mg / s, indicating that both the apparent substrate affinity and catalytic efficiency of κCar2 were improved.

[0026] The above results demonstrate that, based on the wild-type OUC-CgkA-ZL4 already containing a CBM domain, further linker-CBM tandem linkage is not simply adding protein fragments, but rather achieving a comprehensive improvement in substrate adsorption capacity, apparent substrate affinity, and catalytic efficiency while maintaining enzyme activity. This produces technical effects that are difficult to directly predict using existing single CBM domain and its end-fusion techniques.

[0027] A complex enzyme system composed of κCar2, cellulase, and xylanase can be used to degrade Euphorbia milii. Under optimized conditions, 33.98 mg / g of κ-carrageenan tetrasaccharide on a dry basis of Euphorbia milii was obtained, while promoting the release of glucose, xylose, free amino acids, and mineral elements. This provides engineered enzymes and complex enzyme preparations for the mild enzymatic high-value utilization of Euphorbia milii and other red algae rich in κ-carrageenan. Attached Figure Description

[0028] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0029] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0030] Figure 1 This is a schematic diagram of the construction process of the expression vector pET-28a-OUC-CgkA-ZL4-κCar2 in Example 2 of the present invention.

[0031] Figure 2 This is a plasmid map of the expression vector pET-28a-OUC-CgkA-ZL4-κCar2 in Example 2 of the present invention.

[0032] Figure 3The results of SDS-PAGE electrophoresis of wild-type OUC-CgkA-ZL4 (2: crude enzyme, 3: pure enzyme) and κCar2 (4: pure enzyme) in Example 3 of this invention are shown.

[0033] Figure 4 The results of the optimal temperature and optimal pH determination for wild-type OUC-CgkA-ZL4 and κCar2 in Example 4 of this invention are shown. Wherein, a: optimal reaction temperature of OUC-CgkA-ZL4 enzyme; b: optimal reaction pH of OUC-CgkA-ZL4 enzyme; c: optimal reaction temperature of κCar2 enzyme; d: optimal reaction pH of κCar2 enzyme.

[0034] Figure 5 SDS-PAGE electrophoresis results of OUC-CgkA-ZL4 enzyme and κCar2 enzyme bound to κ-carrageenan and their relative adsorption rates to κ-carrageenan. Where: a: electrophoresis results, lane C is the protein before binding, lane S is the supernatant after centrifugation, and lane B is the polysaccharide-protein polymerization precipitate; b: relative adsorption rate to κ-carrageenan.

[0035] Figure 6 This is a graph showing the yield of κ-carrageenan, glucose, and xylose released after treatment of Euphorbia tirucalli with the complex enzyme system in Example 7 of this invention. Detailed Implementation

[0036] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0037] Example 1: Design of tandem CBM fusion with κ-carrageenase κCar2 This embodiment uses the GH16 family κ-carrageenase OUC-CgkA-ZL4 as the starting enzyme. This enzyme is derived from marine bacterial gene resources. Sequence analysis and domain prediction show that the mature enzyme of OUC-CgkA-ZL4 contains a GH16 family catalytic domain and a carbohydrate-binding domain (CBM), belonging to a modular κ-carrageenase containing both a catalytic domain and an auxiliary binding domain. The amino acid sequence of the mature enzyme of wild-type OUC-CgkA-ZL4 is shown in SEQ ID NO:3, and the amino acid sequence of the CBM is shown in SEQ ID NO:8.

[0038] The cell wall of *Euphorbia milii* possesses a relatively dense polysaccharide network structure, with the κ-carrageenan matrix, cellulose backbone, and other polysaccharide components interwoven, distinguishing natural *Euphorbia milii* substrates from purely soluble κ-carrageenan substrates. For such complex, high-viscosity, and diffusion-restricted natural red algal substrates, the enzyme molecule's ability to recognize, adsorb, and localize the κ-carrageenan matrix affects its enrichment level on the substrate surface and subsequent catalytic efficiency. Therefore, while retaining the original catalytic and CBM domains of OUC-CgkA-ZL4, further enhancing its binding and localization capabilities for κ-carrageenan substrates is a feasible design direction to improve its efficiency in interacting with natural *Euphorbia milii* substrates.

[0039] Based on the above considerations, the inventors did not adopt a simple approach of deleting CBM or randomly fusing exogenous CBM at the end of the enzyme molecule. Instead, they inserted a set of linker-CBM fragments in series on the C-terminus of the original wild-type OUC-CgkA-ZL4 domain, creating a continuous double CBM arrangement in the enzyme molecule. This design preserves the original GH16 catalytic domain and natural CBM of the wild-type enzyme, avoiding damage to the original catalytic function and basic substrate recognition ability. On the other hand, by adding a CBM structural unit with the same sequence as the original CBM, the potential multi-site binding ability of the enzyme molecule to κ-carrageenan substrate is improved, thereby enhancing the localization and enrichment of the enzyme near the κ-carrageenan matrix.

[0040] To avoid steric hindrance or conformational interference between two adjacent CBM domains due to excessive proximity, the inventors have incorporated a linker sequence between the original CBM and the additionally inserted CBM. The nucleotide sequence encoding the linker is shown in SEQ ID NO:5, and the amino acid sequence is shown in SEQ ID NO:6; the nucleotide sequence encoding the additionally inserted CBM is shown in SEQ ID NO:7, and the amino acid sequence is shown in SEQ ID NO:8.

[0041] This yielded a tandem CBM fusion κ-carrageenase, OUC-CgkA-ZL4-κCar2, abbreviated as κCar2. The mature enzyme amino acid sequence of κCar2 is shown in SEQ ID NO:1, and the encoding nucleotide sequence is shown in SEQ ID NO:2. Compared to wild-type OUC-CgkA-ZL4, κCar2 adds a second CBM domain in tandem with a linker after the original CBM domain, forming a continuous double CBM arrangement of "GH16 catalytic domain - original CBM - linker - additional CBM". Subsequent expression, adsorption capacity, and kinetic parameters showed that this continuous double CBM design can improve the adsorption capacity, apparent substrate affinity, and catalytic efficiency of κCar2 for κ-carrageenan substrates while maintaining κ-carrageenase activity.

[0042] Example 2: Construction of expression vector pET-28a-OUC-CgkA-ZL4-κCar2 like Figure 1 As shown, this embodiment uses the expression vector pET-28a-OUC-CgkA-ZL4 (containing the wild-type κ-carrageenase gene OUC-CgkA-ZL4, obtained by cloning the wild-type gene shown in SEQ ID NO:4 into pET-28a(+) using conventional molecular cloning methods) as a basis to construct the κCar2 expression vector using the homologous recombination seamless cloning method. The nucleotide sequence of the linker is shown in SEQ ID NO:5, and the nucleotide sequence of the CBM is shown in SEQ ID NO:7. Specifically, the linker-CBM fragment is obtained by PCR amplification and ligated into OUC-CgkA-ZL4 to obtain the expression vector pET-28a-OUC-CgkA-ZL4-κCar2.

[0043] (1) Primer design and synthesis Based on the continuous double CBM structure of κCar2, three primers were designed using the expression vector pET-28a-OUC-CgkA-ZL4 as a template to amplify the linker-CBM fragment and the linearized vector fragment. Primers CL and CB-R were used to amplify the linker-CBM fragment, with their 5' ends containing sequences homologous to both ends of the linearized vector; primer BL was used to amplify the linearized vector fragment, with its 5' end containing a sequence homologous to the end of the linker-CBM fragment. Through this homologous arm design, the linker-CBM fragment and the linearized pET-28a-OUC-CgkA-ZL4 vector fragment could be directionally ligated via homologous recombination in a seamless cloning reaction to obtain the recombinant expression vector pET-28a-OUC-CgkA-ZL4-κCar2. The primer sequences used to construct κCar2 are shown in Table 1.

[0044] Table 1 Primers used for κCar2 construction CL GTGCGAGCACCAACAAACCGAACGCATCCGCGCACCCGCC (SEQ ID NO:9) Amplifying linker-CBM fragments CB-R TTATCGATCAGTTCGTTGGTGCTCGCACGGTTGAT (SEQ ID NO: 10) Amplifying linker-CBM fragments BL GAACTGATCGATAACTTCGAATTCACCCAG (SEQ ID NO:11) Amplification linearization vector

[0045] (2) Amplification of the target fragment Using pET-28a-OUC-CgkA-ZL4 plasmid as a template, PCR amplification was performed using primer pair CL / CB-R and primer BL (which works with the downstream primer of the vector). The PCR reaction system consisted of 25 μL, including 4.5 μL ddH2O, 5 μL dNTPs, 12.5 μL buffer, 1 μL upstream primer, 1 μL downstream primer, 0.5 μL template, and 0.5 μL KOD FX enzyme. The reaction program was as follows: 94 ℃ pre-denaturation for 2 min; 98 ℃ denaturation for 10 s, annealing temperature set according to primer Tm value (50–70 ℃), annealing for 30 s, extension at 68 ℃ for 30 s to 1 min / kb, for a total of 30 cycles; final extension at 68 ℃ for 7 min, and storage at 4 ℃.

[0046] After PCR, the linker-CBM fragment and the linearized vector fragment were identified by 1% agarose gel electrophoresis. The linker-CBM fragment (approximately 280 bp, containing linker and CBM sequences) and the linearized pET-28a-OUC-CgkA-ZL4 vector fragment (approximately 7000 bp) were recovered respectively.

[0047] (3) Seamless cloning connection The recovered linker-CBM fragment and the linearized vector fragment were mixed at a molar ratio of 3:1, and the ligation system was prepared according to the instructions of the C115 enzyme seamless cloning kit. The ligation was carried out at 50 °C for 15 min to obtain the recombinant expression vector pET-28a-OUC-CgkA-ZL4-κCar2.

[0048] (4) Transformation and verification of positive clones 5 μL of the ligation product was converted to E. coli BL21(DE3) competent cells were subjected to an ice bath for 30 min, followed by heat shock at 42°C for 45 s, then immediately ice bath for 2 min. After recovery in LB liquid medium for 1 h, the cells were spread onto LB plates containing 50 μg / mL kanamycin and incubated upside down at 37°C for 12-16 h.

[0049] Single colonies were selected and colony PCR was performed using universal T7 / T7ter primers for verification. The amplified band of the κCar2 positive clone was approximately 2000 bp, consistent with the expected size; sequencing confirmation showed that the sequencing results were consistent with the target sequence. The obtained expression vector was named pET-28a-OUC-CgkA-ZL4-κCar2, and its plasmid map is shown below. Figure 2 As shown, this vector can be used for subsequent recombinant protein expression.

[0050] Example 3: Expression, purification, and SDS-PAGE verification of wild-type OUC-CgkA-ZL4 and κCar2. The correctly sequenced recombinant strain was inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured overnight at 37 ℃ with shaking at 220 r / min to obtain the seed culture. The seed culture was then transferred at a 1% (v / v) inoculation rate to fresh LB liquid medium containing 50 μg / mL kanamycin and cultured at 37 ℃ with shaking at 220 r / min until OD reached. 600 The concentration was approximately 0.8, and then IPTG was added to a final concentration of 0.1 mM. The mixture was then induced and cultured at 20 °C and 220 r / min for another 20 h.

[0051] After induction, the bacterial culture was centrifuged at 7500×g, 4 ℃ for 30 min to collect the bacterial cells. The bacterial cells were resuspended in 20 mL of PBS buffer (pH 7.4) per 100 mL of fermentation broth and sonicated in an ice-water bath. The sonication conditions were: 350 W power, 3 s operation followed by a 3 s interval, for a total disruption time of 30 min, with an alarm temperature of 15 ℃. After disruption, the culture was centrifuged at 8000×g, 4 ℃ for 30 min, and the supernatant was collected to obtain the crude enzyme solution.

[0052] Because the recombinant protein carries a His tag, it was purified using Ni-NTA nickel column affinity chromatography. The eluent was sequentially eluted with PBS buffer containing 10 mM, 20 mM, 50 mM, 100 mM, and 200 mM imidazole, and the 200 mM imidazole eluent was collected. The eluent was concentrated by ultrafiltration (10 kDa molecular weight cutoff) and then analyzed by SDS-PAGE using a 12% separating gel and a 5% stacking gel. For SDS-PAGE sample preparation, 20 μL of protein sample was mixed with 5 μL of 5× protein loading buffer, incubated in a boiling water bath for 5 min, centrifuged, and 20 μL of the protein sample was loaded into each well. 10 μL of protein marker was loaded into each well, and electrophoresis was performed at 120 V for approximately 90 min.

[0053] The results are as follows Figure 3 As shown, wild-type OUC-CgkA-ZL4 exhibits a target protein band at approximately 61.9 kDa, while κCar2 shows a clear target protein band at approximately 67 kDa, which is largely consistent with the theoretical molecular weight of κCar2 (approximately 67.35 kDa). The bands of both proteins were clear after purification using a nickel column, indicating that both wild-type OUC-CgkA-ZL4 and κCar2 can be purified at approximately 61.9 kDa. E. coli Soluble expression of the recombinase protein with high purity was achieved in BL21(DE3).

[0054] Example 4 Enzyme activity assay and enzymatic property analysis The reducing sugar release was determined using the DNS method to calculate κ-carrageenase activity. A standard curve was plotted using glucose as a standard (0–1.0 μmol / mL), and the absorbance at 540 nm was converted to the reducing sugar release. The standard reaction system consisted of 200 μL, including 90 μL of 50 mM Tris-HCl buffer (pH 7.0), 100 μL of 0.5% (w / v) κ-carrageenan substrate, and 10 μL of appropriately diluted purified enzyme solution. The reaction was stopped by adding the DNS reagent after being carried out at 40 °C for 5 min, followed by boiling in a water bath for 10 min, and the absorbance was measured at 540 nm.

[0055] One enzyme activity unit (U) is defined as the amount of enzyme required to release 1 μmol of reducing sugar per minute under standard conditions.

[0056] The results are as follows Figure 4 As shown, wild-type OUC-CgkA-ZL4 maintains high relative activity in the range of 40-55℃, with an optimum temperature of approximately 50℃; κCar2 has an optimum temperature of approximately 40℃ and maintains high activity in the range of 40-50℃. The optimum pH for both enzymes is approximately 7.0.

[0057] Example 5: Kinetic parameter analysis and substrate adsorption capacity analysis κ-carrageenan was prepared into substrate solutions of 0.075%, 0.125%, 0.250%, 0.375%, and 0.500% (w / v). The initial reaction rates were determined under the optimal conditions for each enzyme (50℃ for wild-type OUC-CgkA-ZL4 and 40℃ for κCar2), and the kinetic parameters were calculated using the Lineweaver-Burk double reciprocal method. The results are shown in Table 2.

[0058] Table 2 Kinetic parameters of wild-type OUC-CgkA-ZL4 and κCar2

[0059] As shown in Table 2, the specific activity of κCar2 was 36.89% higher than that of the wild type. K m reduce, k cat / K m(app) The increase indicates that tandem CBM fusion improves the substrate affinity and catalytic efficiency of κCar2.

[0060] The purified OUC-CgkA-ZL4 enzyme and κCar2 enzyme were diluted to the same protein concentration. 1 mL of each diluted enzyme solution was taken, and 15 mg of κ-carrageenan was added to each. The solutions were incubated overnight at 4 °C in a shaker to allow binding to reach equilibrium. The supernatant was then collected by centrifugation at 13,400 ×g. The protein content of the supernatant was measured using the BCA method (using bovine serum albumin as a standard), and compared with that of OUC-CgkA-ZL4 enzyme and κCar2 enzyme with equal protein content. The original solutions, supernatant, and precipitate were analyzed by SDS-PAGE to detect the binding capacity of different structural compositions of κ-carrageenase to κ-carrageenan.

[0061] The results are as follows Figure 5 The results showed that κCar2 was most significantly enriched in the polysaccharide-protein complex precipitation. Figure 5 a) The relative adsorption rate also increased significantly ( Figure 5 (b) indicates that tandem CBM fusion enhances its adsorption capacity for κ-carrageenan substrates.

[0062] Example 6 Optimization of the degradation of Euphorbia milii by a compound enzyme system A complex enzyme system consisting of cellulase, κCar2, and xylanase was established using dried Euphorbia milii powder as a substrate. The amounts of cellulase, κCar2, and xylanase added were all based on the mass of dried Euphorbia milii.

[0063] Weigh 0.50 g of dried *Euphorbia milii* powder, add buffer solution of the corresponding pH, and mix thoroughly according to the set material-to-liquid ratio. Add cellulase, κCar2, and xylanase to the reaction system, and react with shaking at the set temperature. After the reaction is complete, centrifuge the reaction solution, collect the supernatant for subsequent product analysis, and collect the residue for morphological observation or evaluation of enzymatic hydrolysis effect. The control group is a blank control group without enzymes, i.e., under the same conditions of dried *Euphorbia milii* powder mass, buffer system, pH, material-to-liquid ratio, temperature, and reaction time, without adding cellulase, κCar2, and xylanase, and using an equal volume of buffer solution instead of enzyme solution.

[0064] 1. Single-factor experiment on the amount of compound enzyme added First, single-factor experiments were conducted to determine the appropriate addition range for each enzyme. The basic conditions for the single-factor experiments were: 0.50 g of *Euphorbia milii* powder, a material-to-liquid ratio of 1:40, pH 7.0, enzymatic hydrolysis temperature of 40 ℃, and enzymatic hydrolysis time of 5 h. Cellulase, κCar2, and xylanase were diluted to 50 U / mL, and the effect of the amount of each enzyme added on the enzymatic hydrolysis rate of *Euphorbia milii* was investigated. The addition amounts of each enzyme were set to 20, 40, 60, 80, and 100 U / g, while other reaction conditions remained consistent.

[0065] The results showed that all three enzymes could improve the hydrolysis rate of *Euphorbia milii*, but the effects of different enzyme dosages varied. A higher hydrolysis rate was observed with cellulase at 60 U / g, κCar2 at 40 U / g, and xylanase at 40 U / g. These results indicate that cellulase, κCar2, and xylanase act on different polysaccharide components in the cell wall of *Euphorbia milii*. Single-enzyme treatment can improve the hydrolysis rate, but the improvement is limited. Therefore, further optimization of the compound enzyme ratio is needed.

[0066] 2. Orthogonal experiment on the amount of compound enzyme added Based on the single-factor experiments, an L9(3³) orthogonal experiment was used to optimize the amount of compound enzyme added. Cellulase addition was designated as factor A, κCar2 addition as factor B, and xylanase addition as factor C, with the enzymatic hydrolysis rate of *Euphorbia milii* as the evaluation index. The factors and their levels are shown in the table below.

[0067] Table 3 Orthogonal Experiment for Enzyme Addition Amount

[0068] The orthogonal experimental design and results are shown in the table below.

[0069] Table 4 Orthogonal Experimental Design and Results

[0070] As shown in Table 4, the enzymatic hydrolysis rates of the nine orthogonal experiments ranged from 10.1% to 18.7%. Group 7 had the highest hydrolysis rate at 18.7%, corresponding to combination A3B1C3, which consisted of 80 U / g cellulase, 20 U / g κCar2, and 60 U / g xylanase. Range analysis revealed that the R-values ​​for factors A, B, and C were 3.467, 1.867, and 3.267, respectively, with the order of influence being A > C > B. This indicates that cellulase had the greatest impact on the hydrolysis rate of *Euphorbia milii*, followed by xylanase, while κCar2 had a relatively smaller impact. The optimal basic ratio of the compound enzyme was determined to be: 80 U / g cellulase, 20 U / g κCar2, and 60 U / g xylanase.

[0071] 3. Single-factor experiment on the process parameters of compound enzyme hydrolysis After determining the basic ratio of the compound enzyme, the effects of enzymatic hydrolysis temperature, hydrolysis time, pH, and solid-liquid ratio on the hydrolysis rate of *Kirinus koraiensis* were further investigated. The hydrolysis temperatures were set at 35, 40, 45, 50, and 55 °C; the hydrolysis times were set at 3, 6, 9, 12, and 15 h; the pH values ​​were set at 6.0, 6.5, 7.0, 7.5, and 8.0; and the solid-liquid ratios were set at 1:20, 1:40, 1:60, 1:80, and 1:100. When investigating one factor, the other factors remained consistent.

[0072] The results showed that the enzymatic hydrolysis rate gradually increased with increasing temperature from 35 ℃ to 45 ℃, reaching a relatively high level at 45 ℃; however, the hydrolysis rate decreased when the temperature continued to rise to 50 ℃ and 55 ℃. The hydrolysis rate gradually increased with increasing hydrolysis time from 3 h to 12 h, but decreased slightly after further extending to 15 h. pH also significantly affected the hydrolysis rate of the complex enzyme system, with a higher hydrolysis rate at pH 6.5. The hydrolysis rate increased with increasing material-to-liquid ratio from 1:20 to 1:40; however, the hydrolysis rate decreased when the material-to-liquid ratio continued to increase. Therefore, the optimal single-factor process parameters were determined to be: temperature 45 ℃, hydrolysis time 12 h, pH 6.5, and material-to-liquid ratio 1:40.

[0073] 4. Box-Behnken response surface optimization experiment Based on single-factor experiments of process parameters, the process conditions for enzymatic hydrolysis of *Kirinus edulis* using a combination of Box-Behnken design and response surface methodology were optimized. A four-factor, three-level response surface model was established with temperature (A), time (B), pH (C), and material-to-liquid ratio (D) as independent variables and the enzymatic hydrolysis rate (Y) of *Kirinus edulis* as the response value. The factors and levels are shown in the table below.

[0074] Table 5. Factors and levels in the response surface methodology of enzymatic hydrolysis.

[0075] The response surface methodology and results are shown in the table below.

[0076] Table 6 Response Surface Experimental Design and Results

[0077] As shown in Table 6, the enzymatic hydrolysis rate of *Gynostemma pentaphyllum* under different combinations of process parameters ranged from 35.4% to 47.1%, indicating that temperature, time, pH, and the ratio of material to liquid have a significant impact on the degradation of *Gynostemma pentaphyllum* by the composite enzyme system.

[0078] Analysis of variance was performed on the response surface model, and the results are shown in the table below.

[0079] Table 7. Variance and Results of the Regression Model

[0080] The analysis of variance results showed that the established quadratic polynomial model was highly significant, with an F-value of 10.46 (p < 0.0001); the lack-of-fit term was not significant, with an F-value of 2.00. p =0.2624>0.05, indicating that the model can describe the response relationship between temperature, time, pH, and material-to-liquid ratio and the enzymatic hydrolysis rate of *Kirinia serratifolia* well. Further analysis shows that A 2 B 2 C 2 and D 2All values ​​reached a significant or highly significant level, indicating that the influence of each factor on the enzymatic hydrolysis rate is mainly a secondary effect, meaning that each factor has an appropriate range of values.

[0081] Based on the combined results of single-factor experiments, orthogonal experiments, and response surface methodology, the optimal conditions for the degradation of *Euphorbia tirucalli* by the composite enzyme system were determined to be: 80 U / g cellulase, 20 U / g κCar2, 60 U / g xylanase, hydrolysis temperature of 45 ℃, hydrolysis time of 12 h, pH of 6.5, and a material-to-liquid ratio of 1:40.

[0082] Under the above conditions, a complex enzymatic hydrolysis of *Euphorbia milii* was performed, and the resulting hydrolysate was further used for product analysis in Example 7. The results showed that the complex enzyme system could promote the degradation of κ-carrageenan, cellulose, and xylan-like components in *Euphorbia milii*, and promote the release of κ-carrageenan tetrasaccharides, glucose, xylose, free amino acids, and mineral elements, indicating that the above complex enzyme system and process conditions can be used for the enzymatic degradation and high-value utilization of *Euphorbia milii*.

[0083] Example 7 Analysis of Enzymatic Hydrolysates of Euphorbia lactea The supernatant of the enzymatic hydrolysate obtained in Example 6 was collected, filtered through a 0.22 μm filter membrane, and analyzed for oligosaccharide and monosaccharide composition by HPLC-RID. κ-carrageenan oligosaccharides were detected using a Superdex 30 10 / 300 gel filtration column (10×300 mm), with a mobile phase of 0.2 M NH4HCO3, a flow rate of 0.4 mL / min, and a column temperature of 25 °C. Qualitative and quantitative analyses were performed using κ-carrageenan disaccharide and κ-carrageenan tetrasaccharide standards. Glucose and cellulose oligosaccharides were detected using a SUGAR KS-801 column (8.0×300 mm), with a mobile phase of ultrapure water, a flow rate of 0.8 mL / min, and a column temperature of 75 °C. Xylose and xylooligosaccharides were detected using an Asahipak NH2P-50 4E column (4.6×250 mm), with a mobile phase of 60 v / v% acetonitrile, a flow rate of 1.0 mL / min, and a column temperature of 30 °C. A series of standard solutions of different concentrations were prepared for each detected component. A standard curve was established using peak area versus mass concentration, and the content was calculated.

[0084] Free amino acids were determined using an amino acid analyzer (L-8900, Hitachi), and mineral elements were determined using ICP-MS (Agilent 7800).

[0085] The results showed that after treatment with the compound enzyme, the yields of κ-carrageenan (Nκ4), glucose, and xylose reached 33.98 mg / g, 105.60 mg / g, and 14.92 mg / g of dried *Euphorbia milii*, respectively. Figure 6 ).

[0086] The free amino acid assay showed that, compared with the control group (without enzyme), most free amino acids were significantly elevated. Among them, Phe increased from 0.04±0.009 mg / L to 10.23±0.033 mg / L, Tyr increased from 0.22±0.004 mg / L to 7.63±0.008 mg / L, His increased from 0.04±0.006 mg / L to 6.34±0.007 mg / L, Asp increased from 0.12±0.002 mg / L to 5.56±0.007 mg / L, and Glu increased from 0.89±0.002 mg / L to 4.42±0.031 mg / L.

[0087] Mineral element analysis showed a significant increase in the release of Na, K, Mg, and Ca, with Na increasing from 734.0865±0.7175 mg / L to 2073.2074±1.5270 mg / L and K increasing from 88.9295±0.5936 mg / L to 1628.4410±1.238 mg / L. These results indicate that the composite enzyme system of this invention can promote the comprehensive release of oligosaccharides, monosaccharides, amino acids, and mineral elements from *Euphorbia milii*.

[0088] Table 8. Amino acid content in enzymatic hydrolysis products Asp 0.12±0.002 5.56±0.007 Thr 0.18±0.009 0.28±0.006 Ser 0.03±0.001 0.09±0.004 Glu 0.89±0.002 4.42±0.031 Pro 0.42±0.004 0.42±0.013 Gly 0.02±0.006 1.98±0.007 Ala 0.13±0.013 2.14±0.003 Cys 0.73±0.005 1.73±0.004 Val 0.03±0.010 5.49±0.017 Met 0.14±0.009 0.26±0.009 Ile 0.24±0.007 1.81±0.004 Leu 0.01±0.005 4.14±0.002 Tyr 0.22±0.004 7.63±0.008 Phe 0.04±0.009 10.23±0.033 Lys 0.13±0.003 0.87±0.009 His 0.04±0.006 6.34±0.007 Arg 0.16±0.007 1.67±0.006 Table 9. Mineral content in enzymatic hydrolysis products Na 734.0865±0.7175 2073.2074±1.5270 Mg 4.4694±0.1687 15.8967±0.2541 Al 0.2484±0.0298 0.3623±0.0641 Ca 3.6766±0.6031 12.9011±0.7542 Cr ND (Not Detected) 0.0069±0.0007 Mn 0.0443±0.0017 0.1228±0.0096 Fe 0.0324±0.0043 0.1287±0.0113 Co 0.0072±0.0001 0.0100±0.0002 Ni 0.0254±0.0010 0.0401±0.0017 Cu 0.1038±0.0029 0.0814±0.0091 Zn 0.0123±0.0035 0.0161±0.0014 As 0.0305±0.0051 0.0837±0.0015 Se 0.0091±0.0014 0.0956±0.0068 Cd 0.0018±0.0001 0.0025±0.0003 Pb 0.0656±0.0053 0.0818±0.0089 Ag 0.0034±0.0002 0.0058±0.0009 Hg 0.0086±0.0013 0.0411±0.0067 K 88.9295±0.5936 1628.4410±1.238

[0089] The *Euphorbia lactea* enzymatic hydrolysate obtained in Examples 6 and 7 can be processed by enzyme inactivation, centrifugation, filtration, concentration, desalting, purification, or drying to prepare red algae oligosaccharide products rich in κ-carrageenan tetrasaccharide, food or feed ingredients, agricultural compositions, or other seaweed biomass raw materials or intermediate products. When used for food, feed, or agricultural purposes, further safety, heavy metal control, and purification evaluations can be conducted according to the intended use.

[0090] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A tandem CBM fusion κ-carrageenase, characterized in that, The tandem CBM fusion κ-carrageenase is κCar2, and the mature enzyme amino acid sequence of κCar2 is shown in SEQ ID NO:

1.

2. The tandem CBM fusion κ-carrageenase according to claim 1, characterized in that, The κCar2 is formed by inserting an additional set of linker-CBM fragments in tandem at the C-terminus of the original CBM domain of the wild-type OUC-CgkA-ZL4 maturation enzyme, forming a continuous double linker-CBM arrangement; the amino acid sequence of the wild-type OUC-CgkA-ZL4 maturation enzyme is shown in SEQ ID NO:

3.

3. The tandem CBM fusion κ-carrageenase according to claim 2, characterized in that, The nucleotide sequence of the linker is shown in SEQ ID NO:5, and the nucleotide sequence of the CBM is shown in SEQ ID NO:

7.

4. A nucleic acid molecule encoding the tandem CBM fusion κ-carrageenase of any one of claims 1-3, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

2.

5. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule of claim 4.

6. An engineered bacterium, characterized in that, The engineered bacteria contain the recombinant expression vector as described in claim 5.

7. A method for preparing the tandem CBM fusion κ-carrageenase according to any one of claims 1-3, characterized in that, The process includes the following steps: cloning the nucleic acid molecule described in claim 4 into an expression vector, transforming it into a host cell, and obtaining the tandem CBM fusion κ-carrageenase after induction of expression and purification.

8. A compound enzyme preparation for the degradation of Euphorbia lactea, characterized in that, The complex enzyme preparation comprises the tandem CBM fusion κ-carrageenase, cellulase and xylanase as described in any one of claims 1-3.

9. A method for degrading Euphorbia lactea, characterized in that, This includes treating Euphorbia lactea raw materials with the compound enzyme preparation described in claim 8.

10. The use of the tandem CBM fusion κ-carrageenase of any one of claims 1-3, the nucleic acid molecule of claim 4, the recombinant expression vector of claim 5, the engineered bacteria of claim 6, or the complex enzyme preparation of claim 8 in the preparation of *Euphorbia milii* hydrolysate, κ-carrageenan tetrasaccharide, red algae oligosaccharide products, food ingredients, feed ingredients, or agricultural compositions.

Images