A programmable dual-phase RNA editing system

Abstract

This invention discloses a programmable biphasic RNA editing system, belonging to the field of biotechnology. The invention claims protection for an RNA editing system comprising an RNA base editing module and a guide module for targeting and guiding it to a specific site on a target RNA; it also includes a removal module for degrading the RNA base editing module; the removal module comprises an SD40 tag attached to the RNA base editing module and a ligand PT179 specifically recognizing the SD40 tag; wherein the amino acid sequence of the SD40 tag is as shown in SEQ ID NO.3, or is an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3. This invention enables temporally controllable biphasic regulation of RNA editing activity, significantly reducing off-target effects caused by sustained expression of the editor, and can be used to prepare RNA editing drugs or RNA editing research reagents.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to gene editing tools, specifically a programmable biphasic RNA editing system. Background Technology

[0002] According to the ClinVar database, approximately 50% of known pathogenic genetic variations are caused by single nucleotide mutations. Therefore, efficient and specific repair of pathogenic point mutations is a fundamental solution for treating genetic diseases. Compared to DNA base editing, which can lead to permanent and irreversible changes to the genome, RNA base editing offers a more reversible, safer, and real-time controllable strategy. RNA base editing mainly includes A-to-I, C-to-U, and U-to-ψ types. Among them, A-to-I RNA base editing relies on ADAR (adenosine deaminase) proteins, whose natural function is to recognize double-stranded RNA structures and catalyze the deamination of adenosine (A) to generate inosine (I). Inosine (I) is then recognized by ribosomes as guanosine (G) during translation, thereby achieving functional base substitution in the RNA sequence.

[0003] To overcome the limitations of insufficient activity and strong sequence context dependence of natural ADAR, researchers developed a highly active mutant ADAR (E488Q), which significantly improved editing efficiency and expanded the range of applicable sequences. Building on this, scientists fused a λN peptide with high affinity for the BoxB hairpin structure to ADAR (E488Q) and incorporated the BoxB hairpin sequence into guide RNA (gRNA), developing the λN-BoxB-ADAR (E488Q) system. This system precisely recruits ADAR (E488Q) to target RNA sites through the specific interaction between λN and BoxB, achieving programmable and efficient A→I editing, which has been validated in various cell lines and animal models. These optimized ADAR systems have been used to correct common genetic diseases caused by G>A mutations, such as cystic fibrosis transmembrane conductance regulator (CFTR), methyl GpG-binding protein 2 (MECP2), and Duchenne muscular dystrophy (DMD).

[0004] Although 4λN-ADAR (E488Q) exhibits high RNA editing efficiency in both in vitro and in vivo experiments, sustained expression of this system in vivo can lead to cumulative off-target effects. Furthermore, as a heterologous protein, 4λN-ADAR (E488Q) may also induce adverse immune responses. Therefore, the inability to achieve flexible and efficient temporal regulation of its editing activity will significantly limit the clinical safety and application potential of this system.

[0005] In summary, there is an urgent need in this field to develop a class of RNA base editing systems with exogenously regulated activity. This system should achieve efficient and targeted editing within the therapeutic window, and should be able to rapidly and specifically inhibit activity or achieve systemic clearance upon completion of editing or when the risk of toxic side effects arises. This would balance the dual requirements of efficient editing and safe control, facilitating the clinical translation of RNA editing technology.

[0006] In view of the defects and limitations of existing technologies, this invention is proposed. Summary of the Invention

[0007] The first objective of this invention is to provide an RNA editing system, the second objective is to provide a biological material, and the third objective is to provide the application of the aforementioned RNA editing system and biological material in the preparation of RNA editing drugs or scientific research reagents.

[0008] The above-mentioned objective of this invention is achieved through the following technical solution:

[0009] This invention provides an RNA editing system, including an RNA base editing module and a guide module for targeting the RNA base editing module to a specific site on a target RNA; it also includes a clearing module for degrading the RNA base editing module;

[0010] The cleanup module includes an SD40 tag attached to the RNA base editing module and a ligand PT179 that specifically recognizes the SD40 tag; wherein:

[0011] The amino acid sequence of the SD40 tag is as shown in SEQ ID NO.3, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.3;

[0012] The chemical structural formula of the ligand PT179 is shown in formula (I):

[0013]

[0014] (I).

[0015] Preferably, the RNA base editing module includes a λN peptide, a nucleoside deaminase, and an NES signal peptide; the λN peptide is located at the amino terminus of the nucleoside deaminase, and the SD40 tag is linked to the carboxyl terminus of the nucleoside deaminase via the NES signal peptide.

[0016] More preferably, the nucleoside deaminase is RNA adenosine deaminase ADAR.

[0017] More preferably, the nucleoside deaminase is the ADAR high-activity mutant ADAR (E488Q), whose amino acid sequence is shown in SEQ ID NO.1, or is an amino acid sequence with at least 98% sequence identity with SEQ ID NO.1.

[0018] More preferably, the λN peptide comprises one or more peptide segments with the following sequence: NARTRRRERRAEKQAQWKAAN;

[0019] More preferably, the amino acid sequence of the λN peptide is as shown in SEQ ID NO.5, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.5.

[0020] More preferably, the amino acid sequence of the NES signal peptide is as shown in SEQ ID NO.7, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.7.

[0021] More preferably, the guide module includes a guide RNA; the guide RNA has a sequence complementary to a specific site of the target RNA, and its 5' or 3' end is provided with a Box element that can specifically bind to the λN peptide.

[0022] Those skilled in the art will understand that the components of the programmable biphasic RNA editing system can be linked by known short peptides (linkers), and the system can be modified in a known manner without affecting its own function.

[0023] A biological material, which is any one of the following (1) to (4):

[0024] (1) A gene encoding any of the RNA editing systems described in the previous one;

[0025] (2) An expression cassette containing the gene described in (1);

[0026] (3) A recombinant vector containing the gene described in (1) and / or the expression cassette described in (2);

[0027] (4) A recombinant cell or recombinant bacterium containing at least one of the following: the RNA editing system described in any one of the three: (1) the gene described in the three: (2) the expression cassette described in the three: (3) the recombinant vector described in the three: (4) the recombinant cell or recombinant bacterium.

[0028] The expression cassette described herein contains functional elements such as promoters and terminators. Those skilled in the art can make conventional selections based on actual circumstances, as long as the expression of the gene described in (1) can be completed. No further restrictions are placed on the structure and composition of the expression cassette here.

[0029] The vectors described herein refer to vectors capable of delivering exogenous RNA or target genes into host cells for amplification and expression. These vectors can be cloning vectors or expression vectors, and those skilled in the art can choose according to the actual situation; no excessive restrictions are imposed here.

[0030] The application of any of the described RNA editing systems or the described biological materials in the preparation of RNA editing drugs or research reagents.

[0031] Beneficial effects:

[0032] 1. Achieving time-controlled biphasic regulation of RNA editing activity

[0033] This invention integrates the SD40 tag and the small molecule ligand PT179 into the 4λN-ADAR(E488) RNA base editing system for the first time, constructing an integrated programmable biphasic RNA editing platform for editing and clearing. Without exogenous PT179, the 4λN-ADAR(E488Q) editor can be stably and efficiently expressed, achieving precise A→I base editing of target RNA, with an editing efficiency of up to 60% in various endogenous genes and reporter gene targets. With timely addition of the small molecule PT179, the editor protein fused with the SD40 tag can be rapidly induced to undergo specific degradation via the CRBN-mediated ubiquitin-proteasome pathway, achieving rapid downregulation or even complete shutdown of editing activity. This truly enables precise temporal regulation of editing on demand and timely clearing upon task completion.

[0034] 2. Significantly reduces off-target effects caused by continuous editor expression.

[0035] Existing λN-ADAR editing systems are prone to gRNA-dependent and transcriptome-independent off-target editing due to the long-term continuous expression of the editor within cells. This invention utilizes the time-dependent clearance of editor proteins by PT179, promptly shutting down editing activity after reaching the optimal efficiency window to avoid prolonged cumulative effects of the editor. Cellular experiments have demonstrated that this invention effectively suppresses the peak of off-target effects, maintaining off-target levels at a low level over a long period, significantly improving the specificity and safety of RNA editing while ensuring targeted editing efficiency. Attached Figure Description

[0036] Figure 1 This is a schematic diagram illustrating the working principle of a programmable biphasic RNA editing system.

[0037] Figure 2 A schematic diagram of the composition of 4λN-ADAR(E488Q)-SD40.

[0038] Figure 3 The efficiency of PT179 in regulating 4λN-ADAR (E488Q) SD40 at multiple HEK293T endogenous target sites is shown in the editing graph.

[0039] Figure 4 WB diagram to verify the mechanism of PT179-induced degradation of 4λN-ADAR(E488Q)SD40.

[0040] Figure 5 The effect of different concentrations of PT179 on cell viability.

[0041] Figure 6 The temporal gradient patterns of editing efficiency and off-target rate of the 4λN-ADAR(E488Q)SD40 repair mcherry-GFP(173TAG) dual-fluorescent system were investigated.

[0042] Figure 7 The temporal gradient of off-target rate of the PT179-regulated mcherry-GFP (173TAG) dual-fluorescent system was studied.

[0043] Figure 8 To investigate the regulation of the editing efficiency of HEK293T endogenous target sites by different promoters 4λN-ADAR(E488Q)SD40. Detailed Implementation

[0044] The substantive content of the present invention will be described in detail below with reference to specific embodiments. However, those skilled in the art should know that the scope of protection of the present invention should not be limited to these specific embodiments.

[0045] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional molecular biology, biochemistry, cell culture, and other techniques in this technical field.

[0046] Unless otherwise specified, all reagents or instruments used in the following embodiments that do not specify the manufacturer are commercially available products. The plasmids, PCR enzymes, plasmid extraction kits, cell transfection reagents, cell culture reagents, RNA extraction kits, and reverse transcription kits used in the following examples are commercially available products, and the specific operations were performed according to the kit instructions.

[0047] In this specification, the amino acids at the corresponding sites are represented by the recognized IUPAC single-letter abbreviations, and the amino acids and their abbreviations are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0048] Example 1: Construction and Effect Detection of a Programmable Biphasic RNA Editing System

[0049] I. Experimental Methods

[0050] 1. Plasmid design and construction

[0051] This invention introduces an SD40 tag into the 4λN-ADAR (E488Q) sequence. Without the addition of the small molecule ligand PT179 (SD40 tag), 4λN-ADAR (E488Q) maintains highly efficient base editing activity, enabling precise base editing. When editing is complete or significant adverse reactions are imminent, the small molecule ligand PT179 can be flexibly added exogenously. PT179 specifically binds to the SD40 tag, inducing rapid and concentrated degradation or clearance of 4λN-ADAR (E488Q) by the proteasome. This achieves a balance between efficient editing and controllable safety, resulting in the programmable biphasic RNA editing system of this application: 4λN-ADAR (E488Q)SD40-PT179. The working principle is as follows: Figure 1 As shown.

[0052] In this embodiment, the editor vector is based on the 4λN-ADAR(E488Q) backbone. The NES signal peptide and SD40 tag are introduced via overlap extension PCR to construct the 4λN-ADAR(E488Q)-NES-SD40 expression vector. The modules are linked by flexible linker peptides (GGGGGS) commonly used in the art to reduce steric hindrance and maintain the normal folding and function of the fusion protein. In this embodiment, the nucleic acid sequence encoding the above fusion protein is inserted into the eukaryotic expression vector and placed downstream of the CMV promoter to obtain the editor expression plasmid CMV-4λN-ADAR(E488Q)-NES-SD40. The structure of CMV-4λN-ADAR(E488Q)-NES-SD40 is shown below. Figure 2As shown in Table 1. In the system optimization experiment, the editor expression box was placed under the control of different promoters to evaluate the effect of promoter strength on editing activity and cleanup efficiency.

[0053] Table 1 Sequence

[0054]

[0055]

[0056] The guide module in this embodiment uses a guide RNA (gRNA) containing a boxB element (sequence: gaaacaccggccctgaaaaagggccggccctgaaaaagggccttttttaagctttcgaagggcgaattcgcggccgctaaattcaatcgcccctataagaaatccggtt, SEQ ID NO.15) to guide the ADAR editing module to the editing site of the target RNA, thereby promoting A-to-G conversion. The gRNA comprises two parts:

[0057] (1) A boxB structural element that can specifically bind to λN peptide;

[0058] (2) Target sequences that are complementary to specific regions of the target RNA;

[0059] To target the endogenous RNA in HEK293T cells and the reporter system, the following gRNA expression plasmids were constructed. Each gRNA was constructed in the same expression vector backbone and included the aforementioned boxB structure. The targeted editing-clearance efficiency of the programmable biphasic RNA editing system 4λN-ADAR(E488Q)SD40-PT179 was tested.

[0060] EZH2: caccgctgagcggataaagaccccaccaaa

[0061] ACTB: gcttctaggcggactatgacttagttgcgtt

[0062] METTL3: aagaattctgtgactatggaaccaaggagga

[0063] MALAT1: gaagttggttaaaaatcacatcaaaaagct

[0064] siteGFP173: gtcacgagggtgggccagggcacgggcagct

[0065] To evaluate the editing efficiency and off-target accumulation of the RNA editing system in this embodiment, an mCherry-GFP (173TAG) dual-fluorescent reporter system was constructed. In this system, a 173-site stop codon mutation was introduced into the GFP coding region; when the corresponding RNA site underwent A-to-G repair, downstream GFP signal expression was restored, thus reflecting RNA editing activity. This dual-fluorescent reporter system can be used to simultaneously observe the repair effect at the target site and the off-target accumulation at non-target sites.

[0066] To verify the PT179's clearing mechanism for the fused SD40 tag editor, an mcherry sequence was constructed after ADAR(E488Q), namely CMV-4λN-ADAR(E488Q)-mcherry-NES-SD40.

[0067] All of the above plasmids can be constructed using conventional molecular cloning methods in this field. After construction, they are transformed into competent cells, and after screening for positive clones, the plasmids are extracted and sequenced to confirm that the sequences are correct.

[0068] 2. Main reagents and instruments

[0069] The plasmid extraction kit (omega, D6950-02), high-fidelity PCR enzyme (Phanta Max Super-Fidelity DNA Polymerase, P505-d1-AA), cell transfection reagent (LipoMAX Transfection Reagent, Invitrogen), total RNA extraction kit (Cell Total RNA Isolation Kit V2, Vazyme), reverse transcription kit (HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper), Vazyme), PCR amplification reagent (EasyTaq DNA Polymerase, TRANS, AP111-01; dNTP Mix, Vazyme, P032-02), cell viability assay kit (Beyotime, C0041), Western blot (Yamei, PG212), anti-beta actin antibody (ab115777), anti-mCherry antibody (ab213511), and Goat anti-Rabbit IgG H&L used in this embodiment are as follows: All reagents related to (HRP)(ab6721) are commercially available products that can be obtained in this field, and all should be used in accordance with the product instructions.

[0070] PT179 is a small molecule ligand that specifically recognizes the SD40 tag. In the experiment, a stock solution of PT179 (psaitong, 2924858-25-1) was first prepared using DMSO (Solarbio, D8371), and then diluted to the appropriate working concentration with complete culture medium before use. The control group, which did not contain PT179, was supplemented with an equal volume of DMSO.

[0071] 3. Cell Culture

[0072] HEK293T cells were used as host cells. Cells were cultured in a 37°C, 5% CO2 incubator in DMEM complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin antibiotics. Cells were routinely passaged, and those in good growth condition and free from contamination were used for subsequent experiments.

[0073] 4. Cell transfection

[0074] When the HEK293T cells in the 10cm dish reached 70%-80% confluence, the culture medium was removed, and the cells were washed twice with PBS buffer. Then, the cells were incubated at 37°C with 1ml of 0.25% trypsin-EDTA for 120 seconds. Next, the adherent cells were gently pipetted from the bottom of the dish into a single, homogeneous cell suspension using 2ml of antibiotic-free culture medium. After cell counting, the cells were sputtered at a concentration of 1×10⁻⁶ cells / mL. 5 Cells were seeded in 24-well plates with 500 μl of antibiotic-free culture medium added to each well. After culturing for 12 hours in a humidified incubator at 37°C and 5% CO2, the cells in the 24-well plates should reach at least 80% confluence. Plasmid co-transfection was performed using liposomes. For endogenous target editing experiments, editor expression plasmid and corresponding gRNA expression plasmid were added to each well; for dual-fluorescence reporter experiments, editor expression plasmid and mCherry-GFP (173TAG) reporter plasmid were added to each well. 1.5 μg of plasmid (4λN-ADAR(E488Q)SD40: sgRNA = 3:2) was transfected into each well. LipoMAX Transfection Reagent was used for transfection.

[0075] 5. Add PT179

[0076] To investigate the clearance ability of PT179 on the editor of this embodiment and its dose dependence, different final concentrations were set, including: Figure 3 , Figure 7 In this experiment, the final concentration of PT179 was 500 μM. Figure 8 In the corresponding experiment, the final concentration of PT179 was 200 μM; Figure 4 In the corresponding mechanism verification experiment, the treatment was carried out according to a concentration gradient of 10 to 1000 μM; Figure 5In the corresponding cell viability assay, the cells were treated with a concentration gradient of 0.01–5 mM.

[0077] For editing efficiency regulation experiments, PT179 is usually added 12 hours after cell transfection, and the cells are cultured until the set time point for sampling. For time window control experiments, PT179 is added 36 hours after cell transfection when the target editing is close to the peak, in order to observe its inhibitory effect on subsequent off-target accumulation.

[0078] 6. RNA extraction and reverse transcription into cDNA

[0079] Discard the culture medium, gently wash the cells once with PBS, collect adherent cells, and extract total RNA using the Cell Total RNA Isolation Kit V2. Then, reverse transcribe the extracted RNA using cDNA synthesis reagents according to the experimental instructions. The reverse-transcribed cDNA was amplified using target-specific primers (see Table 2) and sent for Sanger sequencing. The PCR amplification program was as follows: Step 1 95°C 3 min; Step 2 95°C 30 s; Step 3 58°C 30 s; Step 4 72°C 45 s; Step 5 go to 25 cycles; Step 6 95°C 30 s; Step 7 55°C 30 s; Step 8 72°C 45 s; Step 9 go to step 625 cycles.

[0080] Table 2 Primer Sequences

[0081]

[0082] 7. Validation of the mechanism by which PT179 regulates a biphasic programmable RNA editing system

[0083] To verify the PT179 clearance mechanism of the SD40 tag editor, total cellular protein was collected after PT179 treatment and detected by Western blot.

[0084] Specifically, cells were lysed using RIPA lysis buffer, centrifuged, and the supernatant was collected. Protein concentration was determined, followed by SDS-PAGE electrophoresis and membrane transfer. Editor protein levels were detected using an antibody recognizing the mcherry tag, with β-actin as an internal control. Electrophoresis conditions: 150V, 60 min; membrane transfer conditions: 200mV, 105 min, 0.45μm PVDF; blocking with 5% skim milk powder; primary antibody blocking overnight at 4℃, secondary antibody incubation at room temperature for 1 h; TBST washing 3 × 10 min.

[0085] 8. Cell viability testing

[0086] To evaluate the cell compatibility of PT179 treatment, HEK293T cells were seeded in 96-well plates. After cell attachment, different concentrations of PT179 were added to achieve final concentrations of 0.01 mM, 0.05 mM, 0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, and 5 mM. An equal volume of DMSO was added to the control group.

[0087] After the treatment period, cell viability was detected using a cell viability assay kit, and the relative cell viability compared to the control group was calculated.

[0088] 9. Editing and off-target assessment of the mCherry-GFP(173TAG) dual-fluorescent reporter system

[0089] The editing efficiency and off-target effects of the system were further analyzed over time using the mCherry-GFP (173TAG) reporter system. HEK293T cells were co-transfected with the editor expression plasmid and the mCherry-GFP (173TAG) reporter plasmid, and samples were collected at different time points.

[0090] The efficiency of editing at the target site is used to assess the repair capability of the reporter system; simultaneously, the A-to-G changes at several non-target sites in the reporter system transcripts are detected to evaluate the off-target accumulation trend. In this embodiment, sites such as Y77C, K97R, and Q114R are selected as representative off-target monitoring sites.

[0091] Without PT179, the editing changes of target and off-target sites were detected at different time points after transfection. In the time window control experiment, PT179 was added 36 hours after transfection, and samples were taken at subsequent time points to compare the dynamic changes of target editing and off-target editing before and after drug addition.

[0092] 10. Data Analysis

[0093] The editing efficiency of target A > G was analyzed and statistically analyzed using BEAR-BaseEdit Analyzer (V1.3.2) software, and the obtained data were summarized and plotted using Graphpad 9.5. Each experiment had at least three independent biological replicates, and the results are expressed as mean ± standard deviation.

[0094] II. Test Results

[0095] Without the addition of the small molecule ligand PT179, the SD40-tagged editor 4λN-ADAR(E488Q)-NES-SD40 exhibited approximately 60% A>G high-efficiency editing at the endogenous targets EZH2, ACTB, and MALAT1 in HEK293T cells. Figure 3This indicates that even after introducing the SD40 tag into the ADAR editor, the editor still retains a strong ability to target RNA base editing.

[0096] After transfection, the addition of PT179 significantly reduced the editing efficiency of 4λN-ADAR(E488Q)-NES-SD40 on multiple HEK293T endogenous target sites. Under the conditions used in this embodiment, PT179 can reduce the editing efficiency of endogenous target sites by about 50%, indicating that PT179 can effectively regulate the editing system of this invention.

[0097] Further Western blot results showed that PT179 treatment significantly reduced the level of editor protein fused with the SD40 tag, and this reduction became more pronounced with increasing treatment concentration. Figure 4 This indicates that PT179 can achieve rapid clearance of editor proteins by recognizing the SD40 tag and mediating related degradation pathways.

[0098] To further clarify the safety of PT179 application, the results of detecting the viability of HEK293T cells at different concentrations of PT179 showed that the survival rate of HEK293T cells was higher than 70% when the PT179 concentration was not higher than 1 mM, indicating that PT179 has good cell compatibility within the effective control concentration range required by this invention. Figure 5 ).

[0099] Using the mcherry-GFP (173TAG) dual-fluorescence reporter system, it was found that without the addition of PT179, the repair of target sites by 4λN-ADAR(E488Q)-NES-SD40 reached a high level approximately 36 hours post-transfection. However, with continued expression of the editor, the off-target editing rate of several non-target sites (Y77C, K97R, Q114R) also gradually accumulated over time, reaching a peak at approximately 48 hours post-transfection, and remained at a high level without exogenous intervention. Figure 6 ).

[0100] Based on the above results, exogenous PT179 was added to clear the off-target mechanism 36 hours post-transfection, within the time window when the target site repair was close to its peak but the off-target effect had not yet reached its peak. The results showed that after adding PT179 at this time point, the off-target rates at sites Y77C, K97R, and Q114R decreased rapidly, significantly blocking the occurrence of the off-target peak compared to the control group without PT179, and maintaining a low level within the subsequent long-term observation window. Figure 7 ).

[0101] The above results demonstrate that the system of the present invention can achieve biphasic regulation of RNA editing activity: maintaining high editing activity in the early stage to complete the repair of target RNA; and after editing reaches the ideal window, rapidly clearing the editor by adding PT179, thereby reducing off-target accumulation caused by continuous expression.

[0102] Although 1 mM PT179 has a good regulatory effect, the drug concentration is relatively high. In this embodiment, by replacing the system promoter with Ubc, the expression intensity and degradation sensitivity of the editor can be further adjusted while maintaining a high basic editing activity. Only 200 μM PT179 is needed to significantly regulate the editing efficiency. Figure 8 The results indicate that the system of the present invention can not only achieve time-sequential clearance through PT179, but also further optimize the pharmacodynamic window by adjusting the system expression intensity, thereby reducing the required small molecule concentration and improving the system's safety and applicability.

[0103] Example 2: RNA editing drugs

[0104] The programmable biphasic RNA editing system of the present invention can be prepared into RNA editing therapeutic drugs for hereditary single-point mutation diseases. The drugs are formulated into clinically applicable formulations using the RNA editing system of the present invention as the active ingredient, supplemented with pharmaceutically acceptable carriers, excipients or delivery systems.

[0105] The RNA editing drug comprises:

[0106] 1) An expression vector encoding the 4λN-ADAR(E488Q)-SD40 fusion protein;

[0107] 2) Targeted gRNA expression vectors containing BoxB elements;

[0108] 3) The small molecule ligand PT179 is used as a time-regulating agent.

[0109] The drug can be delivered via in vivo methods such as lipid nanoparticles (LNP) and adeno-associated virus (AAV) to deliver the editing system to diseased target cells / tissues. After entering the cells, 4λN-ADAR(E488Q)-SD40 is stably expressed and, guided by gRNA, targets the pathogenic G>A or A>G point mutation sites to achieve efficient A-to-I RNA base correction, repair abnormal transcripts, restore the normal function of target proteins, and achieve the therapeutic effect.

[0110] When the editing efficiency reaches the treatment threshold, or when there are off-target risks and potential side effects, a safe concentration of PT179 can be administered exogenously. Utilizing the CRBN ubiquitin-proteasome pathway mediated by SD40-PT179, the 4λN-ADAR(E488Q)-SD40 editor protein is specifically induced to rapidly degrade, promptly shutting down editing activity and avoiding transcriptome off-target accumulation and the risk of exogenous protein immunogenicity caused by continuous editor expression.

[0111] This system is expected to achieve efficient clearance via PT179 after target editing, thereby significantly reducing off-target risks and immunogenicity, and providing a highly efficient and safe solution for RNA precision therapy of genetic diseases (such as cystic fibrosis, Duchenne muscular dystrophy, etc.).

[0112] Example 3: RNA Editing Research Reagents

[0113] The programmable biphasic RNA editing system described in this invention can be developed into a research reagent for RNA base editing, and can be used in basic biological research scenarios such as gene function research, transcriptome regulation, target verification, and gene point mutation model construction.

[0114] The research reagents include:

[0115] 1) A plasmid vector encoding the 4λN-ADAR(E488Q)-SD40 fusion protein;

[0116] 2) gRNA backbone vectors containing BoxB elements and customizable targeting sequences;

[0117] 3) Small molecule regulatory reagent PT179;

[0118] 4) Accompanying transfection reagents, sequencing verification primers, and experimental instructions and kit components.

[0119] Usage: Co-transfecting cells with the 4λN-ADAR(E488Q)-SD40 expression plasmid and customized gRNA can achieve efficient A-to-I single-base editing of the target RNA site. During the experiment, the expression level of the editor protein can be time-controlled by adding different concentrations and durations of PT179, and RNA editing activity can be precisely turned off or down-regulated to achieve a controllable and terminateable scientific research experimental mode.

[0120] This research reagent can be used to conduct experiments such as gene loss / gain studies, RNA alternative splicing regulation studies, endogenous gene point mutation simulation, off-target editing mechanism analysis, and investigation of editing time-dose relationship. It can also be adapted to different cell lines and experimental systems by changing different promoters, making it highly versatile and easy to operate.

[0121] Compared to traditional ADAR editing reagents with constant expression, the biggest advantage of this reagent is that it can switch editing activity on and off at specific times, which can avoid off-target accumulation caused by continuous expression of the editor and can truly reflect gene function changes at specific time windows. In addition, PT179 has a mild concentration, low cytotoxicity, does not interfere with the normal physiological state of cells, and has a clean experimental background and high reliability of results.

[0122] This set of programmable biphasic RNA editing research reagents can be used as a general-purpose RNA editing tool, widely applied in basic research in fields such as molecular biology, genetics, and transcriptomics. It can also serve as a standardized research platform for new drug target screening and gene editing tool evaluation.

[0123] The purpose of the above embodiments is to specifically illustrate the substantive content of the present invention, but those skilled in the art should know that the scope of protection of the present invention should not be limited to the specific embodiments.

Claims

1. An RNA editing system, comprising an RNA base editing module and a guide module for targeting and guiding the RNA base editing module to a specific site on a target RNA; characterized in that, It also includes a cleaning module for degrading the RNA base editing module; The cleanup module includes an SD40 tag attached to the RNA base editing module and a ligand PT179 that specifically recognizes the SD40 tag; wherein: The amino acid sequence of the SD40 tag is as shown in SEQ ID NO.3, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.3; The chemical structural formula of the ligand PT179 is shown in formula (I): (I).

2. The RNA editing system according to claim 1, characterized in that, The RNA base editing module includes a λN peptide, a nucleoside deaminase, and an NES signal peptide; the λN peptide is located at the amino terminus of the nucleoside deaminase, and the SD40 tag is linked to the carboxyl terminus of the nucleoside deaminase via the NES signal peptide.

3. The RNA editing system according to claim 2, characterized in that, The nucleoside deaminase is RNA adenosine deaminase ADAR.

4. The RNA editing system according to claim 2, characterized in that, The nucleoside deaminase is the ADAR high-activity mutant ADAR (E488Q), whose amino acid sequence is shown in SEQ ID NO.1, or is an amino acid sequence with at least 98% sequence identity with SEQ ID NO.

1.

5. The RNA editing system according to claim 2, characterized in that, The λN peptide comprises one or more peptide segments with the following sequence: NARTRRRERRAEKQAQWKAAN.

6. The RNA editing system according to claim 5, characterized in that, The amino acid sequence of the λN peptide is as shown in SEQ ID NO. 5, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.

5.

7. The RNA editing system according to claim 2, characterized in that, The amino acid sequence of the NES signal peptide is as shown in SEQ ID NO.7, or is an amino acid sequence that has at least 98% sequence identity with SEQ ID NO.

7.

8. The RNA editing system according to claim 2, characterized in that, The guide module includes a guide RNA; the guide RNA has a sequence complementary to a specific site of the target RNA, and its 5' or 3' end is provided with a Box element that can specifically bind to the λN peptide.

9. A biomaterial, characterized in that, It is any one of the following (1) to (4): (1) A gene encoding the RNA editing system according to any one of claims 1 to 8; (2) An expression cassette containing the gene described in (1); (3) A recombinant vector containing the gene described in (1) and / or the expression cassette described in (2); (4) A recombinant cell or recombinant bacterium containing at least one of the RNA editing system of any one of claims 1 to 8, (1) the gene, (2) the expression cassette, and (3) the recombinant vector.

10. The use of the RNA editing system according to any one of claims 1 to 8 or the biomaterial according to claim 9 in the preparation of RNA editing drugs or research reagents.

Images