A miRNA and application thereof in improving yield of rape, promoting early flowering of rape and / or shortening growth period of rape

Abstract

The application discloses a miRNA and application thereof in improving rape yield, promoting rape early flowering and / or shortening rape growth period, and belongs to the field of plant genetic engineering. Bna- miRNA397a , and it is verified through experiments that Bna-miRNA397a can regulate the growth period and yield of plants, overexpression of Bna-miRNA397a can enhance rape yield, promote rape early flowering and shorten the growth period, and inhibition of the expression of Bna-miRNA397a can reduce rape yield and prolong the growth period. Bna-miRNA397a Bna-miRNA397a Therefore, the miRNA can be applied to plant breeding, and the application provides a new direction for the plant breeding road.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to a miRNA and its application in increasing rapeseed yield, promoting early flowering and / or shortening the rapeseed growth period. Background Technology

[0002] Rapeseed (Brassica napus) is my country's largest domestic oilseed crop, with an annual planting area of ​​110 million mu (approximately 73 million hectares), 80% of which is distributed in the Yangtze River Basin. Approximately 64 million mu (approximately 4.67 million hectares) of fallow land in the Yangtze River Basin can be used for rapeseed cultivation after rice harvesting. Utilizing these fallow lands for multi-cropping (rice-rapeseed) rapeseed production has become an important way to stabilize grain production and expand oilseed production. Currently, rapeseed production under the three-crop system (such as the "rice-rice-rapeseed" model) faces a core bottleneck of crop rotation shortage. Due to the restriction of the late rice harvest, rapeseed sowing is often forced to be delayed until late October to early November, requiring harvesting in mid-to-late April of the following year, resulting in a sharp reduction of more than 50% in effective accumulated temperature throughout the entire growth period. Late sowing significantly shortens the pre-winter growth period for rapeseed, leading to insufficient biomass accumulation before winter, which seriously affects the plant's overwintering safety and later yield formation. Therefore, to ensure stable and high yields of rapeseed under the three-crop system, it is urgent to breed rapeseed varieties with short growth periods that are tolerant of late sowing. However, current progress in genetic improvement of rapeseed for early flowering is slow. To promote the breeding of high-yield rapeseed varieties with short growth periods, it is urgent to explore superior germplasm and key gene resources that flower and mature early, and to reveal the genetic and molecular mechanisms of the synergy between early flowering and high yield. This will accelerate the breeding of new rapeseed varieties that are tolerant to late sowing, flower and mature early, and have high yields, so as to overcome the technical constraints of three-crop rapeseed production. Summary of the Invention

[0003] The purpose of this invention is to provide a miRNA and its application in increasing rapeseed yield, promoting early flowering, and / or shortening the rapeseed growth period, thereby solving the problems existing in the prior art and overexpressing miRNA. Bna-miRNA397a It can promote early flowering of rapeseed, increase rapeseed yield, and shorten the rapeseed growth period, which is of great significance for improving the rapeseed's short growth period and increasing yield.

[0004] To achieve the above objectives, the present invention provides the following solution: This invention provides a miRNA, the miRNA being named Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.2.

[0005] The present invention also provides the aforementioned Bna-miRNA397a The precursor sequence, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides the aforementioned Bna-miRNA397a Or the use of the precursor sequence in any of the following: (1) Increase rapeseed yield, promote early flowering and / or shorten rapeseed growth period; (2) To prepare products that increase rapeseed yield, promote early flowering and / or shorten the rapeseed growth period; (3) Cultivate rapeseed varieties that flower early, yield high, and / or have a short growing season; (4) Rapeseed germplasm breeding with early flowering, high yield and / or short growth period.

[0007] Optionally, by overexpressing rapeseed... Bna-miRNA397a Or precursor sequences, to achieve the effects of increasing rapeseed yield, promoting early flowering of rapeseed and shortening the growth period of rapeseed.

[0008] The present invention also provides the overexpression described above. Bna-miRNA397a Or the use of biomaterials containing the precursor sequence described herein in any of the following: (1) Increase rapeseed yield, promote early flowering and / or shorten rapeseed growth period; (2) To prepare products that increase rapeseed yield, promote early flowering and / or shorten the rapeseed growth period; (3) Cultivate rapeseed varieties that flower early, yield high, and / or have a short growing season; (4) Rapeseed germplasm breeding with early flowering, high yield and / or short growth period.

[0009] Optionally, the biological material includes recombinant plasmids or recombinant bacteria.

[0010] This invention also provides a method for cultivating early-flowering, high-yielding, and / or short-growing rapeseed, comprising overexpressing in rapeseed... Bna-miRNA397a Steps; The Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.2.

[0011] This invention also provides inhibition Bna-miRNA397a The application of the expressed formulation in prolonging the growth period of rapeseed, the Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.2.

[0012] The present invention also provides a method for prolonging the growth period of rapeseed, including inhibiting the growth of rapeseed. Bna-miRNA397a The steps of expression; The Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.2.

[0013] The present invention discloses the following technical effects: This invention discovered a miRNA associated with short growth period and increased yield in rapeseed. Bna-miRNA397a Experiments have verified that Bna-miRNA397a It can regulate the plant's growth period and yield, and overexpression Bna-miRNA397a It can increase rapeseed yield, promote early flowering, and shorten the growth period; it can inhibit...Bna-miRNA397a The expression of this will reduce rapeseed yield and prolong its growing period. Therefore, it is evident that... Bna-miRNA397a This invention can be applied to plant breeding, and it provides a new direction for plant breeding. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1 These are the electrophoresis results; the first lane is for markers, and the second lane is for constructing the overexpression vector. Bna-miRNA397A The precursor sequence; Figure 2 for Bna-miRNA397a Expression analysis diagrams in wild-type rapeseed plants, overexpressing transgenic rapeseed, and repressed transgenic rapeseed; among them, Zhongshuang 6 is a low-temperature sensitive material. Bna-miRNA397a- OE1, Bna- miRNA397a- OE2 and Bna-miRNA397a- OE3 consists of three independent overexpression transgenic families, and Westar is the Brassica napus variety "Westar". Bna- STTM 397a -1、 Bna- STTM 397a -2 and Bna- STTM 397a -3 represents three independent families with suppressed transgenic expression; Figure 3 for Bna-miRNA397a Phenotypic characteristics of overexpressing transgenic plants and wild-type plants during flowering period, as well as statistical graphs of flowering days and total growth period days; Figure 4 for Bna-miRNA397a Phenotypic characteristics of suppressed transgenic plants and wild-type plants during flowering, as well as statistics on the number of days in the entire growth period and the number of days in flowering; Figure 5 for Bna-miRNA397a Statistical graphs of thousand-seed weight, number of siliques, number of branches, and yield per plant in overexpressing transgenic plants and wild-type plants; Figure 6 for Bna-miRNA397a Statistical graphs of silique number, thousand-seed weight, and yield per plant in transgenic plants with suppressed expression and wild-type plants. Detailed Implementation

[0016] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0017] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0018] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0019] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0020] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0021] Example 1: miRNAs associated with early maturity and increased yield in rapeseed ( Bna-miRNA397a The discovery of 1. Small RNA sequencing analysis was performed on seedlings of the low-temperature resistant material C18 (published in the literature "Identification and Screening of Rapeseed Varieties Tolerant to Late Sowing and Short Growth Period, provided by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences") and the low-temperature sensitive material Shuang 6 (ZS6, published in the literature "Establishment of Identification Method for Cold Resistance of Brassica napus and Screening of Germplasm Resources, provided by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences) before low-temperature stress and at 1d, 7d, 14d, and 21d after low-temperature (4℃ dark for 8h / 8℃ day for 16h) treatment. The relevant data were submitted to the NCBI database (PRJNA596550), and a microRNA member was found: Bna-miRNA397a,Specifically, it exhibits a sustained induction increase under low-temperature stress in the low-temperature resistant material C18, with an induction fold more than three times that of the cultivar 6. Its precursor sequence is shown in SEQ ID NO.1, specifically: 5'-GAACATCATTGAGTGCAGCGTTGATGTGATTTACTTCTCTTTTTCATTGTTGAATGGATTAAAGCAATTTACATCAACGTTGGCTCAATTATGTTT-3', and its mature sequence is shown in SEQ ID NO.2, specifically: TCATTGAGTGCAGCGTTGATGT. These sequences show no base differences between C18 and the cultivar 6.

[0022] 2. Select rapeseed seedlings of the Zhongshuang 6 variety that are about 3 weeks old, extract total DNA, and use this DNA as a template to design amplification... Bna-miRNA397a Primers for the precursor sequence, for... Bna-miRNA397a Amplification of the precursor sequence.

[0023] The PCR reaction volume is 20 μL, specifically: I-5 TM 2×High-Fidelity Master Mix 10μL, upstream primer Bna-miRNA397a -F(5'-CGGAATTCCTACATGTAGTTCCATGGTGATT-3', SEQ ID NO.3) 10 μM 0.5 μL, downstream primer Bna-miRNA397a -R (5'-GGGGTACCTGGAGTTGGAATGACATCAATG-3', SEQ ID NO.4) 10μM 0.5μL, DNA 1μL and ddH2O 8μL.

[0024] The PCR reaction program was as follows: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 20 s, 72℃ for 1 min, for a total of 32 cycles; extension at 72℃ for 5 min.

[0025] Then, 2 μL of the PCR product was taken and detected by 1% agarose gel electrophoresis. The electrophoresis results are shown in the figure. Figure 1 .Depend on Figure 1It can be seen that the amplification in this embodiment yielded a 228bp sequence containing the precursor sequence (SEQ ID NO.5: 5'-CTACATGTAGTTCCATGGTGATTAAACATAGCAAGAAAGGGTTTTTTTCCTGGATTTGTACGAACATCATTGAGTGCAGCGTTGATGTGATTTACTTCTCTTTTTTCATTGTTGAATGGATTAAAGCAATTTACATCAACGTTGGCTCAATTATGTTTTTCTGATTTTCAGGATCATAGAGAAAAAACATTCACAAACAAATTTTATCATTGATGTCATTCCAACTCCA-3').

[0026] Example 2 Overexpression Bna-miRNA397a Construction of genetically modified rapeseed 1. The PCR amplification product obtained in Example 1 was digested with restriction endonucleases EcoRI and KpnI, and the digested product was recovered. Digestion system (50 μL): EcoRI 1.5 μL, KpnI 1.5 μL, 10×buffer 5 μL, PCR amplification product 12 μL, and ddH2O 30 μL; Digestion conditions: 37℃ for 1.5 h.

[0027] 2. The vector pCambia1302 (Wuhan Transduction Biology Laboratory Co., Ltd.) was double-digested with restriction endonucleases EcoRI and KpnI to obtain the vector backbone. The digestion system (50 μL) consisted of: EcoRI 1.5 μL, KpnI 1.5 μL, 10× buffer 5 μL, plasmid DNA 12 μL, and ddH2O 30 μL; digestion conditions: 37℃ for 1.5 h.

[0028] 3. Ligate the digestion product from step 1 and the vector backbone from step 2 using T4 ligase to obtain the recombinant plasmid. The ligation system (5 μL) consisted of: 0.5 μL vector backbone, 3.5 μL digestion product, 0.5 μL T4 ligase, and 0.5 μL T4 buffer; ligation conditions: room temperature for 0.5 h. Then, the ligated recombinant plasmid pCambia1302- miRNA397a Transformed Escherichia coli DH5α competent cells, plated on solid LB agar plates containing kanamycin, incubated overnight, and then selected colonies for sequencing.

[0029] 4. Based on the sequencing results, it is confirmed that the inserted sequence contains... Bna-miRNA397a A sequence of the precursor nucleotide sequence (SEQ ID NO.5). Then, Bna-miRNA397aIt is inserted between the pCambia1302 promoter CaMV35S and the terminator nos, with restriction sites at the 5' end EcoRI and the 3' end KpnI.

[0030] 5. The recombinant plasmid pCambia1302- miRNA397a Recombinant Agrobacterium was obtained by introducing competent Agrobacterium GV3101 (TRANSGEN).

[0031] 6. Transform the recombinant Agrobacterium obtained in step 5 into the hypocotyl of Brassica napus ZS6. The specific steps are as follows: 6.1 Sowing Soak rapeseed seeds in an appropriate amount of 75% (volume percentage) alcohol for 1 minute, discard the alcohol, rinse once with sterile water, discard the water, and then sterilize with 50% (volume percentage) 84 disinfectant (sterile water and commercial 84 disinfectant mixed at a 1:1 volume ratio) for 10 minutes. After sterilization, pour the disinfectant solution into a waste container. For heavily contaminated seeds, the sterilization time can be extended to 20 minutes. Then wash the seeds 5 times with an appropriate amount of sterile water. Use sterile tweezers to sow 25 seeds onto sowing medium M0 per dish, and then place the dishes in a sterile culture box and incubate at 24°C in the dark for 6 days.

[0032] 6.2 Activation and preparation of Agrobacterium (1) One day before inoculation, add antibiotics to 100 mL of sterilized liquid LB medium, inoculate with Agrobacterium, and culture overnight in a shaker at 28°C and 200 rpm. Measure the OD value of the bacteria (an OD value of around 0.8 in LB medium is preferred, and 16 hours is generally sufficient).

[0033] (2) Divide the cultured bacterial solution into two 50mL sterile centrifuge tubes, centrifuge at 3000rpm for 20min, remove the supernatant from the tubes and gently wash the cells with 1mL of DM bacterial activation medium (with added AS (acetylsyleugenol)), then remove the supernatant. Add 1mL of DM bacterial activation medium and mix well. After the bacterial solution is prepared, place it on ice for activation.

[0034] (3) At the same time, use sterile forceps and a scalpel to vertically cut the hypocotyl of the above-mentioned seedlings under dark culture, cut it in the bacterial activation medium DM, the optimal length of the explant is 0.8-1.0cm, put the cut explant into a dish containing the target bacterial solution of the prepared concentration and soak for 15min, the number of explants in each dish should be about 150, and shake it 5 times at intervals.

[0035] (4) After immersion, use sterile forceps to gently remove the explants, place them on sterile filter paper to remove excess bacterial solution from the surface, and then use sterile forceps to place the explants on co-culture medium M1 and co-culture at 24°C for 48 hours in the dark.

[0036] 6.3 Selection of Culture After co-culture, the explants were transferred to selective medium M2 for selective culture for 18 days under the following conditions: 24°C light culture, 16 hours during the day and 8 hours at night.

[0037] 6.4 Differentiation Culture After selection and culture, the explants were transferred to differentiation medium M3 for differentiation culture, and subcultured approximately every 20 days until budding occurred. The culture conditions were 24℃ light culture, with 16 hours of daylight and 8 hours of nightlight.

[0038] 6.5 Rooting Culture and Transplanting Once the shoots have differentiated and the growth point is clearly visible, the shoots are carefully cut from the callus tissue using sterile forceps and a scalpel, avoiding the inclusion of excess callus tissue and preventing damage to the growth point. They are then transferred to M4 rooting medium for rooting. The vitrified shoots require a period of culture to transform into normal shoots, which then root to obtain transformed seedlings, i.e., T0 generation transgenic rapeseed plants.

[0039] The preparation method of the culture medium used for the above transformation is as follows: (1) Sowing medium M0: 1L of medium contains 2.22g MS and 8g agar, and the pH is adjusted to 5.8-5.9; (2) Activation medium DM: 1L of medium contains 4.43g MS and 30g sucrose. The pH is adjusted to 5.8-5.9. After sterilization, add 1mL AS (100mmol / mL), 2mL 2,4-D (0.5mg / mL) and 1.5mL KT (0.2mg / mL). (3) Co-culture medium M1: 1L of medium contains 4.43 g MS, 30 g sucrose, 18 g mannitol, 2 mL 2,4-D (0.5 mg / mL) and 1.5 mL KT (0.2 mg / mL). The pH is adjusted to 5.8-5.9. After sterilization, add 1 mL AS. (4) Selective medium M2: 1L of medium contains 4.43g MS, 30g sucrose, 18g mannitol, 2mL 2,4-D (0.5mg / mL) and 1.5mL KT (0.2mg / mL). The pH is adjusted to 5.8-5.9. After sterilization, add 213µL AgNO3 (20mM / L), 1mL Timentin (300mg / mL) and 500µL hygromycin (50mg / mL). (5) Differentiation medium M3: 1L of medium contains 4.43g MS, 10g glucose, 0.25g xylose and 0.6g MES. The pH is adjusted to 5.8-5.9. After sterilization, add 4mL ZT (0.5mg / mL), 200µL IAA (0.5mg / mL), 1mL Timentin (300mg / mL) and 500µL hygromycin (50mg / mL). (6) Rooting medium M4: 1L of medium contains 2.22g MS, 10g sucrose, 5mL IBA (0.1mg / mL) and 8g agar. After sterilization, add 500µL Timentin (300mg / mL). (7) Liquid LB medium: 1L of medium contains 10g sodium chloride, 10g peptone and 5g yeast; (8) Solid LB medium: 1L of medium contains 10g sodium chloride, 10g peptone, 5g yeast and 8g agar.

[0040] 6.6 Testing Bna-miRNA397a Expression level For T0 generation transgenic rapeseed plants ( Bna-miRNA397a- OE1, Bna-miRNA397a- OE2 and Bna- miRNA397a- RNA was extracted from OE3 (denoted as OE1, OE2, and OE3), and cDNA was obtained by reverse transcription using a TransGen Biotech reverse transcription kit. The reverse transcription system was as follows: 3 μg of RNA was added to ddH2O to adjust the volume to 6 μL, 1 μL of gRNA Removal, 1 μL of cDNA Synthesis Super Mix, 10 μL of 2×buffer, 1 μL of 397 stem-loop primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCA, SEQ ID NO.6), and 1 μL of U6 reverse transcription primer (TTGGACCATTTCTCGATTTGTG, SEQ ID NO.7). The mixture was incubated at 42℃ for 15 min and the reaction was terminated at 85℃ for 15 s.

[0041] The product was diluted 10-fold before qRT-PCR analysis. A 96-well qRT-PCR plate and Vazyme's ChamQ Universal SYBR qPCR Master Mix were used to prepare the reaction system for qRT-PCR. U6 was used as an internal control. The primers were F: TTGGAACGATACAGAGAAGATTAGCA, SEQ ID NO.8; R: GTGCAGGGTCCGAGGTATTC, SEQ ID NO.9.Bna-miRNA397a The amplification primers were F: AGCAGCATCATTGAGTGCAGCG, SEQ ID NO.10; R: GTGCAGGGTCCGAGGTATTC, SEQ ID NO.9. The program was 95℃ pre-denaturation for 30 s, followed by 95℃ for 15 s, 60℃ for 30 s, for 40 cycles. Expression data were organized using Excel, following a 2... -ΔΔCt The method calculates the relative expression level of each individual plant.

[0042] Bna-miRNA397a Expression analysis in wild-type rapeseed plants and overexpressing transgenic rapeseed is shown in [see...]. Figure 2 The results showed Bna-miRNA397a The expression level in the overexpressing transgenic plants was significantly higher than that in the wild-type plant ZS6.

[0043] Example 3 Bna-miRNA397a Construction of rapeseed inhibitory materials Using short tandem target mimic (STTM) technology, the activity of endogenous miRNAs in rapeseed was effectively inhibited, and in vitro synthesis of miRNAs containing... Bna-miRNA397a The partially reverse complementary sequence of the mature sequence (GGTACCACATCAACGCTCTAGCACTCAATGAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATACATCAACGCTCTAGCACTCAATGAGGATCC, SEQ ID NO.11), where the bolded portion represents the restriction endonuclease site, is as follows: 1. The target sequence synthesized in vitro was digested with restriction endonucleases Kpn I and BamHI, and the digestion products were recovered. The digestion system (50 μL) consisted of 1.5 μL Kpn I, 1.5 μL BamHI, 5 μL 10× buffer, 12 μL PCR amplification product, and 30 μL ddH2O; the digestion conditions were 37℃ for 1.5 h.

[0044] 2. The vector PGTV-FLAG III (Wuhan Transduction Biology Laboratory Co., Ltd.) was double-digested with restriction endonucleases Kpn I and BamHI to obtain the vector backbone. The digestion system (50 μL) consisted of: 1.5 μL Kpn I, 1.5 μL BamHI, 5 μL 10× buffer, 12 μL plasmid DNA, and 30 μL ddH2O; digestion conditions: 37℃ for 1.5 h.

[0045] 3. Ligate the digestion product from step 1 and the vector backbone from step 2 using T4 ligase to obtain the recombinant plasmid. Ligation system (5 μL): 0.5 μL vector backbone, 3.5 μL digestion product, 0.5 μL T4 ligase, and 0.5 μL T4 buffer; Ligation conditions: room temperature, 0.5 h. Then, ligate the ligated recombinant plasmid PGTV-FLAG III- miRNA397a Transformed Escherichia coli DH5α competent cells, plated on solid LB agar plates containing kanamycin, incubated overnight, and then selected colonies for sequencing.

[0046] 4. Based on the sequencing results, it was confirmed that the inserted sequence was the target sequence synthesized in vitro (SEQ ID NO.11).

[0047] 5. The recombinant plasmid PGTV-FLAG II- miRNA397a Recombinant Agrobacterium was obtained by introducing competent Agrobacterium GV3101 (TRANSGEN).

[0048] 6. The recombinant Agrobacterium obtained in step 5 was used to transform Westar (WT) hypocotyls of Brassica napus. The subsequent detection method for transgenic rapeseed plants was the same as in Example 2, and multiple samples were obtained. Bna-miRNA397a Rapeseed inhibitory materials ( Bna- STTM 397a -1、 Bna- STTM 397a -2 and Bna- STTM 397a -3, denoted as STTM1, STTM2 and STTM3). Bna-miRNA397a Expression analysis in wild-type rapeseed plants and repressed transgenic rapeseed is shown in [see details]. Figure 2 The results showed that... Bna-miRNA397a The expression level in the repressed transgenic plants was significantly lower than that in the wild-type Westar plants.

[0049] Example 4: Study on the growth period and yield of transgenic lines 1. Experimental materials (wild-type ZS6, wild-type WT, overexpression transgenic plants, and suppressed expression transgenic plants) were planted at the Hanchuan Base of the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, in the 2025-2026 crop year. Sowing date (October 22, 2025). 0.8g of seeds were directly sown per row, with 6 rows per family, each row 2.2m long. Thinning was carried out at the four-leaf stage, with a row spacing of 0.38m and a plant spacing of 0.2m, resulting in 12 plants per row. The experimental plot had uniform fertility and flat terrain, and conventional cultivation management was implemented in the field.

[0050] 2. During the bolting stage, record the number of flowering plants daily. If more than 5 plants in each family are flowering, mark them as the first flowering stage and take photos. When more than 5 plants in each family have 75% of their siliques turning yellow, record the maturity date. Calculate the number of days of the growing season for each family together with the sowing date.

[0051] 3. When 75% of the siliques on a single plant are ripe, select 10 sample plants that are growing normally, free from disease and mechanical damage, harvest them from the base of the stem, and place them upside down in a hanging storage room for 15 days until they are completely air-dried. Then examine the number of branches, total number of siliques, thousand-grain weight, and yield per plant. For specific steps, refer to the following reference: Lu Kun et al., “Analysis of the yield components of high harvest index of rapeseed under different yield conditions”, Acta Agronomica Sinica, 2017, 43(1):82-96.

[0052] 4. Results are as follows Figure 3 As shown, the flowering time of wild-type rapeseed ZS6 was about 7 days later than that of the overexpressing transgenic plants (OE1, OE2, and OE3). The flowering and seed maturity periods were consistent across families; therefore, the growth period of the overexpressing transgenic plants was about 7 days shorter than that of the wild type. Conversely, the flowering time of the suppressed transgenic plants (STTM1, STTM2, and STTM3) was significantly later than that of the wild-type plant WT, and their growth period was about 10 days longer than that of the wild type. Figure 4 This shows that overexpression transgenic plants flower earlier and have a significantly shorter growth period than wild-type rapeseed and suppressed-expression transgenic plants. Bna-miRNA397a It can be used for the improvement and breeding of short-growing plant varieties.

[0053] 5. The results of the crop testing showed that the number of branches per plant, thousand-grain weight, number of siliques, and yield per plant of the overexpressing transgenic plants were significantly higher than those of wild-type rapeseed. Figure 5 The thousand-grain weight, silique number, and yield per plant of the transgenic plants with suppressed expression were significantly lower than those of wild-type rapeseed. Figure 6 ).

[0054] In conclusion, Bna-miRNA397a It can regulate flowering and yield in plants, and overexpression Bna-miRNA397a It can promote earlier flowering in genetically modified plants, thereby shortening the growth period and increasing yield; it can inhibit... Bna-miRNA397a The expression of this gene prolongs the flowering period and growth cycle of transgenic plants, while reducing yield. Therefore, it is evident that... Bna-miRNA397a This invention can be used for plant breeding, and it provides a new direction for plant breeding.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A miRNA, characterized in that, The miRNA is named Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.

2.

2. As described in claim 1 Bna-miRNA397a The precursor sequence of , characterized in that, The nucleotide sequence of the precursor sequence is shown in SEQ ID NO.

1.

3. The claim 1 Bna-miRNA397a Or the use of the precursor sequence as described in claim 2 in any of the following: (1) Increase rapeseed yield, promote early flowering and / or shorten rapeseed growth period; (2) To prepare products that increase rapeseed yield, promote early flowering and / or shorten the rapeseed growth period; (3) Cultivate rapeseed varieties that flower early, yield high, and / or have a short growing season; (4) Rapeseed germplasm breeding with early flowering, high yield and / or short growth period.

4. The application as described in claim 3, characterized in that, By overexpressing rapeseed Bna-miRNA397a Or precursor sequences, to achieve the effects of increasing rapeseed yield, promoting early flowering of rapeseed and shortening the growth period of rapeseed.

5. Overexpression of the expression described in claim 1 Bna-miRNA397a Or the use of the biomaterial containing the precursor sequence as described in claim 2 in any of the following: (1) Increase rapeseed yield, promote early flowering and / or shorten rapeseed growth period; (2) To prepare products that increase rapeseed yield, promote early flowering and / or shorten the rapeseed growth period; (3) Cultivate rapeseed varieties that flower early, yield high, and / or have a short growing season; (4) Rapeseed germplasm breeding with early flowering, high yield and / or short growth period.

6. The application as described in claim 5, characterized in that, The biomaterials include recombinant plasmids or recombinant bacteria.

7. A method for cultivating early-flowering, high-yielding, and / or short-growing rapeseed, characterized in that, Including overexpression in rapeseed Bna-miRNA397a Steps; The Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.

2.

8. Inhibition Bna-miRNA397a The application of the expressed formulation in prolonging the growth period of rapeseed is characterized by, The Bna- miRNA397a The nucleotide sequence is shown in SEQ ID NO.

2.

9. A method for extending the growth period of rapeseed, characterized in that, Including inhibition in rapeseed Bna-miRNA397a The steps of expression; The Bna-miRNA397a The nucleotide sequence is shown in SEQ ID NO.2.

Images