MiRNA associated with rice blast resistance and application thereof

Abstract

The application discloses a miRNA related to rice blast resistance and application thereof, and belongs to the technical field of plant genetic engineering. The application separates a miRNA, miR6256, from rice, wherein the mature nucleotide sequence of the miR6256 is shown as SEQ ID NO. 1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 12. It is verified through experiments that overexpression of the miR6256 gene in a rice strain can significantly improve the rice blast resistance of the rice, and overexpression of the miR6256 gene in Magnaporthe oryzae or in vitro application of the synthesized miR6256 can significantly inhibit the pathogenicity of the Magnaporthe oryzae. The research finding of the application provides a new thought and way for rice breeding against rice blast and green prevention and control of rice blast, and has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a miRNA associated with rice blast resistance and its applications. Background Technology

[0002] Rice blast severely damages rice production. Discovering rice resistance or resistance-related genes, elucidating the molecular mechanisms of resistance, and breeding resistant varieties based on these findings are effective strategies for controlling rice blast. Researchers both domestically and internationally have conducted research on plant disease resistance, cloning a series of resistance or resistance-related genes (such as...). Pigm , Pib , rod1 and bsr-d1 (etc.), elucidated the molecular regulatory mechanism of disease resistance, and established and continuously improved the molecular model of plant disease resistance. The theories of disease resistance genes and molecules were applied to the resistance improvement of crops such as rice, successfully cultivating a number of new crop varieties with excellent resistance, making a positive contribution to ensuring food security.

[0003] Currently, production mostly utilizes R Genetic modification for disease resistance, due to R The resistance provided by genes is strong and abundant, and has race-specific characteristics. In addition, the rapid evolution and frequent replacement of the dominant pathogenic populations mean that disease-resistant varieties usually lose their resistance after 3 to 5 years of planting.

[0004] miRNA, or microRNA, is a class of endogenous single-stranded non-coding small RNA molecules, approximately 21–24 nt in length. It binds to target mRNA through base pairing, inducing translational repression of the target gene or mRNA degradation, negatively regulating gene expression at the post-transcriptional level. miRNA can simultaneously silence multiple immunosuppressive genes, achieving broad-spectrum and durable resistance, making it less susceptible to pathogen breakthrough. Its regulation only downregulates target genes, without knocking out existing genes, resulting in less interference with crop growth and development, and making it easier to balance yield and quality. Furthermore, it can bind to... R Gene aggregation and superposition further extend the disease resistance and lifespan of rice varieties. However, research on rice miRNAs that can inhibit the pathogenicity of rice blast fungus is still relatively limited, and related control methods and measures need to be developed. Summary of the Invention

[0005] The purpose of this invention is to provide a miRNA related to rice blast resistance and its application, thereby addressing the problems existing in the prior art. This invention discovers that rice miRNA miR6256 can regulate rice resistance to rice blast, representing a novel target for disease resistance improvement.

[0006] To achieve the above objectives, the present invention provides the following solution: In a first aspect, the present invention provides a miR6256 associated with rice blast resistance, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Secondly, the present invention also provides a gene encoding the miR6256, the nucleotide sequence of which is shown in SEQ ID NO.12.

[0008] Thirdly, the present invention also provides a primary transcript pri-miR6256 corresponding to miR6256, the nucleotide sequence of which is shown in SEQ ID NO.13.

[0009] Fourthly, the present invention also provides a gene encoding the primary transcript pri-miR6256, the nucleotide sequence of which is shown in SEQ ID NO.4.

[0010] Fifthly, the present invention also provides a recombinant vector comprising a gene encoding the miR6256 or a gene encoding the primary transcript pri-miR6256.

[0011] In a sixth aspect, the present invention also provides a recombinant bacterium, wherein the recombinant bacterium includes a gene encoding the miR6256 or a gene encoding the primary transcript pri-miR6256.

[0012] In a seventh aspect, the present invention also provides the application of an agent for overexpressing the gene encoding miR6256 or the gene encoding the primary transcript pri-miR6256 in improving rice blast resistance.

[0013] In an eighth aspect, the present invention also provides the use of the gene encoding miR6256, the gene encoding the primary transcript pri-miR6256, the recombinant vector, or the recombinant bacteria in any of the following: (1) Improve rice blast resistance; (2) Breeding rice varieties resistant to rice blast; (3) Improve the germplasm resources of rice resistant to rice blast.

[0014] In a ninth aspect, the present invention also provides a method for improving rice blast resistance, comprising the step of overexpressing a gene encoding miR6256 or a gene encoding the primary transcript pri-miR6256 of miR6256 in the plant. The nucleotide sequence of the gene encoding miR6256 is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding the primary transcript pri-miR6256 of miR6256 is shown in SEQ ID NO.4.

[0015] In a tenth aspect, the present invention also provides a method for breeding rice varieties resistant to rice blast, comprising the step of overexpressing a gene encoding miR6256 or a gene encoding the primary transcript of miR6256 pri-miR6256 in the plant. The nucleotide sequence of the gene encoding miR6256 is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding the primary transcript pri-miR6256 of miR6256 is shown in SEQ ID NO.4.

[0016] The present invention discloses the following technical effects: This invention isolates a miRNA—miR6256—from rice, the mature nucleotide sequence of which is shown in SEQ ID NO. 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 12. Experimental verification shows that overexpression of the miR6256 gene in rice lines can significantly improve rice blast resistance, and overexpression of the miR6256 gene in *Bacillus oryzae* or in vitro application of synthetic miR6256 can significantly inhibit the pathogenicity of *Bacillus oryzae*. The findings of this invention provide new ideas and approaches for breeding rice resistant to rice blast and have promising application prospects. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The study investigated the effect of miR6256 overexpression on rice blast resistance. Figure A shows a schematic diagram of the core elements of the constructed miR6256 overexpression vector; Figure B shows the phenotypic diagrams of rice overexpressing miR6256 and wild-type rice (Kitaake) (scale bar = 10cm); Figure C shows the relative expression level of miR6256 in plants corresponding to Figure B; Figure D shows the blast disease phenotype after spray inoculation; Figure E shows the statistical analysis of the number of lesions after spray inoculation; Figure F shows the blast disease phenotype after fungal inoculation via puncture wound; Figure G shows the statistical results of lesion length after fungal inoculation via puncture wound. ** indicates a highly significant difference compared to the control. P ≤0.01); Figure 2The effect of overexpression of miR6256 on the pathogenicity of *Magnaporum oryzae* was investigated. Figure A shows a schematic diagram of the core elements of the constructed miR6256 overexpression vector; Figure B shows a comparison of the vegetative growth phenotypes of *Magnaporum oryzae* overexpressing miR6256 and wild-type *Magnaporum oryzae*; Figure C shows the relative expression level of pre-miR6256 for the strain in Figure B; Figure D shows a comparison of colony diameters in Figure B; Figure E shows the phenotype of rice blast disease after spray inoculation; Figure F shows the statistical analysis of the number of lesions after spray inoculation; Figure G shows the phenotype of rice blast disease after puncture and fungicide application; Figure H shows the statistical results of lesion length after puncture and fungicide application; Figure I shows the phenotype of rice blast disease; Figure J shows the statistical results of lesion length. ** indicates a highly significant difference compared to the control. P ≤0.01). Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1 1. The gene fragment encoding pri-miR6256 was isolated and purified. 1.1 Total DNA extraction from rice leaves Total DNA was extracted from 3-leaf stage rice leaves using the "Plant Genomic DNA Mini-Extraction Kit (Centrifuge Column Type) (Product No.: D0045S)" manufactured by Beyotime Biotechnology Co., Ltd. The extraction method was performed according to the kit instructions.

[0025] 1.2 Amplification and recovery of the gene sequence encoding pri-miR6256 The mature nucleotide sequence of miR6256 is 5'-GUAGUACUCGGUUGUAGGUGUA-3' (SEQ ID NO.1), and the corresponding nucleotide sequence of the miR6256 encoding gene is 5'-GTAGTACTCGGTTGTAGGTGTA-3' (SEQ ID NO.12). To obtain the complete DNA fragment of the miR6256 precursor encoding gene, this invention amplified the encoding gene of the primary transcript pri-miR6256 containing the miR6256 precursor using PCR technology. Its nucleotide sequence is shown in SEQ ID NO.4, and the corresponding nucleotide sequence of the primary transcript pri-miR6256 is shown in SEQ ID NO.13.

[0026] The primers designed based on the reference genome to amplify the gene sequence encoding pri-miR6256 are shown below: pri-miR6256-F:5'- AGGATATCCAGATCCAGTGGGATCC TAAAAGATATCGATACCGTGA TA-3' (SEQ ID NO.2) (the underlined sequence is the upstream homologous sequence that recombines with the overexpression vector); pri-miR6256-R:5'- CCGCACTAGTAAGCTTGGTACC GGATGGCTCCATCTTTTTTTTTAT-3' (SEQ ID NO.3) (The underlined sequence is the downstream homologous sequence that has been recombined with the overexpression vector).

[0027] The pri-miR6256 sequence was amplified by PCR using Vazyme's Phanta® Max Super-Fidelity DNA Polymerase (specific procedures were performed according to the kit instructions). After amplification, the PCR products were separated by 1.0% agarose gel electrophoresis, and the agarose gel fragment of the target size was cut off under UV light using a clean scalpel. The fragment was recovered using a Beyotime DNA gel recovery kit (product number: D0056), and the recovered product was sent to a sequencing company for sequencing to obtain the purified gene fragment encoding pri-miR6256 (SEQ ID NO.4).

[0028] Nucleotide sequence encoding the pri-miR6256 gene (SEQ ID NO.4): 5'-TAAAAGATATCGATACCGTGATACGTCGCACACAGAGATTTTTCTCTAGGAGTAG -3'。

[0029] The nucleotide sequence of pri-miR6256 (SEQ ID NO.13): 5'-UAAAAGAUAUCGAUACCGUGAUACGUCGCACACAGAGAUUUUUCUCUAGGAG -3'.

[0030] 2. Construction of expression vector for overexpressing miR6256 Use rapid digestion enzyme BamHI and KpnI (Purchased from Thermo Fisher, refer to the product instructions for specific usage and dosage) The double-digested plasmid vector pRGV (this vector has been published in the literature "He, F., Zhang, F., Sun, W. et al. A Versatile Vector Toolkit for Functional Analysis of Rice Genes. Rice 11, 27 (2018). https: / / doi.org / 10.1186 / s12284-018-0220-7") was used to homologously recombine the DNA fragment encoding pri-miR6256 isolated in step 1.2 with the above double-digested vector using recombinase (Vazyme, ClonExpress II One Step Cloning Kit). The recombinant product was transformed into *E. coli* DH5α (purchased from Chengdu Qingke Biotechnology Co., Ltd.) via heat shock transformation. After recovery for 1 hour in 600 μL LB broth (tryptone 10 g / L; yeast extract 5 g / L; sodium chloride 10 g / L), the culture was plated onto LB agar plates containing 50 μg / mL kanamycin (tryptone 10 g / L; yeast extract 5 g / L; sodium chloride 10 g / L; agar powder 13 g / L) and incubated at 37°C for 14-16 hours. Single colonies were picked for colony PCR detection. Positive colonies were expanded and plasmids were extracted. The plasmids were sent to a sequencing company for sequencing. The correctly sequenced overexpression vector was named pRGV-pri-miR6256. Figure 1 (A), in which the nucleotide sequence of the core element UBIp:pri-miR6256 expressed by pRGV-pri-miR6256 is shown in SEQ ID NO.5.

[0031] SEQ ID NO.5: 5'- ctgcagtgcagcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaagtta taaaaaattaccacatatttttt ttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaata atataatctatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaagg acaattgagtattttgacaacaggactctacagttttatctttttagtgtgcatgtgttctcctttttttttgcaa atagcttcacctatataatacttcatccattttattagtacatccatttagggtttagggttaatggtttttatag actaatttttttagtacatctattttattctattttagcctctaaattaagaaaactaaaactctattttagtttt tttatttaataatttagatataaaatagaataaaataaagtgactaaaaattaaacaaataccctttaagaaatta aaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacgg acaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctg gacccctctcgagagttccgctccaccgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcggc agacgtgagccggcacggcaggcggcctcctcctcctctcacggcaccggcagctacgggggattcctttcccacc gctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgt tgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtacgccgc tcgtcctccccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctac ttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgt acgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgc agacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatata tgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggc ggtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtg ccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcg ggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttc attcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtg tcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggt tttactgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataa taaacaagtatgttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatt tttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggt gttacttatgcag GATATCCAGATCCAGTGGGATCC TAAAAGATATCGATACCGTGATACGTCGCACACAGAGATT TTTCTCTAGGAGTAGATAAATGAAGATTCTTCTATCGGATGCCAATTGCCATGGTTTATACTTTGCAAAGAGTAGT TAAATATTTGCAGGAAATCTGAACTGCAAAGCACTGAACTGTATTTTTTTTATTCAGTAAATATTTTCCAAGTGTT GGTTCTGCTCTGCAGCAGAATTTGTAACCTCTGTAACTTCCATATATTGCAGGCGCTAAGCAACGGAAGATACAAG AGCGTGTGGCACCGTGCTGTCGTCAACTCTGACAAAGCGAGGATGTCCGTCGCATCGTTCCTGTGCCCCTGCAACG ACGTGCTCATCGGCCCAGCTCAGAAGCTCATCACCGATGGCTCCCCGGCCGTCTACCGGAACTACACCTACGACGA GTACTACAAGAAGTTCTGGAGCAGAAACCTCGACCAAGAACACTGCTTGGAGCTCTTCAGAACAACACCTACAGAC ACATCTTGAATTCTTGATCTAGTCGAGAACTGGTTTGTAGTACTCGGTTGTAGGTGTAGGTGGTGTTTGGGAGAGG GGGTGGTGTTTGGGAGAGAGCCCGACTTATTGTTTTGTGAGAGGATCTCCCAAACACCCCCGTAGTTTCTCGGTTG AAGTTGTTTGTAGTACTCGGTTGTAGGTGTACTGGAACGAGCCGTTGGAATGAGTAATCAATCAAATCAATCGGTG CAACGCAATTGTACTACTGGAGTTCCGTCGTTTTGCTTATTCGGAAAATAAACCAAACGGTATATTTTTAAATGAA AAATAATTTATGAATAAATTTTCATATATTCGGGATATAAACCAAATGACATATTTTCAAACAAAAACAATTTATG AATAAAGTTTTGATATACATGTTCTTAACAATCTAAAAACAAAGACTAGAAAATAAACTTCGATGAAAAAAAACCT CAAAATCAACTTTAAATTTAAAGTTAAAAATTCAAATTTTAGTTGATAAAGATAAGCATAAAAAAAAAGATGGAGC CATCC GGTACCAAGCTTACTAGTGCGGCCGCTAAGTGAGTAgatcgttcaaacatttggcaataaagtttcttaagatgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaa catgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttatactagatc-3'; Among them, the lowercase and italicized sequence is the maize ubiquitin promoter sequence, the underlined sequence is pri-miR6256, the lowercase sequence is the Nopaline synthase terminator and the poly(A) signal NOS terminator, and the other sequences are polyclonal restriction sites and ligation sequences.

[0032] 3. Construction of rice plants overexpressing miR6256 MS and N6 powders were purchased from Phytotechnology Lab.

[0033] The formulations of the culture media used in the following experiments are as follows: Callus induction medium (1L): N6 4g, sucrose 30g, inositol 0.1g, acid-hydrolyzed casein 0.3g, proline 0.5g, glutamine 0.5g, 2,4-D 2mg, plant gel 4g, pH adjusted to 5.8.

[0034] Infection medium (1L): 3g yeast extract, 5g tryptone, sterilized by high temperature and high pressure, then add 40mg AS and adjust pH to 5.5.

[0035] Co-culture medium (1L): MS 4.4g, sucrose 30g, 2,4-D 2mg, D-Sorbitol 50g, plant gel 4g, adjust pH=5.8, autoclave and add 40mg AS.

[0036] Screening medium (1L): MS 4.4g, sucrose 30g, 2,4-D 2mg, plant gel 4g, adjust pH=5.8, autoclave and add 400mg carbenicillin and 50mg genimycin (G418).

[0037] Predifferentiation medium (1L): MS 4.4g, sucrose 30g, D-Sorbitol 50g, 6-BA 3mg, NAA 0.5mg, plant gel 4g, adjust pH=5.8, autoclave and add 200mg carbenicillin and 25mg G418.

[0038] Redifferentiation medium (1L): MS 4.4g, sucrose 30g, D-Sorbitol 50g, 6-BA 2mg, NAA 0.05mg, plant gel 4g, adjust pH=5.8, autoclave and add 200mg carbenicillin and 25mg G418.

[0039] Rooting medium (1L): MS 2.2g, sucrose 30g, plant gel 4g, adjust pH=5.8, autoclave and pour into tissue culture flasks.

[0040] The miR6256 overexpression vector pRGV-pri-miR6256 obtained above was transformed into Agrobacterium using the liquid nitrogen freeze-thaw method. Single clones were picked for testing, and positive clones were stored for later use.

[0041] Using Agrobacterium-mediated genetic transformation, the above-mentioned positive clone Agrobacterium (carrying the overexpression vector pRGV-pri-miR6256) was transformed into japonica rice Kitaake to overexpress miR6256.

[0042] The Agrobacterium-mediated genetic transformation method for rice is as follows: 1) Inducing callus: Remove the seed coat, weigh about 24 g of seeds, treat with 50 mL of 75% alcohol for 2 min, wash twice with sterile distilled water; disinfect with 2.5% sodium hypochlorite for 20 min, then wash off as much sodium hypochlorite as possible from the seed surface with sterile distilled water, and use sterile filter paper to absorb as much liquid as possible from the seed surface; use tweezers to evenly place the disinfected seeds on the callus induction medium, and then incubate in the dark at 30℃ for 10 days. Then peel the callus off the seeds for the next step. 2) Agrobacterium infection of rice callus: Agrobacterium carrying recombinant plasmids, taken from a -80℃ freezer, was streaked on YM solid medium (containing Kan / Rif / Gm) and cultured at 28℃ for 2 days. Then, a small amount of bacteria was picked and added to 3 mL of YM liquid medium (containing Kan / Rif / Gm) and cultured overnight at 28℃ and 200 rpm. 1 mL of bacterial solution was taken and added to 50 mL of infection medium and cultured at 8℃ and 200 rpm until the OD did not exceed 0.1. The peeled callus was immersed in the infection solution and infected at 28℃ and 140 rpm for 30 min. The infection solution was discarded, and the callus was transferred to sterile filter paper. The surface of the callus was dried as much as possible. Then, the callus was transferred to co-culture medium and cultured in the dark at 22℃ for 3 days. 3) Screening and differentiation: Transfer the callus tissue to the screening medium and culture it in the dark at 30°C for at least 30 days, changing the medium once during the period; then transfer the callus tissue to the predifferentiation medium and culture it in the light at 30°C for 15 days; after that, transfer the callus tissue to the redifferentiation medium and culture it in the light at 30°C until green shoots emerge. 4) Rooting: Transfer the differentiated buds to a rooting medium and culture them under 30°C light. When the seedlings grow to about 10cm, harden them off and then transplant them into the soil.

[0043] The obtained plants were amplified using PCR to carry the G418 resistance gene in the pRGV-pri-miR6256 plasmid to determine whether the plants were positive transformants. Furthermore, the expression level of miR6256 in the transgenic material was detected using stem-loop qRT-PCR, as detailed below: Total RNA was extracted from wild-type and transgenic lines using the Trizol method. First, alcohol was poured into a mortar and ignited to remove RNAase from the mortar through high-temperature treatment. After the mortar cooled, liquid nitrogen was added to cryogenically grind the sample. 100 mg of the ground sample powder was placed in a 1.5 mL EP tube, and 1 mL of Trizol reagent was added. After thoroughly mixing the sample powder with the Trizol solution, the mixture was incubated at room temperature for 5 minutes to allow complete separation of the nucleoprotein complex. Add 0.2 mL of chloroform, vortex vigorously for 20 seconds, and incubate at room temperature for 3 minutes. Centrifuge at 12000 g and 4°C for 15 minutes until the RNA is completely dissolved in the upper aqueous phase. Transfer the upper aqueous phase to a new 1.5 mL EP tube (approximately 0.6 mL). Add an equal volume of chloroform again, vortex for 20 seconds, centrifuge at 12000 g and 4°C for 15 minutes, and transfer the upper aqueous phase to a new 1.5 mL EP tube. Add an equal volume of isopropanol, incubate at room temperature for 10 minutes, and centrifuge at 12000 g and 4°C for 10 minutes to precipitate the RNA. Remove the supernatant; the RNA will adhere to the bottom of the tube. Add 0.75 mL of 70% ethanol to wash the precipitate, gently tapping it to ensure thorough washing. Centrifuge at 7000 g and 4°C for 5 minutes and remove the supernatant. Repeat this step. Place the EP tube in a fume hood to allow the alcohol to evaporate completely, until the precipitate is clear. Add 30 μL of RNAase-free water and incubate at 4°C to dissolve completely.

[0044] miRNA reverse transcription was performed using the Vazyme HiScript IV 1st Strand cDNA Synthesis Kit with gDNA Eraser (product code: R412-01). The miR6256-specific stem-loop reverse transcription primer was: miR6256-RT: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACACC-3' (SEQ ID NO. 6). The expression level of miR6256 was detected using miR6256-F / miR6256-R with miR6256-specific stem-loop quantitative primers. Rice small nuclear RNA OsU6 was used as an internal control, and the OsU6 reverse transcription primer was: 5'-ATTTGGACCATTTCTCGATTTGT-3' (SEQ ID NO. 7). Detection was performed using the RT2 SYBR® Green qPCR Master mixes (purchased from QIAGEN). The reaction system was prepared according to the table below: Table 1 Reaction System RT-PCR reaction conditions: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 20 s, 40 cycles; final 72℃ for 20 s. Using rice genes... U6 As an internal reference gene, it was used in three biological replicates, with expression levels calculated at 2... -△△Ct Calculation by method.

[0045] The primer sequence information used in this step is as follows: miR6256-F: 5'-GCGCGGTAGTACTCGGTTGTA-3' (SEQ ID NO.8); miR6256-R: 5'-AGTGCAGGGTCCGAGGTATT-3' (SEQ ID NO.9); OsU6-F: 5'-CGATAAAATTGGAACGATACAGA-3' (SEQ ID NO. 10); OsU6-R: 5'-ATTTGGACCATTTCTCGATTTGT-3' (SEQ ID NO. 11).

[0046] The results are visible. Figure 1 Central BC. By Figure 1 As shown in Figure B, the phenotype of rice lines overexpressing miR6256 did not change significantly compared with the wild type, and the expression level of miR6256 in the rice lines was significantly increased. Figure 1 (C) It can be seen that the rice lines overexpressing miR6256 were successfully constructed and that overexpression of miR6256 did not have an adverse effect on the phenotype of the rice lines.

[0047] 4. Identification of rice blast resistance in rice plants overexpressing miR6256 The wild-type rice material Kitaake and the genetically transformed seedlings (transgenic rice lines #1 and #2 overexpressing miR6256) involved in this invention were all planted in the rice cultivation greenhouse at the transgenic base of Sichuan Agricultural University. Two transgenic rice lines (#1 and #2) overexpressing miR6256 and the wild-type rice line were selected for rice blast resistance testing. Rice blast resistance was assessed using foliar spray inoculation and in vitro puncture inoculation methods, respectively.

[0048] The specific steps of the rice blast fungus spray inoculation method are as follows: When the rice seedlings have grown to 3 weeks, prepare a spore suspension (5×10⁻⁶) of the physiological race Zhong10-8-14 of rice blast fungus. 5The spore suspension (spores / mL) was transferred to a spray bottle, and Tween-20 was added to a final concentration of 0.01%. Field spraying was carried out around 18:00 in the evening. Immediately after spraying, the area was covered with a thin film for insulation and moisture retention; the film was removed around 8:00 the next morning. Five days after the disease appeared in the field, the number of lesions per leaf for each material was counted, and the differences in rice blast resistance between transgenic rice and the control rice were compared and identified.

[0049] The specific steps for in vitro puncture wounding of *Magnapordica oryzae* spores are as follows: Take 15 leaves each of the second-to-last leaf from wild-type *Kitaake* and transgenic rice lines (#1 and #2) that have grown for 3 weeks. Cut the leaves to the same length. Using a 10 μL pipette tip, puncture two equally spaced points on each leaf. Place the leaf in a petri dish containing 0.1% 6-benzylaminopurin (6-BA, pH=7.0) solution, allowing it to float on the surface. Use a 10 μL pipette to aspirate a prepared *Magnapordica oryzae* spore suspension (5 × 10⁻⁶). 5 Apply 4 μL of suspension to each punctured area using Zhong10-8-14 rice blast fungus spores (spores / mL). After inoculation, incubate at 28°C in the dark for 24 hours, followed by alternating light and dark cycles of 12 hours / day at 28°C for 5 days, for a total of 6 days. Measure and count the length of lesions to compare and identify the differences in rice blast resistance between transgenic rice and the control.

[0050] Identification using spray inoculation and puncture-drip inoculation methods revealed that transgenic rice lines (#1 and #2) overexpressing miR6256 exhibited fewer and shorter lesions after infection with rice blast compared to wild-type lines, indicating that the transgenic rice lines possess better resistance to rice blast. Figure 1 DG (China)

[0051] Example 2 1. The gene fragment encoding pri-miR6256 was isolated and purified. The steps for obtaining the gene fragment encoding pri-miR6256 are the same as in Example 1, except that the primer sequences (SEQ ID NO.14-15) used to amplify the gene sequence encoding pri-miR6256 are different from those in the example.

[0052] SEQ ID NO.14 (pri-miR6256-F): 5'- TAGGAACCCAATCTTCAAACCTAGG TAAAAGA TATCGATACCGTGATACG-3' (The underlined sequence is the upstream homologous sequence that was recombined with the overexpression vector); SEQ ID NO.15 (pri-miR6256-R): 5'- GATTTCAGTAACGTTAAGTGGATCC GGATGGC TCCATCTTTTTTTTTATG-3' (The underlined sequence is the downstream homologous sequence that was recombined with the overexpression vector).

[0053] 2. Construction of expression vector for overexpressing miR6256 Use rapid digestion enzyme AvrII and BamHI (Purchased from Thermo Fisher, refer to the corresponding product instructions for specific usage and dosage) Double-digested plasmid vector pNEB-RP27pro-TrpCter-BAR (This vector has been published in the literature "He, M., Xu, Y., Chen, J., Luo, Y., Lv, Y., Su, J., … Chen, X. (2018). MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae. Autophagy, 14(9), 1543-1561. https: / / doi.org / 10.1080 / 15548627.2018.1458171"). The remaining steps are the same as "2. Construction of expression vector for overexpressing miR6256" in Example 1.

[0054] Single colonies were selected for colony PCR detection. Positive colonies were expanded and plasmids were extracted. The plasmids were then sent to a sequencing company for sequencing. The overexpression vector that was correctly sequenced was named pNEB-pri-miR6256. Figure 2 (A), where the nucleotide sequence of the core element UBIp:pri-miR6256 expressed by pNEB-pri-miR6256 is shown in SEQ ID NO.16.

[0055] SEQ ID NO.16: 5'- ataaatgtaggtattacctgtacattttatttattcgagaaaaacaaacaaaccaaaacgatgca gcgatcactaccggcgtcatc cggaattgaaacggcgcgcgttgaggggggccttcttgttcggacacacacggggccgccaaagtggg gcccatacggctgcccatcccttgctctccaataccctggtcatgtgactcgaaattggagactcacaaagatgct ttgaaaccccgccgggaactttttctcacagacacaatcagtcgaccttatcatcgcaaaatcgacaaacctcaaa aagaactcgaagagtcagtctcccttgcggttaaactgattgatatctcgtgttctctaaaccttcaataagtgag ttactgcgcacaaagccgactatactgagcaccaacgcgaattgctcacgttgtcgcctaacagatcttggctttc gtaggaacccaatcttcaaa CCTAGG TAAAAGATATCGATACCGTGATACGTCGCACACAGAGATTTTTCTCTAGG AGTAGATAAATGAAGATTCTTCTATCGGATGCCAATTGCCATGGTTTATACTTTGCAAAGAGTAGTTAAATATTTG CAGGAAATCTGAACTGCAAAGCACTGAACTGTATTTTTTTTATTCAGTAAATATTTTCCAAGTGTTGGTTCTGCTC TGCAGCAGAATTTGTAACCTCTGTAACTTCCATATATTGCAGGCGCTAAGCAACGGAAGATACAAGAGCGTGTGGC ACCGTGCTGTCGTCAACTCTGACAAAGCGAGGATGTCCGTCGCATCGTTCCTGTGCCCCTGCAACGACGTGCTCAT CGGCCCAGCTCAGAAGCTCATCACCGATGGCTCCCCGGCCGTCTACCGGAACTACACCTACGACGAGTACTACAAG AAGTTCTGGAGCAGAAACCTCGACCAAGAACACTGCTTGGAGCTCTTCAGAACAACACCTACAGACACATCTTGAATTCTTGATCTAGTCGAGAACTGGTTTGTAGTACTCGGTTGTAGGTGTAGGTGGTGTTTGGGAGAGGGGGTGGTGTT TGGGAGAGAGCCCGACTTATTGTTTTGTGAGAGGATCTCCCAAACACCCCCGTAGTTTCTCGGTTGAAGTTGTTTG TAGTACTCGGTTGTAGGTGTACTGGAACGAGCCGTTGGAATGAGTAATCAATCAAATCAATCGGTGCAACGCAATT GTACTACTGGAGTTCCGTCGTTTTGCTTATTCGGAAAATAAACCAAACGGTATATTTTTAAATGAAAAATAATTTA TGAATAAATTTTCATATATTCGGGATATAAACCAAATGACATATTTTCAAACAAAAACAATTTATGAATAAAGTTT TGATATACATGTTCTTAACAATCTAAAAACAAAGACTAGAAAATAAACTTCGATGAAAAAAAACCTCAAAATCAAC TTTAAATTTAAAGTTAAAAATTCAAATTTTAGTTGATAAAGATAAGCATAAAAAAAAAGATGGAGCCATCC -3'; The lowercase and italicized sequence is the RP27 promoter sequence, the underlined sequence is pri-miR6256, the lowercase sequence is the TrpC terminator sequence, and the other sequences are polyclonal restriction sites.

[0056] 3. Construction of *Blastomyces oryzae* strain overexpressing miR6256 The culture media and plate formulations used in the following experiments are as follows: IM induction medium: K2HPO4 1.45 g, KH2PO4 2.5 g, NaCl 0.15 g, MgSO4·7H2O 1.02 g, CaCl2·2H2O 0.087 g, (NH4)2SO4 0.5 g, anhydrous glucose 1.8 g, 50% glycerol 10 mL, FeSO4 0.0008 g, MES 21.3 g / 100 mL H2O, 1 mL 200 mM AS, pH adjusted to 5.3 with HCl, dissolved in 1000 mL ddH2O, autoclaved at 121℃ for 15 min, and finally added filtered sterilized FeSO4, MES, and AS (15 g Agar was added for every 1000 mL of IM solid medium). One-sieve CM plate: 300 μg / mL glufosinate, 400 μg / mL cephalosporin, 100 μg / mL streptomycin, sterilized by filtration, added to the culture medium at a ratio of 1:1000 after sterilization; Two-screen CM plates: 100 μg / mL glufosinate, 100 μg / mL cephalosporin, and 60 μg / mL streptomycin were filtered and sterilized, then added to the culture medium at a ratio of 1:1000 after sterilization.

[0057] The Agrobacterium-mediated genetic transformation method was used to transform the constructed miR6256 overexpression vector pNEB-pri-miR6256 into the blast fungus strain Guy11 to express miR6256 in blast fungus.

[0058] The Agrobacterium-mediated genetic transformation method for rice blast fungus is as follows: 1) Thaw Agrobacterium AGL1 competent cells in an ice-water bath, add 1 μg pNEB-pri-miR6256 plasmid to the competent cells, mix gently, incubate in an ice-water bath for 5 min, flash freeze in liquid nitrogen for 5 min, incubate in a 37℃ water bath for 5 min, incubate in an ice-water bath for 5 min, add 800 μL of antibiotic-free LB (Tryptone 5g, Yeast extract 2.5g, NaCl 5g, dissolved in 500 mL ddH2O, and sterilized in an autoclave at 121℃ for 15 min), culture at 28℃ with shaking for 2-3 h, centrifuge at 5000 r / min for 1 min, collect the bacteria, resuspend the cells, and plate them on carbapenem-rifampicin LB agar plates (add 7.5g of Agar per liter to LB liquid medium, sterilize, add the required antibiotic when cooled to 40℃, and invert the plates), and incubate at 28℃ upside down for 48 hours; 2) Pick a single Agrobacterium colony and incubate it in 2 mL of carbohydrate and rifampicin liquid LB medium at 200 r / min and 28 ℃ for 14 h. Then, directly transfer 20 μL of the bacterial culture into 2 mL of IM induction medium and incubate for 6 h for later use. 3) Scrape Guy11 spores with sterile water and adjust the spore concentration to 1×10⁻⁶. 5 cells / mL; 4) Spread the sterilized and dried nitrocellulose membrane on the surface of IM plate medium, mix Agrobacterium bacterial suspension and Guy11 spore suspension in a 1:1 ratio, spread the mixture evenly on the surface of nitrocellulose membrane, dry it in a clean bench, and incubate it in the dark at 25℃ for 2 days. 5) Use sterile forceps to completely peel off the nitrocellulose membrane, then spread it flat on a CM plate and incubate at 25°C until transformants appear; 6) Using sterilized toothpicks, pick up the transformants onto a two-screen CM plate for screening and culture. Then transfer the screened transformants to a regular CM plate for one generation, and then transfer them back to the two-screen CM plate.

[0059] The obtained transformants were amplified by PCR to carry the BAR resistance gene in the pNEB-pri-miR6256 plasmid to determine whether the plants were positive transformants. Furthermore, the expression level of the miR6256 precursor (pre-miR6256) in the transgenic material was detected using quantitative real-time PCR (qRT-PCR). The experimental method here was consistent with that in Example 1.

[0060] miRNA reverse transcription was performed using the Vazyme HiScript IV 1st Strand cDNA Synthesis Kit with gDNA Eraser (product code: R412-01). The expression level of miR6256 was detected using the pre-miR6256-F / pre-miR6256-R primer pair. The expression level of miR6256 was measured using the *Magnaporthe oryzae* microtubule gene assay. MoTubulin As an internal control gene, the RT2 SYBR® Green qPCR Master mixes (purchased from QIAGEN) were used for detection. The reaction system was prepared according to the table below: Table 2 Reaction System RT-PCR reaction conditions: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 20 s, 40 cycles; final 72℃ for 20 s. Using rice genes... MoTubulin As an internal reference gene, it was used in three biological replicates, with expression levels calculated at 2... -△△Ct Calculation by method.

[0061] The primer sequence information used in this step is as follows: pre-miR6256-F: 5'-CCTCGACCAAGAACACTGCT-3' (SEQ ID NO. 17); pre-miR6256-R: 5'-CTCTCTCCCAAACACCACCC-3' (SEQ ID NO. 18); MoTubulin-F: 5'-GTCACTACACTGAGGGTGCC-3' (SEQ ID NO. 19); MoTubulin-R: 5'-GGGTGATCTGGAAACCCTGG-3' (SEQ ID NO. 20).

[0062] The results are visible. Figure 2 The figure shows that the growth phenotype of *Magnaporum oryzae* overexpressing miR6256 was significantly inhibited compared to the wild-type strain. Figure 2 (B), and the colony diameter was significantly reduced ( Figure 2 (D), and the expression level of miR6256 in rice blast fungus was significantly increased ( Figure 2 (C)

[0063] 4. Identification of growth performance and pathogenicity of rice blast fungus overexpressing miR6256 The culture medium formulations used in the following experiments are as follows: CM solid culture medium: 50 mL of 20× Nitrate Salts, 1 mL of Trace Elements, 1 mL of Vitamin Solution, 10 g of D-Glucose, 1 g of Casamino Acids, 1 g of Yeast Extract, and 2 g of Peptone were dissolved in 1000 mL of ddH2O. The pH was adjusted to 6.5 with NaOH, and 15 g of Agar was added. The mixture was then autoclaved at 121°C for 15 min.

[0064] The growth of transformants of wild-type strain Guy11 and miR6256 *Magnaporum oryzae* was compared on CM plates. The specific method is as follows: CM solid medium was prepared, and filter paper discs carrying *Magnaporum oryzae* were placed on CM plates and cultured for 7 days to activate the *Magnaporum oryzae*. Mycelial blocks were then taken using a 0.5 mm diameter sterile punch and passaged onto new CM plates, with the blocks placed in the center of the plate. After 9 days of alternating light and dark incubation, the outermost edge of the mycelium was used as the boundary, and the colony diameter was measured to compare the growth.

[0065] The specific steps of the spray inoculation method for rice blast fungus are as follows: When Taipei309 (TP309) rice seedlings have grown to 3 weeks, prepare spore suspensions (5×10⁻⁶) of wild-type and transformant rice blast fungus physiological races.5 The spore suspension (spores / mL) was transferred to a spray bottle, and Tween-20 was added to a final concentration of 0.01%. Field spraying was carried out around 18:00 in the evening. Immediately after spraying, the rice was covered with a thin film for insulation and moisture retention; the film was removed around 8:00 the next morning. Five days after the disease appeared in the field, the number of lesions per leaf of each inoculated rice material was counted, and the pathogenicity differences between the miR6256 transformant and the control Guy11 were compared and identified.

[0066] The specific steps of the in vitro puncture method for *Magnapordica oryzae* are as follows: Take leaves from TP309 rice plants that have grown for 3 weeks, cut the leaves to uniform length, and use a 10 μL pipette tip to puncture two equally spaced points on each leaf. Place the leaves in a petri dish containing 0.1% 6-benzylaminopurin (6-BA, pH=7.0) solution, allowing them to float on the surface. Use a 10 μL pipette to aspirate a suspension of *Magnapordica oryzae* spores prepared from Guy11 and miR6256 transformants (5 × 10⁻⁶). 5 Apply 4 μL of suspension (spores / mL) to the punctured area, and inoculate each strain onto at least 15 leaves. After inoculation, incubate at 28°C in the dark for 24 hours, followed by alternating light and dark cycles of 28°C for 12 hours and 12 hours at 28°C for 5 days, for a total of 6 days. Measure and count the length of lesions to compare and identify the differences in pathogenicity of miR6256 transformants.

[0067] Identification using spray inoculation and puncture-drip inoculation methods revealed that the rice blast fungus overexpressing miR6256 exhibited lower pathogenicity, fewer lesions, and shorter lesion length compared to the wild-type strain. Figure 2 (China EJ).

[0068] The above experimental results demonstrate that overexpression of miR6256 can significantly enhance rice resistance to rice blast and reduce the pathogenicity of rice blast fungus, which is of great value for subsequent research on rice blast resistance breeding.

[0069] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A miR6256 associated with rice blast resistance, characterized in that, The nucleotide sequence of miR6256 is shown in SEQ ID NO.

1.

2. A gene encoding miR6256 as described in claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

12.

3. A primary transcript pri-miR6256 corresponding to miR6256 as described in claim 1, characterized in that, The nucleotide sequence of the primary transcript pri-miR6256 is shown in SEQ ID NO.

13.

4. A gene encoding the primary transcript pri-miR6256 as described in claim 3, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

5. A recombinant vector, characterized in that, The recombinant vector includes the gene described in claim 2 or the gene described in claim 4.

6. A recombinant bacterium, characterized in that, The recombinant bacteria include the gene described in claim 2 or the gene described in claim 4.

7. The use of a reagent for overexpressing the gene of claim 2 or the gene of claim 4 in improving rice blast resistance.

8. The use of the gene of claim 2, the gene of claim 4, the recombinant vector of claim 5, or the recombinant bacterium of claim 6 in any of the following: (1) Improve rice blast resistance; (2) Breeding rice varieties resistant to rice blast; (3) Improve the germplasm resources of rice resistant to rice blast.

9. A method for improving rice blast resistance, characterized in that, The steps include overexpressing the gene encoding miR6256 in the plant or the gene encoding the primary transcript of miR6256, pri-miR6256. The nucleotide sequence of the gene encoding miR6256 is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding the primary transcript pri-miR6256 of miR6256 is shown in SEQ ID NO.

4.

10. A method for breeding rice varieties resistant to rice blast, characterized in that, The steps include overexpressing the gene encoding miR6256 in the plant or the gene encoding the primary transcript of miR6256, pri-miR6256. The nucleotide sequence of the gene encoding miR6256 is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding the primary transcript pri-miR6256 of miR6256 is shown in SEQ ID NO.4.

Images