Nucleic acid aptamer targeting ccr8 and derivatives and applications thereof

Abstract

This invention relates to the field of biomedical detection technology. It discloses a nucleic acid aptamer targeting CCR8, its derivatives, and their applications. The nucleic acid aptamer is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO:15. The nucleic acid aptamer derivative is obtained by labeling or chemically modifying the aforementioned nucleic acid aptamer. This invention uses SELEX technology to screen and truncate / optimize to obtain a high-affinity nucleic acid aptamer with small molecular weight, strong tissue penetration, and rapid background removal, enabling high-contrast in vivo imaging within 30 minutes. Experiments show that the Kd value of the truncated aptamer Gtl-4-1 binding to CCR8 protein reaches 20.60±4.82 nM, and the Kd value at the tumor tissue cell level is 16.60±1.74 nM. This nucleic acid aptamer and its derivatives can be used to prepare products for detecting or purifying CCR8, as well as for targeted tumor fluorescent imaging probes, radiopharmaceuticals, and ELISA kits, providing a novel molecular tool for the precise detection and dynamic monitoring of CCR8-positive cells in the tumor microenvironment.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a nucleic acid aptamer targeting CCR8 and its derivatives and applications. Background Technology

[0002] CCR8 (CC chemokine receptor type 8) is a cell membrane-bound G protein-coupled receptor (GPCR) that binds to specific chemokines and regulates immune cell function through related signaling pathways. During tumorigenesis and development, CCR8 expression exhibits significant cell population specificity, particularly in the tumor microenvironment (TME), where it is highly enriched on the surface of tumor-infiltrating regulatory T cells (TI-Tregs). Existing research indicates that after CCR8 binds to its ligands, it can enhance the immunosuppressive activity of Tregs through signaling pathways such as STAT3, TGF-β, and NF-κB, and promote their recruitment and maintenance in tumor tissues. In mice and humans, Tregs highly expressing CCR8 account for 30%-80% of tumor Tregs in various cancers. In contrast, in other tissues, the proportion of Tregs highly expressing CCR8 is typically less than 10%, and conventional T cells (Tconvs) infiltrating tumors generally express low levels or almost no CCR8. Furthermore, Treg cells with high CCR8 expression typically exhibit a highly differentiated phenotype and stable immunosuppressive properties. The cell-specific nature of CCR8 expression has spurred the development of several CCR8-targeted therapies, which are currently undergoing clinical trials in various advanced malignant solid tumors, pancreatic ductal adenocarcinoma, and triple-negative breast cancer.

[0003] Among existing targeting technologies for CCR8, the focus is mainly on traditional monoclonal antibodies, such as the CCR8 monoclonal antibody LM-108, which is currently in Phase III clinical trials. LM-108 primarily mediates the clearance of TI-Tregs in the tumor microenvironment by specifically binding to CCR8 and utilizing ADCC (antibody-dependent cell-mediated cytotoxicity). However, as a traditional large molecule drug, LM-108, like other antibodies, has inherent limitations: its large molecular weight results in poor penetration into deep tissues of solid tumors, making it difficult to reach infiltrating Treg cells; furthermore, the antibody preparation process is complex, production costs are high, and there is a risk of potential immunogenicity that is difficult to completely avoid. As an effective complement to existing large molecule antibody drugs, developing targeting molecules with smaller molecular weights and better tissue penetration potential has become an important direction for further optimizing strategies for regulating the solid tumor microenvironment. Based on this, nucleic acid aptamers, as an emerging technology targeting high affinity recognition of target substances, have attracted widespread attention. Nucleic acid aptamers are a class of highly structured DNA or RNA oligonucleotide molecules that can specifically recognize cellular targets. They exhibit high affinity and high selectivity, and their recognition characteristics are similar to those of antibodies, hence they are called "chemical antibodies." Nucleic acid aptamers can spontaneously fold into specific three-dimensional structures (such as stem-loop structures, hairpin structures, and G-quadruplex structures) through intermolecular interactions such as van der Waals forces, hydrogen bonds, electrostatic interactions, and hydrophobic interactions, thereby providing a binding interface that is highly complementary to the target.

[0004] Nucleic acid aptamers obtained through systematic evolution of ligands by exponential enrichment (SELEX) technology have the following significant advantages compared to traditional monoclonal antibodies: they are entirely based on in vitro screening processes, requiring no immune cells or experimental animals; they can be chemically synthesized on a large scale with high batch-to-batch stability; they are physicochemically stable, facilitating storage and transportation; they have smaller molecular weights (generally 4-50 kDa); they are easy to label, chemically modify, or structurally optimize to enhance stability; they have low toxicity and are non-immunogenic, allowing for higher doses of local or intravenous administration.

[0005] Although existing research has fully demonstrated the significant immunosuppressive effects of tumor-infiltrating regulatory T cells (TI-Tregs) and identified the elimination of these cells as an important pathway for next-generation tumor immunotherapy, current non-invasive detection and dynamic monitoring methods for CCR8 at the in vivo level still have significant limitations. Currently, the development of targeting molecules for CCR8 mainly focuses on monoclonal antibodies and their derivatives. While these large-molecule antibodies have shown potential in targeted binding, their direct development as molecular imaging probes for dynamic monitoring faces significant physical and pharmacokinetic obstacles. Traditional monoclonal antibodies have large molecular weights (typically around 150 kDa), resulting in limited penetration into deep tissues of solid tumors. Simultaneously, the long circulating half-life of antibodies in vivo necessitates a prolonged waiting period (several days) after administration to clear blood and non-target background before achieving an ideal target-to-species ratio (signal-to-background ratio), hindering real-time and rapid imaging monitoring. Furthermore, the Fc fragment in antibody molecules is easily recognized by Fc receptors on immune cells, leading to non-specific tissue uptake and further interfering with imaging accuracy. Summary of the Invention

[0006] To address the shortcomings of existing large-molecule antibody probes, such as poor tissue penetration and high imaging background, as well as the lack of research on CCR8 nucleic acid aptamers, this invention aims to provide a novel CCR8 nucleic acid aptamer with high specificity and high affinity. This aptamer, leveraging its small molecule advantage, can precisely target and non-invasively image tumor-infiltrating regulatory T cells (TI-Tregs) in the tumor microenvironment (TME), providing a novel in vivo molecular capture perspective on tumor immune escape mechanisms independent of the PD-1 / PD-L1 pathway. The technical solution of this invention successfully achieves high-contrast dynamic monitoring of the immune microenvironment of solid tumors, providing a novel molecular imaging tool for evaluating the efficacy of tumor immunotherapy and for precise patient stratification. The target used in the SELEX screening of this application is the human CCR8 protein, whose amino acid sequence corresponds to UniProt database accession number P51685 (manufacturer's product number CSB-CF004847HU).

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: First aspect: Nucleic acid aptamers that specifically target CCR8 The present invention provides a nucleic acid aptamer that specifically targets CCR8, wherein the nucleic acid aptamer is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO:15.

[0008] During the SELEX screening and truncation optimization process of this invention, other candidate sequences with CCR8 binding activity were also obtained, and their sequence information is as follows: (The following lists SEQ ID NO:1 to SEQ ID NO:16) SEQ ID NO: 1 (i.e., the initial screening aptamer Gtl-1): AGCGTCGAATAACCACTACAGGGGGCTAGGGGGGGTCTTGGCCGGTTCCTGTCTGAGCAGTCTAATGGAGCTCGTGGTCAG SEQ ID NO: 2 (i.e., the initial screening aptamer Gtl-2): AGCGTCGAATACCACTACAGGGGGGACTCGGGGGGTAGGCCGGTTCCTGTCAGCAGTCTACTAATGGAGCTCGTGGTCAG SEQ ID NO: 3 (i.e., the initial screening aptamer Gtl-3): AGCGTCGAATACCACTACAGTCATTGGACTTCCGGTGAAGTTGGGTTGGTGGGGTAGGCCTAATGGAGCTCGTGGTCAG SEQ ID NO: 4 (i.e., the initial screening aptamer Gtl-4): AGCGTCGAATACCACTACAGGGGGGCGTATCGGGGGGGTAGGCCGGGACCCTGTGTGCACCTAATGGAGCTCGTGGTCAG SEQ ID NO: 5 (i.e., the initial screening aptamer Gtl-5): AGCGTCGAATACCACTACAGCAACAGTGGCTTGGGTTCGGGTTGGGGGGTTGCTTCTCCACCTAATGGAGCTCGTGGTCAG SEQ ID NO: 6 (i.e., the initial screening aptamer Gtl-6): AGCGTCGAATACCACTACAGTTCGTTGGCCGGGTCCCATCTGGGGGGTTAGGGGGGTACGCTAATGGAGCTCGTGGTCAG SEQ ID NO: 7 (i.e., the initial screening aptamer Gtl-7): AGCGTCGAATAACCACTACAGGGGGGAAATGGGGGGTTTGCCGGGCCCCTGTTTGAATGGCTAATGGAGCTCGTGGTCAG SEQ ID NO: 8 (i.e., the initial screening aptamer Gtl-8): AGCGTCGAATACCACTACAGATTCGATGGGGAGGTGGGTGGGCTCTCCAATTAGCCGGAACTAATGGAGCTCGTGGTCAG SEQ ID NO: 9 (i.e., the initial screening aptamer Gtl-9): AGCGTCGAATACCACTACAGCATCCGTTAGGGGGGGTCTGGCCGGTTCCTATGCAGGGGGCTAATGGAGCTCGTGGTCAG SEQ ID NO: 10 (i.e., the initial screening aptamer Gtl-10): AGCGTCGAATACCACTACAGACATTGGGGGGCCGTAATACGGGGGGGGTCTGGCCGGGACCTAATGGAGCTCGTGGTCAG SEQ ID NO: 11 (i.e., the initial screening aptamer Gtl-11): AGCGTCGAATACCACTACAGGCTCCCAGTGGGGGGGGTAGGGGGGAATTTGGCCGGGACCCTAATGGAGCTCGTGGTCAG SEQ ID NO: 12 (i.e., the truncated optimized aptamer Gtl-1-1): ACAGGGGGCTAGGGGGGGTCTTGGCCGGTTCCTGT SEQ ID NO: 13 (i.e., the truncated optimized aptamer Gtl-1-2): CTACAGGGGGCTAGGGGGGGTCTTGGCCGGTTCCTGTCTGAGCAGTCTAATGGAGCTC SEQ ID NO: 14 (i.e., truncated optimized aptamer Gtl-2-1): TACCACTACAGGGGGGACTCGGGGGGTAGGCCGGTTCCTGTCAGCAGT SEQ ID NO: 15 (i.e., the truncated optimized aptamer Gtl-4-1): ACAGGGGGGCGTATCGGGGGGGTAGGCCGGGACCCTGT SEQ ID NO: 16 (i.e., the truncated optimized aptamer Gtl-4-2): TACAGGGGGGCGTATCGGGGGGGTAGGCCGGGACCCTGTGTGCACCTAATGGAGCT

[0009] The second aspect: nucleic acid aptamer derivatives that specifically target CCR8. The present invention provides a nucleic acid aptamer derivative that specifically targets CCR8, which is obtained by modifying any of the nucleic acid aptamers described in the first aspect.

[0010] The nucleic acid aptamers described in this invention possess extremely excellent, specific, and universal targeting specificity. Those skilled in the art should understand that in the nucleic acid aptamer derivatives provided by this invention, the core of the aptamer is responsible for providing biological targeting and recognition functions, while the specific markers or chemical modifications primarily serve as imaging signal sources, radiotherapy energy release sources, or stability-modifying groups, and do not affect the biological activity of the nucleic acid aptamer itself in binding to the target.

[0011] As a preferred technical solution, the modification is selected from isotope markers or fluorescent markers.

[0012] The markers include at least one of isotope markers and indirect isotope markers (aptamer-chelator-nucleoside / drug conjugates), fluorescent markers, biotinylate markers, enzyme markers, and chemiluminescent markers; The aforementioned isotope labels or indirect isotope labels cover all radioactive isotopes and their compounds used for imaging. To meet the needs of different clinical nuclear medicine imaging modalities (such as PET and SPECT imaging), the radioactive isotopes and their compounds include, but are not limited to, the following broad categories and specific nuclides: (1) Radioactive isotopes of halogen elements: These are mainly covalently linked to the 5' or 3' end of nucleic acid aptamers. This linking includes directly coupling the isotope to the nucleic acid aptamer using click chemistry (including, but not limited to, copper-catalyzed or copper-free azido-alkynyl cycloaddition reactions, tetrazine-trans-cyclooctene linkage reactions, etc.), or introducing an indirect labeling group containing the isotope using click chemistry; specifically including: 11 C 13 C 18 F, 19 F, 31 P, 32 P, 35 S, 36 Cl、 123 I, 124 I, 125 I, 131 I, and 211 At, etc.; (2) Radioactive isotopes of transition metal elements: These are mainly formed by chelating with chelating agents (including but not limited to NOTA, DOTA, TETA, TE2A, PCTA, NODAGA, DFO, HBED-CC, etc. or their derivatives) through coordination bonds to form indirect isotope markers, specifically including: 43 Sc、 44 Sc、 47 Sc、 52 Fe、 55 Co、 60 Cu、 61 Cu、 62 Cu、 64 Cu、 67 Cu、 86 Y、 89 Zr、 90 Y、 99m Tc, 186 Re, and 188 Re, etc.; (3) Radioactive isotopes of main group metals: They also bind with corresponding chelating agents through coordination chemistry with high stability, specifically including: 67 Ga、 68 Ga、 111 In、 117 mSn, 201 Tl、 212 Pb, 212 Bi、 213 Bi, and 223 Ra et al.; (4) Radioactive isotopes of lanthanides and actinides: These radionuclides have important applications in theranostics and high linear energy transfer (LET) targeted radiotherapy, specifically including: 153 Sm、 161 Tb, 177 Lu、 225 Ac, and 227 Th et al.

[0013] The chemical modification includes at least one of methylation, amination, thiolation, phosphorylation, thiolation, carboxylation, and PEGylation.

[0014] In this invention, the aforementioned nuclides belonging to the same class (e.g., metal ions of the same group, period, or with similar coordination numbers, ionic radii, and coordination kinetics) exhibit high chemical equivalence, substitutability, and predictable universality in coordination chemistry and covalent bonding (e.g., click chemistry reactions). Therefore, those skilled in the art can, based on the universal labeling method and route described in this invention, readily apply the following to the examples without inventive effort: 68 Ga or 18 F can be replaced with any one or more medical radionuclides listed above.

[0015] The fluorescent label is selected from one or more fluorescent dyes used for in vivo optical imaging, flow cytometry analysis, or in vitro fluorescence microscopy. The fluorescent dye can be directly or indirectly linked to nucleic acid aptamers via covalent bonds, preferably through click chemistry, amide reaction, or thiol-maleimide reaction. To accommodate different excitation wavelengths and detection instruments, the fluorescent dyes include, but are not limited to, the following specific dyes: Cy3, Cy5, Cy5.5, Cy7, indocyanine green (ICG), fluorescein isothiocyanate (FITC), allophycocyanin (APC), and the Alexa Fluor series of dyes.

[0016] In this invention, the aforementioned fluorescent dyes exhibit a high degree of versatility and equivalent substitutability as can be anticipated by those skilled in the art in experimental applications such as physical signal labeling, chemical coupling reactions or confocal experiments, and flow cytometry analysis. Those skilled in the art, based on the universal labeling route described herein, can equivalently replace the exemplary Cy3, Cy5, Cy5.5, FITC, and APC dyes with any one or more of the fluorescent dyes listed above without any inventive effort.

[0017] As a preferred technical solution, the chemical modification includes at least one of methylation modification, amination modification, thiolation modification, phosphorylation modification, thiolation modification, carboxylation modification and PEGylation modification.

[0018] Thirdly: Reagents for detecting CCR8 protein or its expression cells. The present invention provides a reagent for detecting CCR8 protein or its expression cells, the reagent comprising the nucleic acid aptamer derivatives described in the second aspect.

[0019] Imaging agents for targeting CCR8-positive cells on the surface of immune cells in the tumor microenvironment for non-disease diagnostic purposes, as well as medical carriers (including liposomes, chitosan, etc.).

[0020] Fourth aspect: Methods for detecting CCR8 The present invention provides a method for detecting CCR8, comprising: mixing and incubating an in vitro test sample with the nucleic acid aptamer derivative described in the second aspect, and detecting the expression of CCR8 or fluorescence signal in the sample.

[0021] As a preferred technical solution, the in vitro test sample includes CCR8 transfected cells or CCR8... + Treg cells; the specific detection method includes confocal fluorescence staining imaging analysis.

[0022] Fifth aspect: Application This invention provides the application of the aforementioned nucleic acid aptamer derivative in the preparation of a kit for detecting CCR8.

[0023] As a preferred technical solution, the kit includes at least one of an enzyme-linked immunosorbent assay kit, a biosensor, a detection chip, or a gene chip.

[0024] This invention also provides the application of the nucleic acid aptamer derivative in the preparation of reagents for targeting tumors, tumor microenvironments, and other in vivo immune cell molecular imaging for high CCR8 expression. Preferably, the tumor is non-small cell lung cancer (NSCLC); the target of recognition and binding is CCR8-positive cells (especially CCR8-positive cells) in the NSCLC microenvironment. + Treg cells).

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: The nucleic acid aptamers and derived probes described in this invention can specifically target the CCR8 protein on the surface of TI-Treg, achieving precise recognition and binding of the CCR8 protein in the tumor microenvironment such as lung cancer.

[0026] (1) High affinity and specificity The short-chain nucleic acid aptamers obtained through screening and truncation optimization in this invention possess high nanomolar binding affinity. Using these aptamers to detect CCR8 expression in the microenvironment of non-small cell lung cancer (NSCLC) exhibits high specificity and sensitivity. Experimental data show that the Kd value for the truncated nucleic acid aptamer Gtl-4-1 binding to CCR8 protein is 20.60 ± 4.82 nM; the Kd value measured at the real tumor tissue cell level is 16.60 ± 1.74 nM.

[0027] (2) Excellent penetration and rapid imaging capabilities for solid tumors The nucleic acid aptamers of this invention have extremely small molecular weights, thus possessing extremely strong deep tissue penetration; they are rapidly effective in in vivo targeted applications and can quickly clear background signals from non-target areas, enabling early, high-contrast, and precise dynamic imaging in a very short time. In vivo fluorescence imaging and PET / CT (positron emission tomography / computed tomography) imaging have both confirmed that Cy5.5, 68 Ga and 18 F-labeled Gtl-4-1 was significantly enriched at the tumor site within 30 minutes after injection, and background clearance was rapid.

[0028] (3) It has stable physical and chemical properties and is easy to modify and transform. The aptamer is non-immunogenic, and its sequence exhibits excellent resistance to nuclease degradation both in vivo and in vitro. It is stable and easily preserved for long periods. Serum stability experiments showed that Gtl-4-1 remained stable after incubation in mouse serum at 37°C for 4 hours. Furthermore, its 5' or 3' ends can be modified or labeled in various ways (e.g., with fluorescent groups, radioisotopes, etc.) through simple chemical reactions to meet diverse detection needs.

[0029] (4) It has great potential for large-scale production and good batch consistency. The nucleic acid aptamers disclosed in this invention are entirely based on in vitro chemical synthesis, requiring no complex cell or animal immune culture systems. The synthesis process is simple and inexpensive. They have a short production cycle and excellent batch-to-batch reproducibility, making them highly suitable for large-scale standardized production.

[0030] In addition, this invention has established an ELISA (enzyme-linked immunosorbent assay) detection system based on the nucleic acid aptamer Gtl-4-1, which can effectively identify CCR8 signals in tumor tissue and peripheral blood leukocytes of tumor-bearing mice, indicating that this aptamer has good potential for in vitro detection applications.

[0031] The nucleic acid aptamer derivatives of the present invention can be used as highly sensitive and tissue-penetrating molecular imaging probes for in vivo non-invasive targeted tracing and precise quantitative analysis of CCR8 positive cells in various tumor microenvironments and immune-related diseases, and have potential application value for targeted therapy based on radioisotopes. Attached Figure Description

[0032] Figure 1 The image shows the screening and enrichment analysis results of CCR8-targeted nucleic acid aptamers in Example 1 of this invention; where A is the enrichment analysis image of CCR8 protein binding and B is the control analysis image of Ni microbead reverse screening. Figure 2 This is a graph showing the preliminary evaluation results of the binding ability of the CCR8 candidate nucleic acid aptamer sequence in Example 1 of the present invention; where A is a histogram detected by flow cytometry and B is a quantitative fluorescence intensity bar graph. Figure 3 The figure shows the target binding ability analysis results of the truncated CCR8 nucleic acid aptamer in Example 2 of the present invention; where A is a histogram of flow cytometry detection and B is a quantitative fluorescence intensity bar chart. Figure 4 This is a diagram showing the target specificity verification results of the nucleic acid aptamer Gtl-4-1 targeting CCR8 in Example 2 of the present invention; wherein, A is a flow cytometry specificity detection diagram, and B is a fluorescence intensity quantitative diagram of the binding strength of Gtl-4-1 with human CCR8 protein, human CD70 protein and human DLL3 protein; Figure 5 This is a graph showing the in vitro serum stability verification results of the CCR8-targeting nucleic acid aptamer Gtl-4-1 in Example 3 of the present invention; where A is a TBE-PAGE gel electrophoresis image and B is a quantitative bar chart of the integrated gray value of the bands. Figure 6 This is a graph showing the binding affinity analysis between the Gtl-4-1 nucleic acid aptamer and the CCR8 protein in Example 4 of the present invention; wherein, A is a diagram of the predicted secondary structure of Gtl-4-1, and B is a graph of Kd value saturation binding. Figure 7 The figure shows the construction and expression verification results of the CCR8 overexpression LLC cell model in Example 5 of the present invention; where A is a Western Blot detection figure, B is a quantitative statistical figure of the relative protein expression of CCR8, C is a flow cytometry detection figure, and D is an immunofluorescence detection figure. Figure 8 The image shows the results of the targeting binding ability of the fluorescently labeled Gtl-4-1 aptamer to a CCR8-overexpressing LLC cell model in Example 6 of this invention; where A is a flow cytometry image of FITC channel detection of green fluorescent protein (GFP) expression during transfection, and B is a flow cytometry image of APC channel detection of APC channel detection of APC-labeled Gtl-4-1 aptamer binding to CCR8-overexpressing LLC cells. Figure 9 The image shows the immunofluorescence targeting and binding verification results of the fluorescent label Gtl-4-1 on CCR8-overexpressing LLC cells in Example 7 of this invention; where A is a confocal imaging image of LLC-CCR8-overexpressing cells and B is a confocal imaging image of wild-type LLC cells as a control. Figure 10 This is a graph showing the analysis results of CCR8 expression in different tumor models and Treg cells in Example 8 of the present invention; where A is a scatter plot by flow cytometry, and B is a flow cytometry-detected CCR8 in different tissues. +The graph shows the statistical proportion of Treg cells. C is a band diagram of CCR8 protein expression in different non-small cell lung cancer models detected by Western blotting; D is a quantitative graph of relative CCR8 protein expression. Figure 11 The image shows the fluorescence distribution analysis results of Cy5.5 fluorescently labeled Gtl-4-1 in tumor-bearing mice and in vitro tissues in Example 9 of this invention; where A is an in vivo IVIS fluorescence imaging image, B is an in vitro tissue and organ fluorescence imaging image, and C is a quantitative statistical graph of fluorescence radiation efficiency. Figure 12 The radionuclide of Example 9 of the present invention 68 Ga and 18 PET / CT imaging results and tumor targeting evaluation map of F-labeled Gtl-4-1 aptamer in LLC tumor-bearing mice; where A is 68 Ga-labeled probe PET / CT imaging image, B is... 18 F-labeled probe PET / CT imaging image, C is... 68 Graph of tumor uptake %ID / g of Ga-labeled probe, where D represents... 18 Graph showing tumor uptake (%ID / g) of F-labeled probe; E represents... 68 A quantitative chromatogram of the T / M ratio of Ga-labeled probes, where F represents... 18 Quantitative plot of T / M ratio for F-labeled probes; Figure 13 Gtl-4-1 and CCR8 of Embodiment 10 of the present invention + Treg binding affinity analysis curves; where A is the secondary structure prediction model of Gtl-4-1, and B is the Kd value saturation binding curve. Figure 14 The image shows the results of a double-sandwich ELISA using the Gtl-4-1 nucleic acid probe of this invention for CCR8 detection; where A is an ELISA chromogenic plate image of tissue sample lysis buffer, B is an ELISA chromogenic plate image of peripheral blood leukocyte lysis buffer, C is a quantitative statistical graph of OD450 absorbance of tissue sample, and D is a quantitative statistical graph of OD450 absorbance of peripheral blood leukocytes. Detailed Implementation

[0033] This invention utilizes Systematic Evolutionary Exponential Expansion (SELEX) technology to screen and optimize DNA aptamers targeting the CCR8 protein. The key technology lies in obtaining shorter aptamers (such as Gtl-4-1) with smaller molecular weights and superior affinity after screening for the full-length sequence. These aptamers possess excellent deep tissue penetration, extremely rapid in vivo background clearance from non-target areas, and good in vitro and in vivo physicochemical stability. They can effectively and specifically target and bind to CCR8-positive cells (especially tumor-infiltrating regulatory T cells) in tumor microenvironments such as non-small cell lung cancer. This makes them suitable for constructing in vivo molecular imaging probes and in vitro detection kits, thereby achieving high-contrast, specific imaging and accurate detection of the CCR8 target in the tumor microenvironment.

[0034] To facilitate understanding of the technical means, creative features, objectives, and effects of this invention, the following detailed embodiments further illustrate the invention. These embodiments are for illustrative purposes only and should not be considered as limiting the scope of protection of this invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this invention should be included within its scope of protection. Experimental methods without specified conditions are generally performed under conventional conditions or as recommended by the reagent manufacturer. Reagents or instruments without specified manufacturers are all commercially available conventional products.

[0035] Example 1: Screening of nucleic acid aptamers This embodiment describes the SELEX screening process for DNA aptamers targeting CCR8.

[0036] The CCR8 protein (His-tag) was conjugated with Ni microbeads: 80 μg of CCR8 protein was dissolved in 160 μL of PBS, and 5 μL of Ni microbeads were added. The mixture was incubated at room temperature for 3 h. The unbound free protein was separated from the microbeads, the supernatant was discarded, and positive sieve microbeads were obtained. Then, 5 μL of the naked Ni microbeads were taken, washed twice with PBS, and resuspended in 160 μL of PBS solution to obtain reverse sieve microbeads.

[0037] Taking the first round of screening as an example, the specific steps are as follows: (1) Take one initial library powder, centrifuge at 4000 rpm for 30 s, add ultrapure water to dissolve, take 2.5 nmol of the library, add binding buffer to 500 μL, denature at 95℃ for 5 min, cool at 4℃ for 10 min, and recover at room temperature for 10 min; (2) Add the library to the positive sieve microbeads and incubate at room temperature for 30 min; (3) Separate and retain the microbeads, and wash twice with binding buffer; (4) Resuspend the microbeads in PCR reagent for amplification, and cycle 10 times; (5) Take 5 μL of the product from the first polymerase chain reaction (PCR) and perform a second PCR with varying cycle number. After the PCR is completed, perform agarose gel electrophoresis. (6) Select the cycle number where the clear and bright band is located for the third PCR. After the PCR is completed, add SA microbeads and incubate for 15 min. (7) After incubation, filter the microbeads, wash with PBS, add sodium hydroxide (NaOH) to collect single-stranded sequences, add hydrochloric acid (HCl) to adjust the pH to neutral, centrifuge at 1000 rpm for 15 min, and take the supernatant as the next round of screening library; (8) After the third round, after each round of library denaturation, first add reverse sieve microbeads (Ni microbeads) for incubation, separate and collect the supernatant, and then incubate with positive sieve microbeads; (9) Subsequent screening will be adjusted based on the screening results of each round, and the operation steps are the same as above.

[0038] Secondary libraries obtained in each round of screening (e.g., R0, R11, R12) were incubated with CCR8-conjugated microbeads (positive screening) and naked Ni microbeads (reverse screening), respectively. The overall binding capacity and specificity of the libraries were determined by flow cytometry. The initial library (SEQ ID NO.17) was specifically 5'-AGCGTCGAATACCACTACAG-(N40)-ATGGAGCTCGTGGTCAG-3', where the two ends were fixed sequences of PCR amplification primers, and the (N40) in the middle was a region composed of 40 random bases.

[0039] It should be noted that the middle (N40) is a highly randomized base sequence, which is the standard design for constructing large-capacity nucleic acid libraries and is not a specific technical feature claimed in this invention. Therefore, it is neither necessary nor possible to limit the specific 40 base sequences. The fixed sequences at both ends are key to ensuring that the public can independently customize this screening library. By disclosing the complete structure and its commercial source, the requirement for the public to reproduce this invention has been fully met. This sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0040] The results are as follows Figure 1 As shown, with the increase of screening rounds, the fluorescence signal of the library binding to CCR8 microbeads gradually increased (peak shifted to the right), while no obvious binding signal was observed for Ni microbeads, indicating that the nucleic acid sequence specifically targeting CCR8 was effectively enriched in the library. After confirming that the library enrichment had reached a plateau, sequencing analysis was performed on the enriched library, and preliminary screening yielded CCR8-targeting nucleic acid aptamers Gtl-1 to Gtl-11. The results are as follows. Figure 1As shown, with each round of screening, the fluorescence peaks of the libraries bound to CCR8-conjugated microbeads gradually shifted to the right, indicating that the binding ability of the libraries to the CCR8 protein gradually increased. Compared with the initial library R0, the average fluorescence intensity of the enriched library R12 after binding to CCR8-conjugated microbeads in the 12th round increased by nearly 10 times, approximately one order of magnitude. Meanwhile, the fluorescence signal of the R12 library after incubation with naked Ni microbeads remained at the baseline level, without significant enhancement. These results indicate that during multiple rounds of SELEX screening, nucleic acid sequences capable of binding to the CCR8 protein were effectively enriched in the libraries, and this enrichment was not due to non-specific binding of the libraries to the Ni microbeads.

[0041] After the binding signal of the library to the CCR8 protein stabilized, sequencing analysis was performed on the enriched library, resulting in 11 candidate aptamer sequences, corresponding to SEQ ID NO:1 to SEQ ID NO:11 (i.e., Gtl-1 to Gtl-11). Subsequently, flow cytometry was used to preliminarily evaluate the binding affinity of these 11 candidate sequences to the CCR8 protein, and the results are as follows: Figure 2 As shown in the figure, all 11 candidate sequences exhibited varying degrees of enhanced fluorescence signals compared to the initial library. Among them, the average fluorescence intensity of the Gtl-4 group was relatively high, indicating that it has a strong binding ability to the CCR8 protein; the fluorescence signals of candidate sequences such as Gtl-1 and Gtl-2 were also higher than those of the initial library, indicating that they also have a certain binding ability to the CCR8 protein.

[0042] Example 2: Optimization of Nucleic Acid Aptamers To further optimize the nucleic acid aptamer sequences, the nucleic acid aptamers Gtl-1, Gtl-2, and Gtl-4 obtained in Example 1 were truncated at the ends to remove the non-essential primer sequences at the 5' and 3' ends, while precisely retaining the functional core regions that specifically bind to the target. This resulted in truncated and optimized nucleic acid aptamers Gtl-1-1, Gtl-1-2, Gtl-2-1, Gtl-4-1, and Gtl-4-2, corresponding to SEQ ID NO:12 to SEQ ID NO:16, respectively.

[0043] Among the truncated sequences mentioned above, Gtl-2-1, Gtl-4-1, and Gtl-4-2 were selected for flow cytometry binding ability evaluation, and the results are as follows: Figure 3 As shown, under the same aptamer concentration, fluorescent labeling, and detection conditions, all three truncated nucleic acid aptamers exhibited binding signals to the CCR8 protein. Compared with the corresponding full-length nucleic acid aptamers and the initial library, the flow cytometry fluorescence peaks of Gtl-4-1 and Gtl-4-2 showed varying degrees of rightward shift, indicating that both truncated aptamers could still effectively recognize and bind to the CCR8 protein.

[0044] Flow cytometry results showed that the binding signals of Gtl-4-1 and Gtl-4-2 were similar, and there was no statistically significant difference in their binding ability. However, Gtl-4-2 has a sequence length of 56 nucleotides, while Gtl-4-1 has a sequence length of only 38 nucleotides. While retaining CCR8 binding ability, the shorter Gtl-4-1 has advantages such as smaller molecular weight, relatively simpler chemical synthesis, lower synthesis cost, and easier subsequent fluorescent or radioactive labeling modification, while also reducing potential steric hindrance. Therefore, this application prefers Gtl-4-1 as a candidate sequence for subsequent affinity determination, binding specificity evaluation, serum stability detection, and in vivo targeting validation.

[0045] Further verification of the binding specificity of Gtl-4-1 with strong binding ability yielded the following results: Figure 4 A and Figure 4 As shown in Figure B, Gtl-4-1 generates a significant binding signal with human CCR8 protein, while no significant binding signal is observed with human CD70 protein or human DLL3 protein, which fully verifies its targeting specificity.

[0046] Example 3: In vitro serum stability assay of nucleic acid aptamers The stability of nucleic acid aptamers determines their potential for subsequent practical applications. The truncated and optimized short-chain nucleic acid aptamer Gtl-4-1 was dissolved in mouse serum to a final concentration of 5 μM. Samples were aliquoted into five tubes and incubated at 37°C for 0 h, 0.5 h, 1 h, 2 h, and 4 h. After incubation at each time point, the tubes were immediately placed in a 95°C constant-temperature metal bath for denaturation for 5 minutes, cooled on ice, and then stored at -80°C. Once all samples were collected, TBE-PAGE gel electrophoresis was performed and images were obtained.

[0047] The results are as follows Figure 5 As shown, TBE-PAGE gel images revealed that the main band of Gtl-4-1 remained clear after incubation in mouse serum at 37°C for 0 to 4 hours. Gray-scale quantitative analysis (…) Figure 5 B) shows that after 4 hours of incubation, the band density of Gtl-4-1 remained at more than 50% of the initial level, indicating that Gtl-4-1 has excellent in vitro stability and resistance to nuclease degradation in mouse serum.

[0048] Example 4: Affinity Detection of Nucleic Acid Aptamers The binding affinity between the target protein and the nucleic acid aptamer was determined by flow cytometry, and the equilibrium dissociation constant (Kd) was calculated to assess the affinity.

[0049] FITC-labeled Gtl-4-1 aptamers were dissolved and prepared as a 20 μM stock solution, which was then diluted to concentrations of 0, 3, 5, 7.5, 10, 20, 35, 50, 80, 100, 150, 200, and 300 nM. 3 μL of CCR8 microbeads were added to each solution, gently mixed, and incubated in the dark for 30 min. After incubation, the CCR8 microbeads were collected by filtration, and the precipitate was retained. The microbeads were washed with 100 μL of phosphate-buffered saline (PBS) (purchased from Beijing Solarbio Science & Technology Co., Ltd.) 2-3 times to remove unbound aptamers. The CCR8 microbeads were resuspended in 200 μL of PBS, gently mixed, and the fluorescence intensity of the sample was obtained and analyzed by flow cytometry. Nonlinear regression fitting was performed with aptamer concentration as the x-axis and the corresponding average fluorescence intensity as the y-axis.

[0050] like Figure 6 Figure A shows the predicted secondary structure pattern of Gtl-4-1, whose G-rich stem-loop structure provides a stable spatial basis for target binding. Plotting aptamer concentration on the x-axis and average fluorescence intensity on the y-axis, a nonlinear regression fit is performed, as shown below. Figure 6 As shown in Figure B, the Kd value for the binding of the truncated aptamer Gtl-4-1 to the CCR8 protein is 20.60 ± 4.82 nM (goodness of fit R). 2 >0.95). This nanomolar Kd value indicates that the truncated and optimized nucleic acid aptamer has a high binding affinity for the CCR8 protein.

[0051] Example 5: Construction of CCR8 overexpression cell lines A CCR8 overexpression lentivirus was constructed. The CCR8 gene sequence was constructed into the GV492 lentiviral vector (purchased from Shanghai Jikai Gene Medical Technology Co., Ltd.). The element sequence of this vector was Ubc-MCS-3FLAG-CBh-gcGFP-IRES-puromycin. Mouse lung adenocarcinoma cell line LLC (purchased from the American Type Culture Collection, ATCC) was infected using this constructed lentivirus. After adding the virus and appropriate infection enhancement medium, the cells were cultured for 8 hours, followed by replacement with complete culture medium. Cell morphology was observed during culture to ensure normal growth. 72 hours after infection, the intensity of green fluorescence was observed under a fluorescence microscope to determine the infection effect. Next, the cells were placed in a medium containing 10 μg / mL puromycin (purchased from Beijing Solarbio Science & Technology Co., Ltd.) for selection for 48 hours. After selection, all cells in the uninfected blank control group died, while all surviving cells in the infected group were positive. Subsequently, the puromycin concentration was reduced to a maintenance concentration (5 μg / mL), and the positive cells were further amplified. Simultaneously, a portion of cells was collected, and the expression of CCR8 protein was identified by flow cytometry, immunofluorescence, and Western blotting, respectively. The identification results are as follows: Figure 7 As shown.

[0052] First, Western blot results showed that, compared with wild-type LLC cells, the CCR8 protein band of approximately 41 kDa was significantly enhanced in LLC-CCR8 cells. Gray-scale quantitative analysis showed that the relative expression level of CCR8 protein was significantly increased, and the difference was statistically significant (**, p < 0.01). Figure 7 A); the corresponding relative protein expression level quantification graph is shown below. Figure 7 As shown in Figure B, gray-scale quantitative analysis revealed a significant increase in the relative expression level of CCR8 protein, with statistically significant differences (**, p < 0.01); flow cytometry results showed that the LLC-CCR8 cell population exhibited obvious GFP fluorescence signals, indicating that most of the selected cells successfully expressed the GFP reporter gene carried by the lentiviral vector. Figure 7 C); Immunofluorescence results further showed that obvious GFP green fluorescence and CCR8 red fluorescence could be observed in LLC-CCR8 cells, while the CCR8 red fluorescence signal was weaker in wild-type LLC cells (C). Figure 7 D).

[0053] The Western blot, flow cytometry, and immunofluorescence results above sufficiently demonstrate the successful construction of the overexpression model. Finally, the identified normal cells were cryopreserved for preservation, and the CCR8 overexpressing cell line LLC-CCR8 was successfully constructed for subsequent nucleic acid aptamer binding capacity and targeting verification experiments.

[0054] Example 6: Nucleic acid aptamers labeled with cyanine dye groups Nucleic acid aptamer Gtl-4-1 and the initial library (the same initial library as described in Example 1) were labeled with cyanine dyes Cy3, Cy5, and Cy5.5, respectively. The dissolved activated esters of each dye (dissolved in dimethyl sulfoxide (DMSO), 10 equivalents) were added to the amino-terminated aptamers, and an appropriate amount of carbonate buffer was added. The mixture was sonicated until completely dissolved. The reaction was carried out at 25°C in the dark for 1 hour. After the reaction, the aptamers and library sequences labeled with Cy3, Cy5, and Cy5.5 were obtained by HPLC purification.

[0055] Flow cytometry was used to analyze the LLC-CCR8 cells constructed in Example 5 using Cy5-labeled aptamers. LLC-CCR8 cells (1×10⁶ cells) were digested and collected using enzyme-free digestion buffer (purchased from Beijing Solarbio Science & Technology Co., Ltd.). 7Cells were washed twice with washing buffer (cells / tube). They were then resuspended in binding buffer, and Cy5-labeled Gtl-4-1 and the initial Cy5-labeled library (as described in Example 1) were added to a final concentration of 200 nM. The cells were then incubated together at 4°C in the dark for 30 min. After incubation, the cells were washed three more times with washing buffer.

[0056] like Figure 8 As shown in Figure A, LLC-CCR8 cells all expressed fluorescent protein (GFP), demonstrating good lentiviral infection and selection effects; simultaneously, as Figure 8 As shown in Figure B, in the allophycocyanin (APC) channel, compared with the Cy5-labeled initial library control group, the flow cytometry fluorescence peak of Cy5-labeled Gtl-4-1 after incubation with LLC-CCR8 cells was significantly shifted to the right, indicating that Gtl-4-1 can bind to CCR8 overexpressing cells. In contrast, Cy5-labeled Gtl-4-1 showed only a weak fluorescence signal after incubation with wild-type LLC cells, and this signal was significantly lower than that of the LLC-CCR8 cell group.

[0057] The above results indicate that Gtl-4-1 can recognize and bind to LLC-CCR8 cells overexpressing CCR8, further supporting its good binding specificity to CCR8 on the cell surface.

[0058] Example 7: Confocal fluorescence staining of nucleic acid aptamers labeled with cyanine dye groups Confocal imaging was performed on LLC-CCR8 cells constructed in Example 5 using the Cy3-labeled nucleic acid aptamers from Example 6. LLC-CCR8 cells (1×10⁶) were digested and collected using enzyme-free digestion buffer (purchased from Beijing Solarbio Science & Technology Co., Ltd.). 7 Cells (per tube) were washed twice with washing buffer. They were then resuspended in binding buffer, and Cy3-labeled aptamer Gtl-4-1 and the initial Cy3-labeled library (as described in Example 1) were added to a final concentration of 200 nM for both. The cells were incubated together at 4°C in the dark for 30 min. After incubation, the cells were washed three more times with washing buffer. The cell samples were then observed and analyzed under a confocal laser scanning microscope.

[0059] The results are as follows Figure 9As shown in Figure A, confocal fluorescence imaging results revealed that Cy3-labeled Gtl-4-1 exhibited a strong red fluorescence signal on the surface of LLC-CCR8 cell membranes, primarily distributed around green fluorescent protein (GFP)-positive cells. The red fluorescence and GFP-green fluorescence in the combined image showed significant spatial overlap, and fluorescence intensity distribution analysis revealed good consistency between their signal peaks. In contrast, Figure 9 Only a weak red fluorescence signal of Gtl-4-1 was observed in wild-type LLC cells in group B. These results indicate that Gtl-4-1 can specifically recognize and bind to CCR8 on the surface of LLC-CCR8 cells, further supporting its good specific targeting and binding ability to CCR8 at the cellular level.

[0060] Example 8: Detection of CCR8 protein expression in tumor tissue To verify the expression of the CCR8 target in the real tumor microenvironment, LLC, CMT-167, and Kras were used respectively. G12D / TP53 - / - Kras G12D / LKB1 - / - A mouse subcutaneous xenograft model was established using mouse lung cancer cells. Specifically, LLC, CMT-167, and Kras cells in the logarithmic growth phase were used. G12D / TP53 - / - Kras G12D / LKB1 - / - Cells were digested and resuspended in sterile PBS. Take 100 μL of cell suspension (containing 5 × 10⁶ cells / mL). 5 (1 cell) was injected subcutaneously into the right shoulder of 6-week-old C57 mice (6-week-old C57BL / 6 mice used in the experiment were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) to establish a subcutaneous xenograft model. Tumor size was measured periodically using calipers, and tumor volume was calculated using the formula: 0.5 × length × width. 2 Calculations will be performed when the tumor volume grows to 250–500 mm. 3 Mice were euthanized, and tumor tissue, spleen, and lymph nodes were dissected for subsequent flow cytometry and Western blotting.

[0061] (1) Flow cytometry detection of CCR8 + Treg cell infiltration Tumor tissue, spleen, and lymph nodes were isolated from tumor-bearing mice, as well as lymph nodes from normal mice. For tumor tissue, digestion was performed at 37°C for 45 minutes using a digestion solution containing 0.5 mg / mL type IV collagenase and 0.15 mg / mL deoxyribonuclease I (DNase I), both purchased from Beijing Solarbio Science & Technology Co., Ltd. Red blood cells were then removed using erythrocyte lysis buffer (purchased from Beijing Solarbio Science & Technology Co., Ltd.) to prepare a single-cell suspension. For spleen tissue, red blood cells were removed after grinding, and a single-cell suspension was prepared by adding erythrocyte lysis buffer. For lymph nodes, single-cell suspensions were prepared directly by grinding. All single-cell suspensions were filtered through a 70 μm cell sieve (purchased from Solarbio Science & Technology Co., Ltd.). The cell concentration was adjusted to 10-1. 7 Cells were stained at a density of 1 / mL for subsequent staining. Cells were incubated with Zombie NIR™ fixative dye (Biolegend) at room temperature in the dark for 20 min, washed with pre-chilled PBS, and centrifuged at 300×g for 5 min. Then, CD16 / CD32 (Biolegend) was added and incubated on ice for 10 min. Surface staining antibody (Biolegend) was added and incubated on ice in the dark for 20 min, followed by washing with pre-chilled PBS, centrifuging at 300×g for 5 min, and discarding the supernatant. After surface staining, cells for nuclear staining were incubated at room temperature in nucleation buffer (True-Nuclear™ Fix buffer, Biolegend) in the dark for 45–60 min, then stained with FOXP3 staining antibody at room temperature for 30 min, and washed three times with buffer. Cells were then resuspended in 500 μl of cell buffer (Biolegend) for analysis.

[0062] The results are as follows Figure 10 As shown in the flow cytometry scatter plot of A, CCR8 was successfully delineated in tumor tissue gating. + The cell population. Subsequent quantitative statistical results are as follows: Figure 10 As shown in Figure B, CCR8 in the tumor tissue + Treg cells accounted for approximately 60% of all Treg cells, significantly higher than in the spleen and draining lymph nodes (LN) tissues; furthermore, CCR8 was present in the spleen and draining lymph nodes (LN) tissues. + The proportions of Treg cells were all at low levels, below 15%. Statistical analysis results showed that CCR8 was present in tumor tissue. + The proportion of Treg tissue was significantly higher than that of the corresponding non-tumor tissues, and the difference was statistically significant (****, p<0.0001).

[0063] (2) Western blot analysis of total CCR8 protein expression in tumor tissue LLC, CMT-167, Kras G12D / TP53 - / - Kras G12D / LKB1 - / - Tumor tissue (including LLC, CMT-167, Kras) G12D / TP53 - / - Kras G12D / LKB1 - / - All cells were mouse lung adenocarcinoma cell lines. The LLC cell line was purchased from the American Type Culture Collection (ATCC), the CMT-167 cell line was purchased from Shanghai Yaji Biotechnology Co., Ltd., and the Kras cell line... G12D / TP53 - / - Kras G12D / LKB1 - / - Cell lines were purchased from the Central Laboratory of Shanghai Pulmonary Hospital affiliated with Tongji University. Cells were flash-frozen in liquid nitrogen and lysed using RIPA lysis buffer (purchased from Shanghai Yamei Biotechnology Co., Ltd.). Proteins were extracted and analyzed by Western blotting. Tumor proteins obtained from different tumor tissues were mixed with loading buffer and denatured at 90°C for 15 min, with the total protein loading controlled at 80 μg. Proteins were separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel (80V, 10 min, 120V, 60 min; gel preparation kit purchased from Shanghai Yamei Biotechnology Co., Ltd.). The proteins were transferred to a 0.45 μm nitrocellulose membrane (NC membrane, purchased from Shanghai Yamei Biotechnology Co., Ltd.), blocked with protein-free rapid blocking buffer (purchased from Shanghai Yamei Biotechnology Co., Ltd.), and further incubated with rabbit anti-mouse CCR8 antibody (purchased from Wuhan Aibotek Biotechnology Co., Ltd.). After further incubation with goat anti-rabbit secondary antibody containing HRP (horseradish peroxidase) (purchased from Shanghai Beyotime Biotechnology Co., Ltd.), the proteins were washed with TBST (purchased from Shanghai Yamei Biotechnology Co., Ltd.) and finally detected by chemiluminescence imaging using ECL ultrasensitive developing solution (purchased from Shanghai Yamei Biotechnology Co., Ltd.). Figure 10 As shown in C, LLC, CMT-167, Kras G12D / TP53 - / - Kras G12D / LKB1 - / - A 41 kDa CCR8 protein band was detected in tissues from all four non-small cell lung cancer models, and as... Figure 10 The quantitative statistical plot of D shows that there is no significant difference (ns) in the relative expression level of protein among the four models, indicating that CCR8 is generally highly expressed in the lung cancer immune microenvironment.

[0064] Example 9: Specific targeting imaging of nucleic acid aptamer Gtl-4-1 in tumor-bearing mice To further verify the in vivo targeting ability of nucleic acid aptamers, small animal in vivo IVIS fluorescence imaging and radionuclide PET / CT imaging experiments were performed using Gtl-4-1.

[0065] (1) Model building LLC tumor cells with a pre-validated CCR8 tumor microenvironment, as determined by Western blot analysis, were pre-passaged. Cells in logarithmic growth phase were collected, digested, and resuspended in sterile PBS. 100 μL of the cell suspension (containing 5 × 10⁻⁶ cells / mL) was then used. 5 (1 cell) was injected subcutaneously into the right shoulder of 6-week-old C57 mice (6-week-old C57BL / 6 mice used in the experiment were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) to establish a subcutaneous xenograft model. Tumor size was measured periodically using calipers, and tumor volume was calculated using the formula: 0.5 × length × width. 2 Calculations will be performed when the tumor volume grows to 250–500 mm. 3 This is used for subsequent in vivo imaging experiments.

[0066] (2) In vivo IVIS fluorescence imaging of small animals The successfully constructed LLC tumor-bearing mice (6-week-old C57BL / 6 mice used in the experiment were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were prepared and injected via tail vein with 1 OD of Cy5.5-labeled Gtl-4-1 and the initial Cy5.5-labeled library sequence as a control (Cy5.5 - initial library, where the initial library is the initial library described in Example 1). Thirty minutes after injection, the mice were completely anesthetized with mixed oxygen containing 2.5% isoflurane and placed in an IVIS fluorescence imaging system for fluorescence imaging.

[0067] In vivo imaging results as follows Figure 11 As shown in Figure A, Cy5.5-labeled Gtl-4-1 exhibits significant fluorescence enrichment at the subcutaneous tumor site. The fluorescence imaging results of ex vivo tissues and organs are as follows... Figure 11 As shown in Figure B, the enrichment of the probe in different organs and tumor tissues was further confirmed. Quantitative analysis of the region of interest showed that the total radiation efficiency of the Cy5.5-Gtl-4-1 tumor region was significantly higher than that of the Cy5.5-initial library negative control group, and the difference was statistically significant (****, p<0.0001; Figure 11 (C), indicating that Gtl-4-1 can accumulate at the tumor site in tumor-bearing mice.

[0068] In vitro organ fluorescence imaging and quantitative analysis showed that the total radiation efficiency of Cy5.5-Gtl-4-1 was significantly increased in tumor tissues, and the signals observed in the liver and kidneys may be related to probe metabolism and clearance. These results indicate that Gtl-4-1 can preferentially accumulate at tumor sites in tumor-bearing mice and exhibits good tumor targeting ability.

[0069] (3) Radionuclide PET / CT imaging Fifteen LLC tumor-bearing mice were prepared and injected with 150 μCi of [a specific drug] via the tail vein. 68 Ga and 18 F-labeled nucleic acid aptamers ( 68 Ga-NOTA-Gtl-4-1 and 18 F-FT-Gtl-4-1). At a specific time point after injection ( 68 Ga-NOTA-Gtl-4-1 is available in 30, 60, 120, and 240 minute durations. 18 F-FT-Gtl-4-1 was performed for 30, 60, and 120 minutes. Mice were anesthetized with a mixture of oxygen containing 3% isoflurane. The anesthetized mice were then placed in a PET / CT imaging device to record imaging results at different time points. PET / CT results of six LLC tumor-bearing mice (M1-M6) were presented. Figure 12 A, 12B) show, 68 Ga and 18 F-labeled radioactive molecular imaging probe 68 Ga-NOTA-Gtl-4-1 18 F-FT-Gtl-4-1 showed significant tumor radioactivity concentration within 30 minutes after injection. The changes in %ID / g and T / M ratio over time are shown below. Figure 12 C and Figure 12 As shown in E; 18 The quantitative results of the %ID / g and T / M ratio of the F-labeled probe are as follows: Figure 12 D and Figure 12 As shown in F. 30 minutes after injection, 68 Ga-NOTA-Gtl-4-1 has an %ID / g of over 2% and a T / M ratio close to 30; 18 The T / M ratio of F-FT-Gtl-4-1 also rapidly increased to over 10 within one hour. These results demonstrate that both radionuclide-labeled probes can achieve rapid, high-contrast tumor-targeted imaging. 68 Ga-NOTA-Gtl-4-1 showed a high contrast between tumor and muscle at an early time point.

[0070] Example 10: Determination of the affinity of nucleic acid aptamer Gtl-4-1 for CCR8 on the surface of tumor tissue cells To further evaluate the binding affinity of nucleic acid aptamers at the cellular level in the real tumor microenvironment, tumor tissue dissociation and flow cytometry analysis were performed on the LLC tumor-bearing mouse model shown to have significant uptake by in vivo imaging in Example 9.

[0071] Mice were euthanized by cervical dislocation, and tumor tissue was rapidly dissected. The tissue was digested for 45 minutes at 37°C using a digestion solution containing 0.5 mg / mL type IV collagenase and 0.15 mg / mL deoxyribonuclease I (DNase I), both purchased from Beijing Solarbio Science & Technology Co., Ltd. The tissue was then filtered through a 70 μm cell sieve (purchased from Beijing Solarbio Science & Technology Co., Ltd.) to prepare a single-cell suspension, and the cell concentration was adjusted to 1 × 10⁻⁶ cells / mL. 7 per mL.

[0072] Take the cell suspension described above and add a series of gradient concentrations (0, 5, 20, 50, 80, 100, 200, 300 nM) of FITC-labeled nucleic acid aptamer Gtl-4-1, ensuring a total incubation volume of 100 μL for each incubation. Incubate at 4°C in the dark for 30 minutes. After incubation, wash the cells three times with phosphate-buffered saline (PFS) to remove non-specifically bound aptamers. Finally, resuspend the cells in PFS to a loading volume of 500 μL, and obtain and analyze the fluorescence intensity of the sample using flow cytometry.

[0073] A nonlinear regression was performed with nucleic acid aptamer concentration on the x-axis and the corresponding percentage of average fluorescence intensity on the y-axis. The predicted secondary structure of Gtl-4-1 is as follows: Figure 13 As shown in Figure A, the ring structure formed by the enrichment of G bases provides a molecular basis for targeted binding; in affinity assays, such as Figure 13 As shown in Figure B, after nonlinear regression fitting, the Kd value of Gtl-4-1 measured at the single-cell suspension level of real tumor tissue from tumor-bearing mice was 16.60 ± 1.74 nM. This result is highly consistent with the Kd value (20.60 nM) measured based on CCR8 protein in Example 4, further confirming that Gtl-4-1 has a high binding affinity for the CCR8 target protein in the complex real tumor cell environment.

[0074] Example 11: Validation of the ability of Gtl-4-1 aptamer ELISA to detect CCR8-related signals in mouse tissue samples To verify the in vitro detection capability of the nucleic acid aptamer Gtl-4-1, this embodiment establishes a CCR8 detection method based on an antibody targeting CCR8, tumor, lung, and muscle tissue lysates, peripheral blood leukocyte lysates from tumor-bearing mice, peripheral blood leukocyte lysates from normal mice, a detection probe composed of biotin-labeled nucleic acid aptamer Gtl-4-1, and an SA-HRP / TMB (streptavidin-horseradish peroxidase conjugate / tetramethylbenzidine) colorimetric system. The antibody targeting CCR8 used in this embodiment was purchased from Wuhan Aibotek Biotechnology Co., Ltd. The tumor tissue lysate, muscle tissue lysate, lung tissue lysate, peripheral blood leukocyte lysate from tumor-bearing mice, and peripheral blood leukocyte lysate from normal mice were all derived from the mouse model described in Example 8. The specific process was as follows: First, tumor tissue, muscle tissue, and lung tissue from tumor-bearing mice were separated. All tissues were digested at 37°C for 45 minutes using a digestive solution containing 0.5 mg / ml type IV collagenase and 0.15 mg / ml deoxyribonuclease I (DNase I), purchased from Beijing Solarbio Biotechnology Co., Ltd. Then, erythrocyte lysate (purchased from Beijing Solarbio Biotechnology Co., Ltd.) was added to remove erythrocytes, thus preparing tumor tissue lysate, muscle tissue lysate, and lung tissue lysate. For peripheral blood from tumor-bearing mice and normal mice, erythrocyte lysate was directly added at three times the blood volume to remove erythrocytes, thus preparing peripheral blood leukocyte lysate from tumor-bearing mice and peripheral blood leukocyte lysate from normal mice.

[0075] The CCR8 antibody was diluted to 1 μg / mL using phosphate-buffered saline (PBS), and 100 μL was added to each well of an ELISA plate. The plate was incubated overnight at 4°C. After washing with PBST (phosphate-buffered saline containing 0.5% Tween-20, purchased from Shanghai Beyotime Biotechnology Co., Ltd.), blocking buffer was added, and the plate was blocked at 37°C for 2 hours. After blocking, lysates of tumor tissue, muscle tissue, lung tissue, and peripheral blood leukocytes from normal mice and tumor-bearing mice were added, and the plates were incubated at 37°C for 1.5 hours before washing. Subsequently, a renatured 100 nM Biotin-Gtl-4-1 detection probe was added and incubated on a shaker at room temperature for 30 minutes to allow it to bind to the captured CCR8. After washing the plate, streptavidin-horseradish peroxidase (SA-HRP, purchased from Shanghai Beyotime Biotechnology Co., Ltd.) working solution was added and incubated at 37°C in the dark for 30 minutes. After thorough washing, TMB chromogenic solution (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) was added for color development, and the reaction was terminated with a stop solution. Finally, the OD450 absorbance value was measured.

[0076] Results of enzyme-linked immunosorbent assay (ELISA) chromogenic plate: Figure 14 A and Figure 14As shown in Figure B, after adding TMB chromogenic solution, a significant difference in color intensity was observed between tumor tissue lysate and peripheral blood leukocyte samples from tumor-bearing mice and normal tissue samples; even after adding TMB chromogenic stop solution, the color differences between the samples remained clearly visible. ELISA results are as follows: Figure 14 C and Figure 14 As shown in Figure D, the OD450 values ​​of tumor tissue lysate samples were approximately 0.7–0.8, significantly higher than those of lung and muscle tissues, whose OD450 values ​​were both approximately 0.5. The differences were statistically significant (p<0.0001). Figure 14 C); Meanwhile, the OD450 value of peripheral blood leukocytes in tumor-bearing mice was approximately 0.5, which was significantly higher than the value of peripheral blood leukocytes in normal mice, which was approximately 0.3. The difference was statistically significant (****, p<0.0001). Figure 14 D).

[0077] The above results indicate that the aptamer ELISA detection system based on Gtl-4-1 can detect differential CCR8-related binding signals in different biological samples, and can distinguish between tumor tissues and corresponding non-tumor tissues, as well as peripheral blood leukocyte samples from tumor-bearing mice and normal mice, further supporting the application potential of Gtl-4-1 as a CCR8 detection probe.

Claims

1. A nucleic acid aptamer targeting CCR8, characterized in that, The nucleic acid aptamer is a single-stranded DNA with a nucleotide sequence as shown in SEQ ID NO:

15.

2. A nucleic acid aptamer derivative that specifically targets CCR8, characterized in that, The nucleic acid aptamer derivative is obtained by modifying the nucleic acid aptamer according to claim 1, wherein the modification is selected from isotope markers or fluorescent markers; the isotope markers include radioactive isotopes used for imaging; the fluorescent markers include fluorescent dyes used for in vivo optical imaging, flow cytometry analysis or laser confocal microscopy imaging.

3. The nucleic acid aptamer derivative according to claim 2, characterized in that, The nucleic acid aptamer derivative is characterized by having an isotope label or fluorescent label at the 5' or 3' end of the nucleic acid aptamer; the isotope label is selected from radioactive isotopes of halogens, radioactive isotopes of transition metals, radioactive isotopes of main group metals, and radioactive isotopes of lanthanides and actinides; wherein, the radioactive isotopes of halogens are linked to the nucleic acid aptamer via click chemistry, and the radioactive isotopes of transition metals, main group metals, and lanthanides and actinides are chelated to the nucleic acid aptamer via metal chelation; the fluorescent label is selected from Cy3, Cy5, Cy5.5, Cy7, indocyanine green, fluorescein isothiocyanate, allophycocyanin, and Alexa Fluor series dyes.

4. The use of a nucleic acid aptamer derivative according to claim 2 in the preparation of a reagent for targeting tumors with high CCR8 expression, tumor microenvironment, and other in vivo immune cell molecular imaging.

5. The application of the nucleic acid aptamer derivative according to claim 2 in the preparation of a kit for detecting CCR8.

6. A detection reagent for detecting CCR8 protein or CCR8-positive cells, characterized in that, The detection reagent comprises the nucleic acid aptamer derivative as described in claim 2.

7. A method for detecting CCR8 for non-disease diagnostic purposes, characterized in that, The in vitro test sample was mixed and incubated with the nucleic acid aptamer derivative described in claim 2, and the binding signal was detected. The in vitro test samples include CCR8 transfected cells, CCR8 positive immune cells, or CCR8 positive regulatory T cells derived from tumor tissue; The detection was performed by flow cytometry, confocal fluorescence imaging, enzyme-linked immunosorbent assay (ELISA), or PET / CT or SPECT / CT imaging.

8. An imaging formulation for targeting CCR8-positive cells on the surface of immune cells in the tumor microenvironment for non-disease diagnostic purposes, characterized in that, The imaging formulation comprises the nucleic acid aptamer derivative of claim 2, and a pharmaceutically acceptable carrier.

9. A reagent product for cell sorting or enrichment, characterized in that, It includes the nucleic acid aptamer derivative as described in claim 2.

Images