An artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flow redistribution and application thereof

Abstract

The application provides an artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flow redistribution and application thereof, and belongs to the technical field of biological nitrogen fixation. The artificial non-coding RNA module comprises, in sequence, a promoter element P crcZ as shown in SEQ ID NO: 3 and an artificial non-coding RNA functional element ApiR- phbA as shown in SEQ ID NO: 1. The artificial non-coding RNA module provided by the application specifically recognizes and binds to the 5'-untranslated region of the mRNA of an acetyl-CoA thiolase coding gene phbA , and regulates the expression thereof at a post-transcriptional level, thereby realizing directional regulation of the PHB metabolic pathway of rhizobium, significantly improving the symbiotic nitrogen fixation efficiency of a chassis strain, and further improving the growth-promoting ability and nodulation ability of the chassis strain on a host soybean.

Description

Technical Field

[0001] This invention belongs to the field of biological nitrogen fixation technology, and in particular relates to an artificial non-coding RNA module that enhances rhizobium symbiotic nitrogen fixation based on carbon metabolic flow redistribution and its application. Background Technology

[0002] Polyhydroxybutyrate (PHB) is a crucial carbon source and energy reserve in rhizobia, playing a central regulatory role in their carbon metabolism. The dynamic balance between its synthesis and degradation maintains cellular carbon metabolism and energy homeostasis. Existing research indicates a competition for energy and reducing power between PHB synthesis and accumulation and the nitrogen fixation pathway within rhizobia. Given that symbiotic nitrogen fixation is a highly energy-intensive physiological process, energy allocation has a decisive impact on nitrogen fixation efficiency. Therefore, regulating PHB synthesis has become a core strategy for enhancing the symbiotic nitrogen fixation capacity of rhizobia. However, traditional genomic modification techniques such as gene knockout often lead to an imbalance in the carbon and nitrogen metabolism of strains, thereby weakening their symbiotic nitrogen fixation capacity. This phenomenon fully reveals the crucial role of PHB metabolism in maintaining carbon and nitrogen homeostasis in rhizobia. Therefore, improving symbiotic nitrogen fixation efficiency urgently requires precise and reversible dynamic regulation of the PHB synthesis pathway, rather than simple gene deletion.

[0003] Artificial non-coding RNAs (ANRNAs), with their characteristics of "strong targeting, reversible regulation, and fine-tuning," can specifically regulate the expression of target genes at the post-transcriptional level without altering the genome structure. Based on this, designing ANRNA modules involved in the fine-tuning of the PHB synthesis pathway not only provides a new technical pathway for optimizing the regulation of the PHB synthesis pathway and improving the efficiency of symbiotic nitrogen fixation, but also provides important technical support for constructing efficient and stable artificial symbiotic nitrogen fixation systems. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide an artificial non-coding RNA module that enhances rhizobium symbiotic nitrogen fixation based on carbon metabolic flux redistribution and its application; the artificial non-coding RNA module provided by this invention specifically recognizes and binds to the gene encoding acetyl-CoA thiolase, a key enzyme in PHB synthesis. phbA The 5'-untranslated region (5'-UTR) of mRNA regulates its expression at the posttranscriptional level, thereby achieving targeted regulation of the PHB metabolic pathway in rhizobia.

[0005] This invention provides an artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flux redistribution, comprising sequentially linked promoter elements P crcZ and artificial noncoding RNA functional element ApiR- phbA The artificial non-coding RNA functional element ApiR-phbA The sequence is shown in SEQ ID NO:1; the promoter element P crcZ The sequence is shown in SEQ ID NO:3.

[0006] Preferably, the artificial non-coding RNA functional element ApiR- phbA The encoding gene is shown in SEQ ID NO: 2.

[0007] This invention provides a recombinant expression vector for expressing the aforementioned artificial non-coding RNA module.

[0008] Preferably, pBBR1MCS-2 is used as the initial vector, and the artificial non-coding RNA module is obtained by cloning it into the multiple cloning site of the initial vector.

[0009] The present invention provides a recombinant expression strain that expresses the aforementioned artificial non-coding RNA module.

[0010] Preferred, *Rhizobium fischeri* (F. Fischer) Sinorhizobium fredii CCBAU 45436 is a chassis strain. The recombinant expression vector is transferred into the chassis strain to obtain a recombinant expression strain.

[0011] This invention provides the application of the aforementioned artificial non-coding RNA module in reducing the synthesis of PHB in nitrogen-fixing bacteria.

[0012] This invention provides the application of the aforementioned artificial non-coding RNA module in enhancing the biological nitrogen fixation capacity of chassis strains.

[0013] This invention provides the application of the artificial non-coding RNA module, the recombinant expression vector, and the recombinant expression strain in biological nitrogen fixation.

[0014] Preferably, the artificial non-coding RNA module can enhance the growth-promoting and nodulation abilities of the recombinant expression strain when it coexists with soybean.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flux redistribution, comprising sequentially linked promoter elements P crcZ and artificial noncoding RNA functional element ApiR- phbA hereinafter referred to as P crcZ ApiR- phbA The mechanism by which the artificial non-coding RNA module regulates PHB synthesis and enhances the efficiency of symbiotic nitrogen fixation by chassis microorganisms is as follows: ApiR- phbA By linking the gene encoding acetyl-CoA thiolase, a key enzyme in the PHB synthesis pathway. phbAInteractions with the 5'-UTR region of mRNA inhibit phbA The translation process of mRNA inhibits the synthesis of PHB, allowing the energy and reducing power originally used for PHB storage to be transferred to the biological nitrogen fixation pathway, thereby significantly enhancing the symbiotic nitrogen fixation capacity of chassis microorganisms.

[0016] The present invention also constructed a recombinant expression vector pBBR-P expressing the artificial non-coding RNA module. crcZ ::ApiR- phbA The recombinant expression vector was transferred into the model chassis strain *Rhizobium fischeri* (F. Fischer). Sinorhizobium fredii A recombinant expression strain was obtained from CCBAU 45436.

[0017] Experiments have confirmed that, under conditions of symbiotic nodulation between rhizobia and soybean, the RNA regulatory module P of this invention... crcZ ApiR- phbA It can affect the PHB synthesis of the chassis strain and significantly improve the symbiotic nitrogen fixation efficiency of the chassis strain. Compared with the chassis strain, the nitrogenase activity of the recombinant expression strain is significantly increased by 23.9%. The growth-promoting ability and nodulation ability of the recombinant expression strain on the host soybean are significantly improved by 9.06% and 48.9%, respectively. Attached Figure Description

[0018] Figure 1 For artificial non-coding RNA module P crcZ ::ApiR- phbA Construction of recombinant expression vectors; the direction of gene transcription is indicated by arrows in the diagram, where 'a' is a schematic diagram of the construction of an artificial RNA module expression vector, and the insertion site is... Bam HI and Hin dШ; b is the expression vector pBBR-P crcZ ::ApiR- phbA PCR verification of the constructed strain; c represents the recombinant engineered bacteria. S. fredii PCR validation of CCBAU45436 (pBBR-PcrcZ::ApiR-phbA).

[0019] Figure 2 The effect of artificial non-coding RNA module expression on the growth ability of chassis strains in TY total nutrient liquid medium.

[0020] Figure 3To compare the PHB synthesis capabilities of the chassis strain and the recombinant expression strain under symbiotic conditions, the following images are presented: (a) Transmission electron micrograph of PHB synthesis in the chassis strain cells 21 days after inoculation with soybean (symbiotic nitrogen fixation period); (b) Transmission electron micrograph of PHB synthesis in the recombinant expression strain cells 21 days after inoculation with soybean (symbiotic nitrogen fixation period); (c) Statistical comparison of the number of PHB particles in the cells of the chassis strain and the recombinant expression strain; and (d) Statistical comparison of the diameter of PHB particles in the cells of the chassis strain and the recombinant expression strain.

[0021] Figure 4 The study compared the symbiotic phenotypes of the chassis strain and the recombinant expression strain 21 days after soybean inoculation. Specifically, a) was a statistical comparison of the growth-promoting ability of the chassis strain and the recombinant expression strain on the host soybean; b) was a statistical comparison of the number of nodules in the chassis strain and the recombinant expression strain; c) was a statistical comparison of the fresh weight of nodules in the chassis strain and the recombinant expression strain; and d) was a statistical comparison of the nitrogenase activity in the chassis strain and the recombinant expression strain.

[0022] Figure 5 For artificial RNA element ApiR- phbA With the target phbA Results of mRNA binding ability identification. Detailed Implementation

[0023] This invention provides an artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flux redistribution, comprising sequentially linked promoter elements P crcZ and artificial noncoding RNA functional elements ( A rtificially P HBsynthesis- i nhibiting non-coding R NA, ApiR- phbA ApiR- phbA The artificial non-coding RNA functional element ApiR- phbA The sequence is shown in SEQ ID NO:1; the promoter element P crcZ The sequence is shown in SEQ ID NO:3.

[0024] In this invention, the artificial non-coding RNA functional element ApiR- phbA The encoding gene is shown in SEQ ID NO: 2.

[0025] In this invention, bioinformatics methods are used for analysis. S. fredii The gene encoding acetyl-CoA thiolase, a key enzyme in the PHB synthesis pathway in CCBAU 45436. phbA The promoter region was designed to contain [something related to] the stem ring. phbAThe artificial non-coding RNA element ApiR-, which is completely complementary to the 5'-UTR region of the mRNA. phbA Furthermore, a constitutive promoter element P was synthesized using artificial chemical synthesis methods. crcZ and artificial RNA element ApiR- phbA The control module P is connected in series crcZ ApiR- phbA .

[0026] The sequence is as follows: Artificial noncoding RNA functional element ApiR- phbA (SEQ ID NO:1): 5'CAUGGGACGUUUCCUCUUGUGCACAACAACAAUAAUCCACGGAUAAGACAAUAAGAACAAACACCAAAGUACGCAGCAAAACCUCGACAAGAUAACGGAUAAGCAGCUAACUGAUUCUUUUGGAGGACAUGCCACGGGGUUCGCCCCACGACCAGGCCGAGAACAACAAAAACGGCAUCGAGCAGGCC CUGCACUGGUUGGAUCGAAGAUCAAGGCAAUCUCAGCGACCAAACGGAUCCGUUUGCUAAUGGCUAAUACUGUAAAUGCGAUUUUAACGGCCACCGUCCGCAAGGACGCAUUAACAACAAGAACAGCAUGGCCUGAGAAGACCAAUAACAAUAAAUUUAGUCGCGACAUUAGCUACACGCGCAGCUUUUU-3' Artificial noncoding RNA functional element ApiR- phbA The encoding gene (SEQ ID NO:2): 5'CATGGGACGTTTCCTCTGTGCACAACAACAATAATCCACGGATAAGACAATAAGAACAAACACCAAAGTACGCAGCAAAACCTCGACAAGATAACGGATAAGCAGCTAACTGATTCTTTTGGAGAGGACATGCCACGGGGTTCGCCCCACGACCAGGCCGAGAACAACAAAAACGGCATCGAGCAGGCC CTGCACTGGTTGGATCGAAGATCAAGGCAATCTCAGCGACCAAACGGATCCGTTTGCTAATGGCTAATACTGTAAATGCGATTTTAACGGCCACGTCCGCAAGGACGCATTAACAACAAGAACAGCATGGCCTGAGAAGACCAATAACAATAAATTTAGTCGCGACATTAGCTACACGCGCAGCTTTTT-3' promoter element P crcZ (SEQ ID NO:3): 5'CCGGGTAATTTGTTACCGCCGGCGCATCGTTCGTAACAAAAACCGGGAGCATCGGTAACGACGCCCCGGTTTTTTCTTGCCTTCCGCCAAGCCTGGAAATCACAACTCATTGAAATATAACGATTTCCTAAAACTGGCACGGCAACTGCTTACCTAATG-3' The present invention does not impose any particular limitation on the preparation method of the artificial non-coding RNA module, and conventional preparation methods in the art can be used. In the specific implementation of the present invention, it is preferred to prepare it by artificial synthesis.

[0027] This invention provides a recombinant expression vector for expressing the aforementioned artificial non-coding RNA module.

[0028] In this invention, pBBR1MCS-2 is used as the initial vector, and the artificial non-coding RNA module is obtained by cloning it into the multiple cloning site of the initial vector; preferably, the artificial non-coding RNA module is cloned into... Bam HI and Hin Between dIII restriction sites. This invention does not specifically limit the preparation method of the recombinant expression vector; conventional restriction enzyme digestion and ligation methods in the art can be used.

[0029] The present invention provides a recombinant expression strain that expresses the aforementioned artificial non-coding RNA module.

[0030] In this invention, *Rhizobium fischeri* is preferred. Sinorhizobium fredii CCBAU 45436 is a chassis strain. The recombinant expression vector is transferred into the chassis strain to obtain a recombinant expression strain. More preferably, the recombinant expression vector is transferred into *Rhizobium fischeri* CCBAU 45436 via a triparental conjugation method. This invention does not specifically limit the triparental conjugation method; any triparental conjugation method known in the art can be used.

[0031] This invention provides the application of the aforementioned artificial non-coding RNA module in reducing the synthesis of PHB in nitrogen-fixing bacteria.

[0032] This invention provides the application of the aforementioned artificial non-coding RNA module in enhancing the biological nitrogen fixation capacity of chassis strains.

[0033] This invention provides the application of the artificial non-coding RNA module, the recombinant expression vector, and the recombinant expression strain in biological nitrogen fixation.

[0034] Preferably, the artificial non-coding RNA module can enhance the growth-promoting and nodulation abilities of the recombinant expression strain when it coexists with soybean.

[0035] Experiments in the examples demonstrate that, under conditions of symbiotic nodulation between rhizobia and soybean, the non-coding RNA regulatory module P of the present invention... crcZ ApiR- phbA It can affect the PHB synthesis of chassis strains and significantly improve the symbiotic nitrogen fixation efficiency of chassis strains.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, all experimental conditions are conventional conditions well known to those skilled in the art, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or those recommended by the manufacturer.

[0037] Example 1

[0038] Constructing the artificial non-coding RNA module fusion expression vector pBBR-P crcZ ::ApiR- phbA

[0039] (I) Experimental Methods: First, an artificial non-coding RNA regulatory module P with a full length of 538 bp was synthesized using artificial chemical synthesis methods. crcZ ::ApiR-phbA (Sequence SEQ ID NO:3+SEQ ID NO:2), its expression is controlled by an artificial promoter element of size 159 bp (SEQ ID NO:3); then this module and the expression vector pBBR1MCS-2 were respectively subjected to Bam HI and Hin dIII double digestion, using seamless cloning technology to transfer ApiR- phbA The fragment was inserted into the multiple cloning site of pBBR1MCS-2; the ligation product was transformed into E. coli by electroporation, and positive clones were selected for PCR verification to obtain the recombinant expression vector pBBR-P. crcZ ::ApiR- phbA The recombinant expression vector was transformed into *Rhizobium fischeri* CCBAU 45436 (in a chassis) via triparental conjugation with the helper plasmid pRK2013. The recombinant engineered strain was obtained through resistance screening and PCR verification.

[0040] (II) Experimental Results: The artificial RNA regulatory module P was obtained using artificial chemical synthesis methods. crcZ ::ApiR- phbA The full-length nucleic acid sequence was successfully obtained, and a recombinant expression vector and recombinant expression strain expressing an artificial non-coding RNA module were constructed. PCR sequencing confirmed the correctness of the fusion expression vector, which was named pBBR-P. crcZ ::ApiR- phbA Contains pBBR-P crcZ ::ApiR- phbA The recombinant expression strain was named S. fredii CCBAU 45436 (pBBR-P crcZ ::ApiR- phbA ).

[0041] Example 2

[0042] Analysis of the effect of artificial non-coding RNA regulatory module expression on the growth of chassis strains

[0043] (I) Experimental Methods

[0044] 1. Recombinant engineered strains S. fredii CCBAU 45436 (pBBR-P crcZ ::ApiR- phbA ) and wild-type strains S. fredii CCBAU 45436 was activated in TY liquid medium and incubated at 30 °C for 2 days; Centrifuge at 4000 rpm for 10 min, collect the bacterial cells, and wash the bacterial cells twice with physiological saline; 3. Suspend the bacterial cells in physiological saline and adjust the OD. 600 =1.0; 4. Add 270 μl of TY liquid culture medium to the wells of the Biosèreen instrument's dedicated plate, and add 30 μl of the corresponding OD medium to the corresponding wells. 600 A bacterial culture with an initial OD value of 1.0 results in an initial OD value of 1.0. 600 =0.1.

[0045] 5. The growth curve of the bacterial strain was detected using a Bioscreen instrument. The temperature was set at 30 ℃, and the incubation time was 3 days. The OD of the bacterial solution was measured every 1 hour. 600 value.

[0046] (II) Experimental Results: The growth curves of the recombinant expression strains in TY total nutrient liquid medium showed no significant difference from those of the wild-type strains, indicating that the expression of the artificial non-coding RNA module does not affect the normal growth of the chassis strains.

[0047] Example 3

[0048] Analysis of PHB synthesis capacity of recombinant strains under symbiotic conditions

[0049] (I) Experimental Methods

[0050] 1. Twenty-one days after inoculating soybeans with rhizobia, select fresh, well-grown rhizobia, quickly peel them off, and fix them in vacuum with 6% glutaraldehyde fixative (containing 0.1 M sodium dimethylarsenate) for 4 h. Repeat twice. 2.4 ℃, 1% OsO4 fixation for 8 h or overnight; 3. Dehydrate using a gradient of ethanol (50%-70%-90%-100%-100%-100%) for 20 min per gradient; infiltrate using resins with ethanol / resin ratios of 1:1 and 1:3, for 4 h per step; then polymerize by heating to 70℃ for 12 h. 4. Ultrathin sections were stained with uranium acetate and lead citrate and observed using a transmission electron microscope (Tecnai G2 SpiritBioTWIN).

[0051] 5. Use ImageJ software to analyze the transmission electron microscopy images, select five rhizobium cells on the diagonal of the images for statistical analysis, and count the number and diameter of PHB particles in the rhizobium cells.

[0052] (II) Experimental Results: Compared with the chassis strain, the recombinant expression strain showed a significant 31.8% decrease in the diameter of intracellular PHB particles and a 55.5% increase in the number of PHB particles; the expression of the artificial non-coding RNA module significantly affected the formation of PHB particles in the chassis strain. Figure 3 ).

[0053] Example 4

[0054] Symbiotic phenotype analysis of recombinant strains

[0055] (I) Experimental Methods

[0056] 1. Methods for determining growth-promoting and nodulation abilities: 21 days after inoculation of soybeans with rhizobia, the soybean root system was completely removed, rinsed thoroughly with deionized water, and cut 1 cm above the root collar. The root portion was then placed on sterile absorbent paper to remove surface moisture. The number of nodules per plant, the fresh weight of nodules, and the plant height (length from stem base to terminal bud) were recorded. All data are the mean ± standard deviation of five biological replicates.

[0057] 2. Determination of nitrogenase activity by acetylene reduction method: (1) Sample preparation: Place the complete root nodule system (including attached roots) in a pre-sterilized 120 mL serum bottle, replace the air in the bottle (remove 12 mL of gas and then inject an equal volume of high-purity acetylene), and seal the bottle mouth with an aluminum cap. (2) Reaction system: stand at 28 ℃ for 60 min, and draw 0.25 mL of headspace gas using an airtight syringe; (3) Chromatographic analysis: The amount of ethylene produced was quantitatively analyzed using a GC-9A gas chromatography system; (4) Enzyme activity calculation: Nitrogenase activity =

[0058] A 样 : Peak area of ​​ethylene detected by gas chromatography of the sample

[0059] A 标 Peak area of ​​standard ethylene gas

[0060] V 瓶 Total volume of the reaction flask

[0061] m 标 The amount / volume / mass of standard ethylene (determined based on the actual calibration unit).

[0062] V 进 Gas chromatography injection volume

[0063] W 鲜 Fresh weight of root nodules

[0064] t: The reaction time of the acetylene reduction reaction.

[0065] (II) Experimental Results: Compared with wild-type chassis strains, inoculation with recombinant expression strain 45436 (pBBR-P) resulted in better results. crcZ ::ApiR- phbA The expression of artificial non-coding RNA regulatory modules significantly increased soybean plant height by 9.06%, nodule count by 48.9%, and nitrogenase activity by 23.9%. This indicates that the expression of these modules can significantly improve the symbiotic nodule formation and nitrogen fixation efficiency between the chassis strain and soybean. Figure 4 (and Table 1).

[0066] Table 1. Effects of artificial non-coding RNA regulatory modules on nitrogen fixation efficiency of chassis strains

[0067] Example 5

[0068] Artificial RNA ApiR- phbA With the gene encoding the target acetyl-CoA thiolase phbA Identification of mRNA binding ability

[0069] (I) Experimental Methods

[0070] 1. RNA synthesis and labeling

[0071] The material was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The required length for this experiment is 28 bp. phbA The mRNA 5'-UTR sequence was used for 5' FAM fluorescent labeling as a target; a full-length 379 bp artificial ncRNA, ApiR-, was obtained through in vitro transcription. phbA Sequence, as a ligand; 2. Mixed reactions of target and ligand The concentration of FAM-labeled target mRNA was 200 nM, and the concentration of ligand RNA was 8 μM. The ligand RNA was diluted in half concentration gradients, and 10 μL was mixed with the same volume of target RNA. The mixed sample was then added to 16 standard-treated capillaries and allowed to stand for 5 min. 3. Measurement and data analysis of trace heat surges RNA modules were analyzed using the NT.115 instrument (NanoTemper Technologies GmbH). phbA The binding ability between mRNAs was analyzed and the dissociation constant Kd was calculated.

[0072] Kd= , Where [A] is the concentration of free fluorescent molecules, [L] is the concentration of free ligands, and [AL] is the concentration of the A and L complex.

[0073] (II) Experimental Results: Artificial noncoding RNA ApiR- phbA and phbA The thermophoretic fitting curves between mRNAs exhibited typical "S"-shaped curves, and with the constant kd = 0.753 ± 0.388 μM, this indicates that the artificial non-RNA ApiR- phbA and phbA There was a strong binding tendency between the mRNAs, and the artificial non-coding RNA ApiR- phbA It can interact with the target through complementary base pairing. phbA mRNA interaction ( Figure 5 ).

[0074] As can be seen from the above embodiments, the artificial non-coding RNA module provided by the present invention can achieve targeted regulation of the PHB metabolic pathway of rhizobium, significantly improve the symbiotic nitrogen fixation efficiency of chassis strains, and thus improve their ability to promote growth and nodulation of host soybean.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An artificial non-coding RNA module for enhancing rhizobium symbiotic nitrogen fixation based on carbon metabolic flux redistribution, characterized in that, Including sequentially connected promoter elements P crcZ and artificial noncoding RNA functional element ApiR- phbA The artificial non-coding RNA functional element ApiR- phbA The sequence is shown in SEQ ID NO:1; the promoter element P crcZ The sequence is shown in SEQ ID NO:

3.

2. The artificial non-coding RNA module according to claim 1, characterized in that, The artificial noncoding RNA functional element ApiR- phbA The encoding gene is shown in SEQ ID NO:

2.

3. A recombinant expression vector for expressing the artificial non-coding RNA module of claim 1 or 2.

4. The recombinant expression vector according to claim 3, characterized in that, Using pBBR1MCS-2 as the initial vector, the artificial non-coding RNA module was obtained by cloning it into the multiple cloning site of the initial vector.

5. A recombinant expression strain expressing the artificial non-coding RNA module of claim 1 or 2.

6. The recombinant expression strain according to claim 5, characterized in that, Rhizobium fischeri (Fish's rhizobium) Sinorhizobium fredii CCBAU 45436 is a chassis strain. The recombinant expression vector is transferred into the chassis strain to obtain a recombinant expression strain.

7. The use of the artificial non-coding RNA module according to claim 1 or 2 in reducing the synthesis of PHB in nitrogen-fixing bacteria.

8. The application of the artificial non-coding RNA module according to claim 1 or 2 in improving the biological nitrogen fixation ability of chassis strains.

9. The application of the artificial non-coding RNA module of claim 1 or 2, the recombinant expression vector of claim 3 or 4, and the recombinant expression strain of claim 5 or 6 in biological nitrogen fixation.

10. The application according to claim 9, characterized in that, The artificial non-coding RNA module can enhance the growth-promoting and nodulation abilities of recombinant expression strains when coexisting with soybeans.

Images