Microbial fermentation synthesis method of antibacterial peptide Cla-H and application of fermentation supernatant thereof

Abstract

The application discloses a microbial fermentation synthesis method of an antibacterial peptide Cla-H and application of fermentation supernatant of the antibacterial peptide. In the application, pichia pastoris GS115 is used as a host strain, a coding sequence of the antibacterial peptide Cla-H is cloned into a pPIC9K expression vector, and a recombinant pichia pastoris engineering bacterium is constructed; through optimization of a fermentation medium formula and fermentation parameters, fermentation culture is carried out in a 5L small fermentation tank, high-efficiency secretion expression of the antibacterial peptide Cla-H is realized through three stages of batch growth, glycerol feeding and methanol induction; after the fermentation is completed, fermentation supernatant is collected through centrifugation, the fermentation supernatant contains active antibacterial peptide Cla-H, can be directly used for inhibiting growth of fusarium graminearum and botrytis cinerea, and still maintains good bacteriostatic efficacy in a high-salt environment. The application has the advantages of simple operation, low cost and large-scale production, the fermentation supernatant can be directly applied to agricultural fungal disease prevention and control without complicated purification, application cost is reduced, industrialized transformation of the antibacterial peptide Cla-H is promoted, and the application has important practical application value.

Description

Technical Field

[0001] This invention belongs to the fields of microbial fermentation technology and antibacterial technology, specifically a method for the microbial fermentation synthesis of the antimicrobial peptide Cla-H and the application of its fermentation supernatant. Background Technology

[0002] Cla-H antimicrobial peptide is a C-terminal histidine-tagged Clavanin-AK variant with excellent antimicrobial activity and salt tolerance. It effectively inhibits the growth of common agricultural fungi such as Fusarium graminearum and Botrytis cinerea, making it a promising new active ingredient for green pesticides. Currently, the preparation of Cla-H antimicrobial peptide mainly employs chemical synthesis methods. While this method can yield high-purity products, it suffers from high synthesis costs, difficulties in large-scale production, and complex operations, limiting its industrial application. Microbial fermentation synthesis is the preferred method for large-scale production of antimicrobial peptides, offering advantages such as low cost, ease of operation, and scalability. Pichia pastoris GS115 is a commonly used host for exogenous protein expression, characterized by strong secretory expression capacity, well-developed post-translational modifications, and simple culture conditions, making it suitable for the efficient expression of antimicrobial peptides.

[0003] However, there are currently no reports on Pichia pastoris fermentation processes for Cla-H antimicrobial peptides. Constructing recombinant Pichia pastoris engineered strains that efficiently express Cla-H, optimizing fermentation parameters to achieve efficient secretion and expression of Cla-H antimicrobial peptides, and simultaneously ensuring the antibacterial efficacy of the fermentation supernatant, has become a key issue in promoting the industrial transformation of Cla-H antimicrobial peptides. Furthermore, existing antimicrobial peptide fermentation products often require complex separation and purification steps to obtain pure products, increasing application costs. Summary of the Invention

[0004] The purpose of this invention is to provide a microbial fermentation synthesis method for the antimicrobial peptide Cla-H and the application of its fermentation supernatant in order to solve the problems mentioned above.

[0005] The technical solution adopted in this invention is as follows: A method for microbial fermentation synthesis of the antimicrobial peptide Cla-H, comprising the following steps:

[0006] S1: The coding sequence of the Cla-H antimicrobial peptide was cloned into the pPIC9K expression vector to obtain the recombinant expression vector pPIC9K-Cla-H; after linearization of the recombinant expression vector, it was electroporated into Pichia pastoris strain GS115, and after G418 gradient screening, the high-copy recombinant Pichia pastoris engineered strain GS115-Cla-H (abbreviated as G-Cla-H) was obtained.

[0007] S2: Seed culture: Recombinant Pichia pastoris engineered strain G-Cla-H was inoculated into BMGY seed medium and cultured with shaking to obtain a secondary seed culture with good activity;

[0008] S3: Fermentation culture: The secondary seed culture was inoculated into BSM fermentation medium and fermented in a 5 L small fermenter. The fermentation process was carried out in batch growth stage, glycerol feeding stage and methanol induction stage. The fermentation parameters at each stage were controlled to achieve the secretion and expression of Cla-H antimicrobial peptide.

[0009] S4: Fermentation product collection: After fermentation, the fermentation supernatant is collected by centrifugation, which is the fermentation product containing Cla-H antimicrobial peptide.

[0010] In a preferred embodiment, in step S1, the coding sequence of the Cla-H antimicrobial peptide is shown in SEQ ID NO.1;

[0011] In the recombinant expression vector pPIC9K-Cla-H, the Cla-H coding sequence is placed downstream of the α-signal peptide to achieve secretory expression.

[0012] The concentration of G418 gradient screening was 0.25-4.0 mg / mL, and high-copy engineered bacteria that could grow normally on 2 mg / mL G418-YPD plates were obtained.

[0013] In a preferred embodiment, in step S2, the BMGY seed culture medium is formulated as follows: Yeastextract 10 g / L, Peptone 20 g / L, YNB 13.4 g / L, glycerol 10 mL / L, 0.1 mol / L potassium phosphate buffer (pH 6.0), and biotin 0.4 mg / L; the culture conditions are: 30 ℃, 240 r / min, shaking culture for 8-10 h, until the OD600 value of the bacterial culture reaches 2-6.

[0014] In a preferred embodiment, in step S3, the BSM fermentation medium is formulated as follows: 85% H3PO4 26.7 mL / L, CaSO4•2H2O 0.93 g / L, K2SO4 18.2 g / L, KOH 4.13 g / L, glycerol 50 g / L, MgSO4•7H2O 14.9 g / L, PTM1 trace element stock solution 4.35 mL / L, pH adjusted to 5.0; the PTM1 trace element stock solution (1L) is formulated as follows: CuSO4•5H2O 6.0 g, KI 0.08 g, MnSO4•H2O 3.0 g, Na2MoO4•2H2O 0.2 g, H3BO3 0.02 g, CoCl2•6H2O 0.5 g, ZnCl2 20 g, FeSO4•7H2O 65 g, biotin 0.2 g. g, 5 mL concentrated sulfuric acid.

[0015] In a preferred embodiment, the parameters for each fermentation stage in step S3 are controlled as follows:

[0016] ① Batch growth stage: After inoculation, culture at 30 ℃ for 20-24 h, adjust the stirring speed to 500-800 r / min, maintain dissolved oxygen (DO) ≥30% until glycerol is depleted and dissolved oxygen shows a sudden jump;

[0017] ② Glycerol feeding stage: After the dissolved oxygen jump, feed 50% glycerol solution containing PTM1 is added to maintain dissolved oxygen stability. Cultivate until the OD600 value of the bacterial culture reaches 180-220, then stop feeding.

[0018] ③ Methanol induction stage: Lower the temperature to 26 ℃, add methanol feed solution containing PTM1, maintain methanol concentration at 0.3%-0.5%, and induce culture for 96-144 h. During this period, add 15% Peptone feed solution periodically to supplement nitrogen source.

[0019] In a preferred embodiment, a method for microbial fermentation synthesis of the antimicrobial peptide Cla-H and the application of its fermentation supernatant are characterized in that: in step S4, the centrifugation conditions are: 4 ℃, 3000 r / min, centrifugation for 15 min, and the supernatant is collected; the supernatant can be further purified by secondary centrifugation to remove residual yeast cells.

[0020] In a preferred embodiment, a Cla-H antimicrobial peptide fermentation supernatant is prepared by the aforementioned microbial fermentation synthesis method of Cla-H antimicrobial peptide.

[0021] In a preferred embodiment, the microbial fermentation supernatant is used to inhibit Fusarium graminearum or Botrytis cinerea.

[0022] In a preferred embodiment, the application of the microbial fermentation supernatant includes its use in the preparation of agricultural antifungal agents.

[0023] In a preferred embodiment, the fermentation supernatant is at a salt concentration of 50 mM and a pH of 1×10⁻⁶. 6 Even with high spore counts of CFU / mL, it can still completely inhibit the growth of Fusarium graminearum and Botrytis cinerea within 48 hours; it can be used for preventive control of fungal diseases in crops such as wheat and tomatoes, with a spraying dosage of 10 mL / plant.

[0024] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0025] 1. In this invention, a high-copy recombinant Pichia pastoris engineered strain G-Cla-H was constructed. The Cla-H coding sequence was placed downstream of the α-signal peptide, which achieved efficient secretory expression of the Cla-H antimicrobial peptide. The antimicrobial peptide activity in the fermentation supernatant was stable, and it could be directly applied without complicated purification, which significantly reduced the application cost.

[0026] 2. In this invention, the fermentation medium formulation and fermentation parameters were optimized, and the key control conditions for the three stages of batch growth, glycerol feeding, and methanol induction were clarified. A small-scale fermentation of Cla-H antimicrobial peptides was achieved using a 5 L small fermenter, and the bacterial effluent OD... 600 The value can reach 180-220, with high fermentation efficiency, providing technical parameters and theoretical support for subsequent industrial-scale production.

[0027] 3. In this invention, the fermentation supernatant has good antibacterial effect. It can effectively inhibit the growth of Fusarium graminearum and Botrytis cinerea in a high-salt environment. It also has a fast bactericidal speed and is not easy to induce drug resistance. It can be directly used for the prevention and control of agricultural fungal diseases. It is easy to operate, low in cost, and suitable for large-scale application.

[0028] 4. In this invention, Pichia pastoris is used as the host strain, which has simple culture conditions and is environmentally friendly. No toxic or harmful substances are produced during the fermentation process, which is in line with the concept of green production. This promotes the industrial transformation of Cla-H antimicrobial peptides and has important economic and social value. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of PCR detection of the genome of a G-Cla-H positive clone of yeast engineered bacteria in this invention;

[0030] Figure 2 This is a schematic diagram of Tricine-Tris-SDS-PAGE detection of the antimicrobial peptide Cla-H synthesized by engineered bacteria G-Cla-H in this invention;

[0031] Figure 3 This is a schematic diagram illustrating the detection of the antibacterial efficacy of the fermentation supernatant of the engineered yeast G-Cla-H against Fusarium graminearum at the cellular level in this invention.

[0032] Figure 4 This is a schematic diagram illustrating the detection of the antibacterial efficacy of the fermentation supernatant of the engineered yeast G-Cla-H against Botrytis cinerea at the cellular level in this invention.

[0033] Figure 5 This is a schematic diagram illustrating the phenotypic observation of the antibacterial effect of the fermentation supernatant of the engineered yeast G-Cla-H on Fusarium graminearum in live wheat in this invention.

[0034] Figure 6This is a schematic diagram illustrating the phenotypic observation of the antibacterial effect of the fermentation supernatant of the engineered yeast G-Cla-H on live tomatoes against Botrytis cinerea in this invention.

[0035] Figure 7 This is a statistical diagram illustrating the antibacterial efficiency of the fermentation supernatant of the engineered yeast G-Cla-H in this invention against Fusarium graminearum on living plants. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0037] Reference Figure 1-7 Example 1: Construction of recombinant Pichia pastoris engineered strain:

[0038] (1) The coding sequence of the Cla-H antimicrobial peptide (corresponding amino acid sequence SEQ ID NO.1) was synthesized and cloned into the downstream of the α-signal peptide of the pPIC9K expression vector to construct the recombinant expression vector pPIC9K-Cla-H;

[0039] (2) The recombinant expression vector was linearized with SacⅠ restriction endonuclease, digested at 37 °C for 2 h, and the digestion product was purified by gel recovery.

[0040] (3) Preparation of Pichia pastoris GS115 competent cells: The GS115 strain was activated on YPD plates, inoculated into YPD liquid medium, and cultured at 30 ℃ and 220 r / min until OD. 600 =0.6-0.8, competent cells were prepared by ice bath, centrifugation, washing with sterile water and 1M sorbitol, aliquoted and stored at -80 ℃;

[0041] (4) Electroporation: Take 5 μg of linearized recombinant expression vector, add 80 μL of competent cells, incubate on ice for 20 min, transfer to a pre-cooled electroporation cuvette, set voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω, and electroporate; after electroporation, add 1 mL of pre-cooled 1M sorbitol, incubate at 30 ℃ for 1 h, spread on MD plates, and culture at 30 ℃ for 4 d to obtain positive transformants;

[0042] (5) High copy screening: The positive transformants were prepared into bacterial suspensions and the OD was adjusted. 600=1.0, plated on 0.25-4.0 mg / mL G418-YPD plates, incubated at 30 ℃ for 4 days, single colonies with good growth on 2 mg / mL G418 plates were picked, genomic DNA was extracted, PCR identification was performed using AOX1 5' and AOX1 3' primers, and sequencing verified that the target gene sequence was correct, thus obtaining recombinant Pichia pastoris engineered strain G-Cla-H.

[0043] SEQ ID NO.1 is:

[0044] GTTTTTCAATTTTTGGGTAAGATTATTAAGAAGGTTGGTAACTTTGTTAAGGGTTTTTCTAAGGTTTTTCATCATCATCATCATCAT.

[0045] Example 2: Fermentation synthesis of Cla-H antimicrobial peptides:

[0046] (1) Seed culture:

[0047] ① Primary seed culture: Pick a single colony of G-Cla-H, inoculate it into 3 mL of YPD liquid medium, and culture at 30 ℃ and 240 r / min for 16 h with shaking;

[0048] ② Secondary seed culture: Take 1 mL of primary seed culture and inoculate it into 200 mL of BMGY medium. Incubate at 30 ℃ and 240 r / min for 9 h with shaking. Detect the OD of the bacterial culture. 600 =4.2, and secondary seed liquid was obtained.

[0049] (2) Fermentation culture:

[0050] ① Fermenter preparation: Add 2 L of BSM culture medium to a 5 L fermenter, sterilize at 121 ℃ for 20 min, cool, add 4.35 mL of PTM1 stock solution, and adjust the pH to 5.0 with 5 mol / L ammonia water;

[0051] ② Batch growth stage: Inoculate with secondary seed culture, culture at 30 ℃ for 22 h, adjust the stirring speed to 600-700 r / min, maintain dissolved oxygen ≥30%, culture until dissolved oxygen shows a sudden jump, and continue to culture for 1 h;

[0052] ③ Glycerol feeding stage: Add 50% glycerol feed solution containing PTM1 at a feed rate of 10 mL / h, and incubate until the bacterial culture reaches OD. 600 =205, stop feeding;

[0053] ④ Methanol induction stage: Lower the temperature to 26 ℃, add methanol feed solution containing PTM1 at an initial flow rate of 0.5 mL / h, gradually increase to 2.5 mL / h, maintain methanol concentration at about 0.4%, and induce culture for 120 h, during which 10 mL of 15% Peptone feed solution is added every 24 h.

[0054] (3) Collection of fermentation supernatant: After fermentation, centrifuge at 4 ℃ and 3000 r / min for 15 min and collect the supernatant; centrifuge again for 15 min to remove residual yeast cells and obtain clear fermentation supernatant, which is stored at -80 ℃.

[0055] Example 3: Antibacterial activity detection of fermentation supernatant:

[0056] The antibacterial activity of the fermentation supernatant prepared in Example 2 against Fusarium graminearum (Fg) and Botrytis cinerea (Bc) was detected using a micro-broth dilution method combined with resazurin staining. An empty vector of Pichia pastoris fermentation supernatant was used as a negative control. The environment was set at a salt concentration of 50 mM. The specific steps are as follows:

[0057] (1) Prepare a mixture containing 2×10 6 2×PDB medium suspension of CFU / mL spores, for later use;

[0058] (2) Add 50 μL of fermentation supernatant (treatment group) or empty supernatant (negative control) to each well of a 96-well microplate; add 50 μL of BMMY medium to the blank control.

[0059] (3) Add 50 μL of spore suspension to each well to make the final volume of the system 100 μL and the final spore concentration 1 × 10⁻⁶. 6 CFU / mL, final salt concentration is 50 mM;

[0060] (4) Incubate at 25 °C for 48 h, add 10 μL of 0.01% azadirachtin detection solution to each well, continue incubation for 4 h, and observe the color change.

[0061] Test results: In the treatment group (Cla-H fermentation supernatant), all wells remained blue without any color change, indicating that fungal growth was completely inhibited. In the negative control group and the blank control group, the blue color faded and turned red, indicating that the empty supernatant had no antibacterial activity and the fermentation system itself did not interfere with the detection. This demonstrates that the fermentation supernatant of the present invention has good antibacterial efficacy and can be directly used to inhibit target fungi under high spore counts.

[0062] Example 4: In vivo antibacterial application of fermentation supernatant:

[0063] Wheat seedlings aged 10-15 days and tomato plants aged 4 weeks were selected and divided into a treatment group and a negative control group, with 3 replicates in each group. The specific steps are as follows:

[0064] (1) Treatment group: Spray the Cla-H fermentation supernatant prepared in Example 2, 10 mL per plant;

[0065] (2) Negative control group: Spray the supernatant of empty Pichia pastoris fermentation, 10 mL per plant;

[0066] (3) After spraying, spray each plant with 2 mL of solution containing 1×10 6 CFU / mL spore suspension (wheat corresponds to Fg, tomato corresponds to Bc);

[0067] (4) Wheat seedlings were cultured for 30 days and tomato plants for 10 days, and the disease rate was statistically analyzed.

[0068] Results: The disease incidence rate in the wheat seedling treatment group was 29.45%, while that in the negative control group was 96.28%; the disease incidence rate in the tomato plant treatment group was 6.70%, while that in the negative control group was 46.88%. This demonstrates that the fermentation supernatant of the present invention can effectively control fungal diseases in crops and has good practical application effects.

[0069] like Figure 1 As shown:

[0070] Lanes 1 and 2: PCR amplification products of empty vector pPIC9K;

[0071] Lane 3: Genomic PCR amplification product of the control strain (transformed into GS115 Pichia pastoris using pPIC9K empty vector);

[0072] Lane 11: Genomic PCR amplification product of recombinant engineered bacteria G-Cla-H (transformed into GS115 by recombinant vector pPIC9K-Cla-H);

[0073] The primer combination used for PCR amplification in this experiment was: AOX1 5' (5'-GACTGGTTCCAATTGACAAGC-3') and AOX1 3' (5'-GCAAATGGCATTCTGACATCC-3').

[0074] Note: Lanes 4, 5, 6, 7, 8, 9, 10, 12, and 13 are all PCR amplification samples of other engineered yeast genomes unrelated to this patent application.

[0075] like Figure 2 As shown:

[0076] Tricine-Tris-SDS-PAGE detection of antimicrobial peptide Cla-H synthesized by engineered bacteria G-Cla-H.

[0077] Lane 7: Fermentation supernatant of engineered yeast strain G-Cla-H; Lane 9: Fermentation supernatant of control yeast transformed with empty pPIC9K vector; Lanes 1-6 and Lane 8: Fermentation supernatant of other engineered yeast strains unrelated to this patent application; M: Protein molecular weight marker.

[0078] Note: The white arrows in the figure indicate the target small peptide bands detected in the fermentation supernatant of each yeast strain. The white arrow in lane 7 shows the antimicrobial peptide Cla-H specifically expressed in the fermentation supernatant.

[0079] like Figure 3 As shown:

[0080] Column 1: 1 / 2 fermentation medium + resazurin staining solution; Column 2: Fermentation supernatant of yeast transformed with empty vector pPIC9K + resazurin staining solution; Column 3: 1 / 2 fermentation medium + different concentrations of Fusarium graminearum spores + resazurin staining solution; Column 4: Fermentation supernatant of yeast transformed with empty vector pPIC9K + different concentrations of Fusarium graminearum spores + resazurin staining solution; Column 5: Fermentation supernatant of engineered yeast G-Cla-H + different concentrations of Fusarium graminearum spores + resazurin staining solution.

[0081] Note: Each treatment group is set to 1×10. 4 1×10 5 1×10 6 Three CFU / mL concentration gradients of pathogenic fungal spores were used, with three biological replicates for each experiment. Oxidized resorcinol remained stable as a blue pigment in the detection system, showing no color change upon contact with dead fungal cells. However, upon contact with viable fungal cells, it was reduced by intracellular reducing agents to produce red resorufin. If the reduction reaction intensified further, the product would completely fade to colorless. Based on the gradual color change of resorcinol from blue to red and then to colorless, visual comparison of the color differences between each experimental group and the blank control group allowed for rapid determination of the metabolic activity of fungal cells, providing a direct reflection of the pathogen's growth and proliferation status.

[0082] like Figure 4 As shown:

[0083] Column 1: 1 / 2 fermentation medium + resazurin staining solution; Column 2: Fermentation supernatant of yeast transformed with empty vector pPIC9K + resazurin staining solution; Column 3: 1 / 2 fermentation medium + different concentrations of Botrytis cinerea spores + resazurin staining solution; Column 4: Fermentation supernatant of yeast transformed with empty vector pPIC9K + different concentrations of Botrytis cinerea spores + resazurin staining solution; Column 5: Fermentation supernatant of engineered yeast G-Cla-H + different concentrations of Botrytis cinerea spores + resazurin staining solution.

[0084] Note: Each treatment group is set to 1×10. 4 1×10 5 1×10 6 Three CFU / mL concentration gradients of pathogenic fungal spores were used, with three biological replicates for each experiment. Oxidized resorcinol remained stable as a blue pigment in the detection system, showing no color change upon contact with dead fungal cells. However, upon contact with viable fungal cells, it was reduced by intracellular reducing agents to produce red resorufin. If the reduction reaction intensified further, the product would completely fade to colorless. Based on the gradual color change of resorcinol from blue to red and then to colorless, visual comparison of the color differences between each experimental group and the blank control group allowed for rapid determination of the metabolic activity of fungal cells, providing a direct reflection of the pathogen's growth and proliferation status.

[0085] like Figure 5 As shown:

[0086] The fermentation supernatant was used to preventively spray wheat plants, with the fermentation supernatant of the empty vector transformed strain as a negative control. Subsequently, pathogen spores were inoculated, and the in vitro antibacterial properties of the crude product of the antimicrobial peptide variant synthesis system were systematically evaluated by continuously observing the disease phenotype and incidence of the plants.

[0087] Column 1: Wheat seedlings treated with supernatant from yeast fermentation using the control empty vector; Column 2: Enlarged view of a portion of the seedlings treated in Column 1; Column 3: Wheat seedlings treated with supernatant from yeast G-Cla-H fermentation.

[0088] like Figure 6 As shown:

[0089] Tomato plants were preventively sprayed with fermentation supernatant, with fermentation supernatant of empty vector transformed strains used as a negative control. Subsequently, pathogen spores were inoculated, and the in vitro antibacterial properties of the crude product of the antimicrobial peptide variant synthesis system were systematically evaluated by continuously observing the disease phenotype and incidence of the plants.

[0090] Note: The plant on the left is a tomato plant treated with the fermentation supernatant of engineered yeast G-Cla-H, and the plant on the right is a tomato plant treated with the fermentation supernatant of yeast transformed with an empty carrier.

[0091] like Figure 7 As shown:

[0092] 1. The negative control group, i.e., the plants were preventively sprayed with the yeast fermentation supernatant of the control group. The yeast in the control group was obtained by transforming GS115 with empty vector pPIC9K. Each plant was sprayed with 10 mL of yeast fermentation supernatant. 2. The treatment group, i.e., the plants were preventively sprayed with the yeast engineered strain G-Cla-H fermentation supernatant. Each plant was sprayed with 10 mL of yeast fermentation supernatant.

[0093] Note: After preventative spraying with the yeast fermentation supernatant, each plant was inoculated with a quantitative amount of fungal spore suspension. The spraying volume per plant was 2 mL, and the spore concentration was uniformly set at 1×10⁻⁶. 6 CFU / mL.

[0094] Statistical results showed that after pretreatment with fermentation supernatant, the disease incidence rate of wheat plants inoculated with Fusarium graminearum for 30 days decreased significantly, from 96.28% in the control group to 29.45%. Similarly, after treatment with G-Cla-H fermentation supernatant, the disease incidence rate of tomato plants inoculated with Botrytis cinerea for 10 days significantly decreased from 46.88% in the control group to 6.78%. During the experiment, the negative control group experienced widespread wilting and death of entire plants, while the yeast-engineered G-Cla-H fermentation supernatant treatment group only showed localized lesions without overall wilting, demonstrating excellent in vitro disease resistance induction and plant protection effects.

[0095] In summary, this invention constructs a high-copy recombinant Pichia pastoris engineered strain G-Cla-H, placing the Cla-H coding sequence downstream of the α-signal peptide, thereby achieving efficient secretory expression of the Cla-H antimicrobial peptide. The antimicrobial peptide activity in the fermentation supernatant is stable, and it can be directly applied without complex purification, significantly reducing application costs.

[0096] In this invention, the fermentation medium formulation and fermentation parameters were optimized, and the key control conditions for the three stages of batch growth, glycerol feeding, and methanol induction were clarified. A small-scale fermentation of Cla-H antimicrobial peptides was achieved using a 5 L small-scale fermenter, and the OD of the bacterial culture was [not specified]. 600 The value can reach 180-220, with high fermentation efficiency, providing technical parameters and theoretical support for subsequent industrial-scale production.

[0097] In this invention, the fermentation supernatant has good antibacterial effect. It can effectively inhibit the growth of Fusarium graminearum and Botrytis cinerea even in high-salt environments. It also has a fast bactericidal speed and is not easy to induce drug resistance. It can be directly used for the prevention and control of agricultural fungal diseases. It is easy to operate, low in cost, and suitable for large-scale application.

[0098] In this invention, Pichia pastoris is used as the host strain, which has simple and environmentally friendly cultivation conditions. No toxic or harmful substances are produced during the fermentation process, which is in line with the concept of green production. This promotes the industrial transformation of Cla-H antimicrobial peptides and has important economic and social value.

[0099] It should be noted that, in this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the term "comprising" or any other variations thereof is intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0100] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for microbial fermentation synthesis of the antimicrobial peptide Cla-H, characterized in that: The method includes the following steps: S1: The coding sequence of the Cla-H antimicrobial peptide was cloned into the pPIC9K expression vector to obtain the recombinant expression vector pPIC9K-Cla-H; after linearization of the recombinant expression vector, it was electroporated into Pichia pastoris strain GS115, and after G418 gradient screening, the high-copy recombinant Pichia pastoris engineered strain GS115-Cla-H was obtained. S2: Seed culture: Recombinant Pichia pastoris engineered strain G-Cla-H was inoculated into BMGY seed medium and cultured with shaking to obtain a secondary seed culture with good activity; S3: Fermentation culture: The secondary seed culture was inoculated into BSM fermentation medium and fermented in a 5 L small fermenter. The fermentation process was carried out in batch growth stage, glycerol feeding stage and methanol induction stage. The fermentation parameters at each stage were controlled to achieve the secretion and expression of Cla-H antimicrobial peptide. S4: Fermentation product collection: After fermentation, the fermentation supernatant is collected by centrifugation, which is the fermentation product containing Cla-H antimicrobial peptide.

2. The method for microbial fermentation synthesis of the antimicrobial peptide Cla-H as described in claim 1 and the application of the fermentation supernatant thereon, characterized in that: In step S1, the coding sequence of the Cla-H antimicrobial peptide is shown in SEQ ID NO.1; In the recombinant expression vector pPIC9K-Cla-H, the Cla-H coding sequence is placed downstream of the α-signal peptide to achieve secretory expression. The concentration of G418 gradient screening was 0.25-4.0 mg / mL, and high-copy engineered bacteria that could grow normally on 2 mg / mL G418-YPD plates were obtained.

3. The method for microbial fermentation synthesis of the antimicrobial peptide Cla-H as described in claim 1 and the application of the fermentation supernatant thereon, characterized in that: In step S2, the formula for the BMGY seed culture medium is: Yeast extract 10 g / L, Peptone 20 g / L, YNB 13.4 g / L, glycerol 10 mL / L, 0.1 mol / L potassium phosphate buffer, and biotin 0.4 mg / L; the culture conditions are: 30 ℃, 240 r / min, shaking culture for 8-10 h, until the OD600 value of the bacterial solution reaches 2-6.

4. The microbial fermentation synthesis method for the antimicrobial peptide Cla-H as described in claim 1, and the application of the fermentation supernatant thereon, characterized in that: In step S3, the BSM fermentation medium is formulated as follows: 85% H3PO4 26.7 mL / L, CaSO4•2H2O 0.93 g / L, K2SO4 18.2 g / L, KOH 4.13 g / L, glycerol 50 g / L, MgSO4•7H2O 14.9 g / L, PTM1 trace element stock solution 4.35 mL / L, pH adjusted to 5.0; the PTM1 trace element stock solution is formulated as follows: CuSO4・5H2O 6.0 g, KI 0.08 g, MnSO4・H2O 3.0 g, Na2MoO4・2H2O 0.2 g, H3BO3 0.02 g, CoCl2・6H2O 0.5 g, ZnCl2 20 g, FeSO4・7H2O 65 g, biotin 0.2 g, concentrated sulfuric acid 5 mL.

5. The microbial fermentation synthesis method for the antimicrobial peptide Cla-H as described in claim 1, and the application of the fermentation supernatant thereon, characterized in that: In step S3, the parameters for each fermentation stage are controlled as follows: ① Batch growth stage: After inoculation, culture at 30 ℃ for 20-24 h, adjust the stirring speed to 500-800 r / min, maintain dissolved oxygen ≥30% until glycerol is exhausted and dissolved oxygen shows a sudden jump; ②Glycerol feeding stage: After the dissolved oxygen jump, feed a solution containing 50% glycerol and PTM1 to maintain dissolved oxygen stability and culture until the bacterial OD reaches the target level. 600 Stop feeding when the value reaches 180-220; ③ Methanol induction stage: Lower the temperature to 26 ℃, add methanol feed solution containing PTM1, maintain methanol concentration at 0.3%-0.5%, and induce culture for 96-144 h. During this period, add 15% Peptone feed solution periodically to supplement nitrogen source.

6. The microbial fermentation synthesis method for the antimicrobial peptide Cla-H as described in claim 1, characterized in that: In step S4, the centrifugation conditions are: 4 ℃, 3000 r / min, centrifugation for 15 min, and collection of supernatant; the supernatant can be further purified by secondary centrifugation to remove residual yeast cells.

7. A Cla-H antimicrobial peptide fermentation supernatant, characterized in that: The supernatant was prepared by microbial fermentation synthesis of the antimicrobial peptide Cla-H as described in any one of claims 1-6.

8. The application of a microbial fermentation supernatant containing the antimicrobial peptide Cla-H, characterized in that: The supernatant from the microbial fermentation was used to inhibit Fusarium graminearum or Botrytis cinerea.

9. The application of the microbial fermentation supernatant of the antimicrobial peptide Cla-H as described in claim 8, characterized in that: The application of the microbial fermentation supernatant includes its use in the preparation of agricultural antifungal agents.

10. The method for microbial fermentation synthesis of the antimicrobial peptide Cla-H as described in claim 1 and the application of the fermentation supernatant thereon, characterized in that: The fermentation supernatant was prepared at a salt concentration of 50 mM and a concentration of 1×10⁻⁶ mM. 6 Even with high spore counts of CFU / mL, it can still completely inhibit the growth of Fusarium graminearum and Botrytis cinerea within 48 hours; it can be used for preventive control of fungal diseases in crops such as wheat and tomatoes, with a spraying dosage of 10 mL / plant.

Images