Modified ube3a gene for gene therapy approach for angelman syndrome

Abstract

The present invention relates to modified UBE3A genes for gene therapy methods for Angelman syndrome. More specifically, the present invention provides therapeutic methods and compositions for treating Angelman syndrome.

Description

[0001] This application is a divisional application of the application filed on May 9, 2016, with international application number PCT / US2016 / 031468, which entered the Chinese national phase on November 7, 2017, application number 201680026461.3, and invention title "Modified UBE3A gene for gene therapy of Angelman syndrome".

[0002] Cross-reference of related applications

[0003] This application claims priority to U.S. Provisional Application No. 62 / 158,269, filed May 7, 2015, entitled “Modified UBE3A Gene for a Gene Therapy Approach for AngelmanSyndrome,” which is incorporated herein by reference. Technical Field

[0004] This invention relates to the treatment of Angelman syndrome. More specifically, this invention provides methods and compositions for treating Angelman syndrome. Background Technology

[0005] Angelman syndrome (AS) is a genetic disorder that affects neurons, with an estimated occurrence of about 1 in 15,000 newborns (Clayton-Smith, Clinical research on Angelman syndrome in the United Kingdom: observations on 82 affected individuals. Am J Med Genet. 1993 Apr 1; ​​46(1): 12-5), but the actual number of diagnosed AS cases may be higher due to misdiagnosis.

[0006] Angelman syndrome is a progressive impairment characterized by delayed and reduced intellectual and developmental progress, particularly in language and motor skills. Specifically, AS is defined by little or no verbal communication, some nonverbal communication, ataxia, and temperament including frequent laughter and smiling and excited movements.

[0007] More severe cases result in severe intellectual disability, potentially uncontrollable seizures that typically begin before or around age three, frequent laughter (Nicholls, Newinsights reveal complex mechanisms involved in genomic imprinting. Am J HumGenet. 1994 May;54(5):733-40), microcephaly, and EEG abnormalities. In severe cases, patients may not develop language or may only use 5-10 words. Movement is usually clumsy, and walking is often accompanied by hand swinging and a stiff gait. Patients often have epilepsy, especially early in life, and suffer from sleep apnea, typically sleeping only 5 hours at a time. They are sociable and crave human contact. In some cases, the skin and eyes may have little or no pigment, sucking and swallowing problems, heat sensitivity, and an fascination with water. Studies in UBE3A-deficient mice have shown disturbances in long-term synaptic plasticity. Angelman syndrome is currently incurable, and treatment is palliative. For example, anticonvulsant drugs are used to reduce seizures, and speech and physical therapy are used to improve language and motor skills.

[0008] The UBE3A gene causes atherosclerosis (AS), and it is unique because it belongs to one of the small families of human imprinted genes. UBE3A, found on chromosome 15, encodes a homolog (HECT) of the C-terminal protein of E6AP (E6-associated protein (E6AP)) (Kishino et al., UBE3A / E6-AP mutations cause Angelman syndrome. Nat Gen. 1997 Jan 15.15(1):70-3). UBE3A undergoes spatially defined maternal imprinting in the brain; therefore, the paternal copy is silenced via DNA methylation (Albrecht et al., Imprinted expression of the murine Angelman syndrome gene, Ube3a, in hippocampal and Purkinje neurons. Nat Genet. 1997 Sep;17(1):75-8). Therefore, only the maternal copy is active, and the paternal chromosome has little or no effect on the proteasomes of neurons in this region of the brain. Thus, partial inactivation, translocation, or deletion of chromosome 15 leads to uncompensated loss of function. Some studies have shown that inappropriate E6-AP protein levels alter synaptic connections in patients with Angelman syndrome (Tonazzini et al., Impaired neurite contract guidance in ubiquitin ligase E3a(Ube3a)-deficient hippocampal neurons on nanostructured substrates. AdvHealthc Mater. 2016 Apr;5(7):850-62).

[0009] Most cases of Angelman syndrome (70%) occur via a de novo deletion of approximately 4 Mb from 15q11 to q13 on the maternal chromosome incorporating the UBE3A gene (Kaplan et al., Clinical heterogeneity associated with deletions in the long arm of chromosome 15: report of 3 new cases and their possible significance). Am J Med Genet. 1987 Sep; 28(1): 45-53. However, it can also occur due to abnormal methylation of the maternal copy preventing its expression (Buiting et al., Inherited microdeletions in the Angelman and Prader-Willi syndromes define an imprinting center on human chromosome 15). Nat Genet. 1995. Apr; 9(4): 395-400; Gabriel et al., A transgene insertion creating a heritable chromosome deletion mouse model of Prader-Willi and Angelman syndrome. Proc Natl Acad Sci USA 1999 Aug; 96(16): 9258-63) or due to uniparental disomy resulting from the inheritance of two copies of the paternal gene (Knoll et al., Angelman and Prader-Willi syndromes share a common chromosome 15 deletion but differ in parental origin of the deletion). Am J Med Genet.1989 Fed; 32(2): 285-90; Malcolm et al., Uniparental paternal disomy in Angelman's syndrome. Lancet. 1991 Mar 23; 337(8743): 694-7). The remaining AS cases arise from various UBE3A mutations in the maternal chromosome, or they are diagnosed as having no genetic cause (12-15). UBE3A encodes the E6-associated protein (E6-AP) ubiquitin ligase. E6-AP is an E3 ubiquitin ligase, and therefore exhibits specificity for its protein targets, including the tumor suppressor molecule p53 (Huibregtse et al., A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18. EMBO J. 1991 Dec; 10(13): 4129-35), and the human homologue of the yeast DNA repair protein Rad23 (Kumar et al., Identification of HHR23A as a substrate for E6-associated protein-mediated ubiquitination). J Biol Chem. 1999 Jun 25; 274(26): 18785-92), E6-AP itself, and the recently identified target Arc (Nuber et al., The ubiquitin-protein ligase E6-associated protein (E6-AP) serves as its own substrate. Eur J Biochem. 1998 Jun 15; 254(3): 643-9; Greer et al., The Angelman Syndrome protein Ube3A regulates synapse development by ubiquitinating arc. Cell. 2010 Mar 5; 140(5): 704-16).

[0010] Mild cases may be caused by mutations in the UBE3A gene at chromosome 15q11-13, which encodes the E6-AP ubiquitin ligase protein of the ubiquitin pathway, while more severe cases are caused by larger deletions on chromosome 15. Typically, loss of the UBE3A gene in the hippocampus and cerebellum leads to Angelman syndrome, but a single loss-of-function mutation can also cause the condition.

[0011] Compared with the normal brain, the anatomy of mouse and human AS brains did not show significant changes, suggesting that cognitive deficits may be biochemical rather than developmental in nature (Jiang et al., Mutation of the Angelmanubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron. 1998 Oct; 21(4): 799-811; Davies et al., Imprinted gene expression in the brain. Neurosci Biobehav Rev. 2005 May; 29(3): 421–430). The Angelman syndrome mouse model used exhibits disruption of the maternal UBE3A gene through a null mutation in exon 2 (Jiang et al., Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron. 1998 Oct; 21(4): 799-811). This model is extremely beneficial to the field of AS research due to its ability to recreate the major phenotypic features of AS patients. For example, AS mice exhibit induced seizures, poor motor coordination, hippocampal-dependent learning deficits, and defects in hippocampal LTP. Previous studies have shown that cognitive deficits in AS mouse models are associated with abnormal phosphorylation of calcium / calmodulin-dependent protein kinase II (CaMKII) (Weeber et al., Derangements of hippocampal calcium / calmodulin-dependent protein kinase II in a mouse model for Angelman mental retardation syndrome. J Neurosci. 2003 Apr;23(7):2634-44). CaMKII activation Thr 286 Sites and inhibitory Thr 305 Phosphorylation at both sites was significantly increased, but the total enzyme level remained unchanged, leading to an overall decrease in activity. The total amount of CaMKII at the postsynaptic density was also reduced, indicating a decrease in the amount of active CaMKII. At Thr 305 Mutant mouse models with point mutations that prevent phosphorylation at the site were crossed with AS mice, rescuing the AS phenotype, namely, seizure activity, motor coordination, hippocampus-dependent learning, and LTP, which were restored to wild-type levels. Therefore, postnatal expression of αCaMKII suggests that the major phenotype in AS mouse models is due to postnatal biochemical changes rather than overall developmental defects (Bayer et al., Developmental expression of the CaMkinase II isoforms: ubiquitous γ- and δ-CaM kinase II are the early isoforms and most abundant in the developing nervous system). Brain Res Mol Brain Res. 1999 Jun 18; 70(1): 147-54.

[0012] Ube3a deficiency is also associated with Huntington's disease (Maheshwari et al., Deficeincy of Ube3a in Huntington's disease mice brain increases aggregate load and accelerates disease pathology. Hum Mol Genet. 2014 Dec 1; 23(23): 6235-45).

[0013] Matentzoglu points out that E6-AP possesses non-E3 activity related to hormone signal transduction (Matentzoglu, EP2, 724, 721 A1). Therefore, steroids such as androgens, estrogens, and glucocorticoids are used to treat various E6-AP disorders, including Angelman syndrome, autism, epilepsy, Prader-Willi syndrome, cervical cancer, Fragile X syndrome, and Ret syndrome. Philpot suggests using topoisomerase inhibitors to demethylate the silenced gene, thereby correcting Ube3A deficiency (Philpot et al., PG Pub. US 2013 / 0317018 A1). However, work and proposed therapies in this field, as with the use of steroids, do not address the underlying conditions, or may lead to other conditions, such as autism, when using demethylating compounds. Therefore, what is needed is a therapy that addresses the underlying causes of Ube3A deficiency disorders in a safe and effective manner. Summary of the Invention

[0014] While most human conditions characterized by severe intellectual disability involve abnormalities in brain structure, there are no major anatomical changes associated with AS. The generated Ube3a protein contains additional cellular secretion sequences that allow Ube3a to be secreted from cells and cellular uptake sequences that facilitate its uptake by neighboring neurons. This provides a functional E6-AP protein to neurons, thereby rescuing the disease pathology.

[0015] Therefore, a UBE3A vector is formed using a transcription initiation sequence and a UBE construct positioned downstream of the transcription initiation sequence. The UBE construct is formed from a UBE3A sequence, a secretion sequence, and a cellular uptake sequence. Non-limiting examples of the UBE3A sequence are cDNAs of SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 13, 15, SEQ ID No. 7, cDNA of SEQ ID No. 14, or homologous sequences. Variations of the DNA sequence include conserved mutations in the DNA triplet codon, as shown in the table. In specific variations, the UBE3A sequence is from a mouse (… mus musculus UBE3A U82122.1, Homo sapiens ( homo sapiensUBE3A variant 1, variant 2, or variant 3. Non-limiting examples of the secreted sequence are cDNA or homologous sequences of SEQ ID No. 2, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, and SEQ ID No. 3, as well as variations of the DNA sequence including the aforementioned conserved mutations. Non-limiting examples of the cellular uptake sequence are cDNA of SEQ ID No. 4, SEQ ID No. 11, and SEQ ID No. 5, or homologous sequences. Variations of the DNA sequence include the aforementioned conserved mutations. In a specific variation of the invention, the secreted sequence is positioned upstream of the UBE3A sequence, and more specifically, optionally upstream of the UBE3A sequence and downstream of the secreted sequence.

[0016] The table below shows the redundant triplet codons and their corresponding encoded amino acids based on functional group categories.

[0017]

[0018] In some variations of the invention, the transcription initiation sequence is a cytomegalovirus chicken-β-actin heterozygous promoter or a human ubiquitin c promoter. The invention optionally includes an enhancer sequence. A non-limiting example of such an enhancer sequence is a cytomegalovirus immediate early enhancer sequence positioned upstream of the transcription initiation sequence. The vector optionally also includes a marmot hepatitis post-transcriptional regulatory element.

[0019] In a variation, the vector is inserted into a plasmid, for example, a plasmid based on recombinant adeno-associated virus serotype 2. In a specific variation, the plasmid based on recombinant adeno-associated virus serotype 2 lacks a DNA integration element. A non-limiting example of the plasmid based on recombinant adeno-associated virus serotype 2 is the pTR plasmid.

[0020] A method for synthesizing a UBE3A vector is also provided. A UBE3A construct is inserted into a backbone plasmid having a transcription initiation sequence, wherein the UBE3A construct is formed from a UBE3A sequence, a secretion sequence, and a cellular uptake sequence. In some variations, the UBE3A construct is inserted downstream of the transcription initiation sequence. Non-limiting examples of the UBE3A sequence are cDNA or homologous sequences of SEQ ID No. 1, SEQ ID No. 6, SEQ ID No. 12, SEQ ID No. 13, and SEQ ID No. 7. Variations of the DNA sequence include conserved mutations in the DNA triplet codon, as shown in the table. Non-limiting examples of the secretion sequence are cDNA or homologous sequences of SEQ ID No. 2, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, and SEQ ID No. 3, as well as variations of the DNA sequence including the aforementioned conserved mutations. Non-limiting examples of the cellular uptake sequence are the cDNA of SEQ ID No. 4, SEQ ID No. 11, the cDNA of SEQ ID No. 5, or homologous sequences. Variations of the DNA sequence include the aforementioned conserved mutations. In a specific variation of the invention, the secretory sequence is positioned upstream of the UBE3A sequence, and more specifically, optionally upstream of the UBE3A sequence and downstream of the secretory sequence. For example, the Ube3a gene is cloned and in-frame fused into a 3' DNA sequence (having two other peptide sequences at their N-termini), a signal peptide, and an HIV TAT sequence, and cloned into a recombinant adeno-associated virus vector to express the secreted E6-AP protein in the brain and spinal cord of AS patients. The UBE construct is optionally inserted by cutting the backbone plasmid with at least one endonuclease and ligating the UBE3A construct to the cut ends of the backbone plasmid.

[0021] The vector is then optionally inserted into an amplified host possessing an antibiotic resistance gene, and undergoes antibiotic selection corresponding to the antibiotic resistance gene. The amplified host is then multiplied in a culture medium containing the antibiotic selection, and the multiplied amplified host is collected. The vector is then isolated from the amplified host. In a specific variation of the invention, the antibiotic resistance gene is an ampicillin resistance gene, wherein the corresponding antibiotic selection is ampicillin.

[0022] Methods for treating UBE3A deficiency disorders such as Angelman syndrome, Prader-Willi syndrome, or Huntington's disease are also provided. The carrier described above is administered to the brain of a patient with a UBE3A deficiency disorder to correct the UBE deficiency. The carrier is optionally administered by injection. Non-limiting examples include intrahippocampal or ventricular injection. In specific variations, the carrier is injected bilaterally. Optional doses include approximately 5.55 x 10⁻⁶. 11 Genomes per gram of brain mass approximately 2.86 x 10⁻⁶ 12 Genomes per gram of brain mass, or more specifically 5.55 x 10^6 grams. 11 Up to 2.86 x 10 12 Genome / gram brain mass. Non-limiting examples of dosage are: 5.55 x 10 11 Genomes per gram of brain mass, 5.75 x 10⁻⁶ 11 Genomes / gram brain mass, 5.8 x 10 11 Genomes / gram brain mass, 5.9 x 10⁻⁶ 11 Genomes / gram brain mass, 6.0 x 10 11 Genomes / gram brain mass, 6.1 x 10 11 Genomes / gram brain mass, 6.2 x 10^6 11 Genomes / gram brain mass, 6.3 x 10 11 Genomes / gram brain mass, 6.4 x 10 11 Genomes / gram brain mass, 6.5 x 10⁻⁶ 11 Genomes / gram brain mass, 6.6 x 10-1 11 Genomes per gram of brain mass, 6.7 x 10⁻⁶ 11 Genomes / gram brain mass, 6.8 x 10⁻⁶ 11 Genomes / gram brain mass, 6.9 x 10-1 11 Genomes / gram brain mass, 7.0 x 10 11 Genomes / gram brain mass, 7.1 x 10^6 11 Genomes / gram brain mass, 7.2 x 10⁻⁶ 11 Genomes / gram brain mass, 7.3 x 10 11 Genomes / gram brain mass, 7.4 x 10 11 Genomes / gram brain mass, 7.5 x 10 11 Genomes / gram brain mass, 7.6 x 10 11 Genomes / gram brain mass, 7.7 x 10 11 Genomes / gram brain mass, 7.8 x 10 11 Genomes / gram brain mass, 7.9 x 10 11Genomes / gram brain mass, 8.0 x 10 11 Genomes / gram brain mass, 8.1 x 10 11 Genomes / gram brain mass, 8.2 x 10^6 11 Genomes / gram brain mass, 8.3 x 10 11 Genomes / gram brain mass, 8.4 x 10 11 Genomes / gram brain mass, 8.5 x 10 11 Genomes per gram of brain mass, 8.6 x 10⁻⁶ 11 Genomes / gram brain mass, 8.7 x 10 11 Genomes / gram brain mass, 8.8 x 10 11 Genomes / gram brain mass, 8.9 x 10 11 Genomes / gram brain mass, 9.0 x 10 11 Genomes / gram brain mass, 9.1 x 10^6 11 Genomes / gram brain mass, 9.2 x 10^6 11 Genomes per gram of brain mass, 9.3 x 10⁻⁶ 11 Genomes / gram brain mass, 9.4 x 10⁻⁶ 11 Genomes / gram brain mass, 9.5 x 10 11 Genomes / gram brain mass, 9.6 x 10 11 Genomes / gram brain mass, 9.7 x 10 11 Genomes / gram brain mass, 9.80 x 10 11 Genomes / gram brain mass, 1.0 x 10 12 Genomes / gram brain mass, 1.1 x 10⁻⁶ 12 Genomes / gram brain mass, 1.2 x 10^6 12 Genomes / gram brain mass, 1.3 x 10⁻⁶ 12 Genomes / gram brain mass, 1.4 x 10 12 Genomes / gram brain mass, 1.5 x 10 12 Genomes / gram brain mass, 1.6 x 10^6 12 Genomes / gram brain mass, 1.7 x 10^6 12 Genomes / gram brain mass, 1.8 x 10⁻⁶ 12 Genomes / gram brain mass, 1.9 x 10^6 12 Genomes / gram brain mass, 2.0 x 10 12 Genomes / gram brain mass, 2.1 x 10^6 12 Genomes / gram brain mass, 2.2 x 10⁻⁶ 12 Genomes / gram brain mass, 2.3 x 10⁻⁶ 12Genomes / gram brain mass, 2.40 x 10⁻⁶ 12 Genomes / gram brain mass, 2.5 x 10⁻⁶ 12 Genomes / gram brain mass, 2.6 x 10^6 12 Genomes / gram brain mass, 2.7 x 10⁻⁶ 12 Genomes / gram brain mass, 2.75 x 10⁻⁶ 12 Genomes / gram brain mass, 2.8 x 10 12 Genomes per gram of brain mass, or 2.86 x 10^6 12 Genome / gram brain quality. Attached Figure Description

[0023] For a more complete understanding of the present invention, reference should be made to the following detailed description in conjunction with the accompanying drawings, in which: Figure 1 These are dot blots of anti-GFP antibody on the culture medium of HEK293 cells transfected with the indicated GFP clone containing the signal peptide.

[0024] Figure 2 This is a diagram of the mouse UBE3A vector construct used in this invention. Major genes are annotated.

[0025] Figure 3 This is a Western blot showing the E6-AP protein secreted by HEK293 cells transfected with plasmid. Culture media taken from control cells transfected with cell culture medium (cnt txn), culture media taken from Ube3a transfected cells (Ube3a txn), and culture media taken from untransfected cells (cnt untxn) were run on acrylamide gels and stained with anti-E6-AP antibody.

[0026] Figure 4 This is a graph showing the percentage of E6-AP protein staining area. Non-transgenic (Ntg) control mice show the Ube3a expression level in the brains of normal mice. Angelman syndrome mice (AS) show the staining levels (also known as background staining) in those mice. Injection of AAV4-STUb into the lateral ventricle of AS mice showed increased E6-AP protein staining levels compared to AS mice. n=2

[0027] Figure 5 These are microscopic images of anti-E6-AP antibody staining in non-transgenic mice. GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from ependymal cells and taken up in the parenchyma.

[0028] Figure 6These are microscopic images of anti-E6-AP antibody staining in non-transgenic mice, showing a higher magnification image of the ventricular system (lateral ventricles (LV), third ventricle). GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from ependymal cells and taken up in the parenchyma.

[0029] Figure 7 These are microscopic images of anti-E6-AP antibody staining in uninjected AS mice.

[0030] Figure 8 These are microscopic images of anti-E6-AP antibody staining in uninjected AS mice, showing higher magnification images of the ventricular system (lateral ventricles (LV), third ventricle).

[0031] Figure 9 These are microscopic images of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. Expression is observed in ependymal cells, but staining is also observed in the parenchyma immediately adjacent to the ventricle. GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from the ependymal cells and taken up in the parenchyma.

[0032] Figure 10 These are microscopic images of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricles, showing a higher magnification image of the ventricular system (lateral ventricle (LV), third ventricle). Expression is seen in the ependymal cells, but staining is also observed in the parenchyma immediately adjacent to the ventricle (indicated by arrows). GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from the ependymal cells and taken up in the parenchyma.

[0033] Figure 11 This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricles. A higher magnification image of the ventricular system (lateral ventricles (LV)) showing Ube3a expression after AAV4-STUb delivery. Expression is visible in ependymal cells, but staining is also observed in the parenchyma immediately adjacent to the ventricles (indicated by arrows). GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from the ependymal cells and taken up in the parenchyma.

[0034] Figure 12This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. A higher magnification image shows Ube3a expression in the ventricular system (third ventricle) after AAV4-STUb delivery. Expression is visible in ependymal cells, but staining is also observed in the parenchyma immediately adjacent to the ventricle (indicated by arrows). GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from ependymal cells and taken up in the parenchyma.

[0035] Figure 13 These are microscopic images of non-transgenic mice stained with anti-E6-AP antibody after transfection with GFP. No expression was observed upon injection of AAV4-GFP; only transduction in ependymal and choroid plexus cells was visible. GFP (green fluorescent protein) is a non-secreted cytoplasmic protein. This indicates that Ube3a is being released from ependymal cells and taken up in the parenchyma.

[0036] Figure 14 These are microscopic images of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. A coronal section of the brain showing Ube3a expression after AAV4-STUb delivery.

[0037] Figure 15 This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. The coronal section of the middle lateral ventricle (LV) shows Ube3a expression after AAV4-STUb delivery.

[0038] Figure 16 This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. A coronal section of the third ventricle (3V) in the brain shows Ube3a expression after AAV4-STUb delivery.

[0039] Figure 17 This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. The coronal section of the interior horn of the middle lateral ventricle (LV) shows Ube3a expression after AAV4-STUb delivery.

[0040] Figure 18 This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. The coronal section of the middle lateral ventricle (LV) shows Ube3a expression after AAV4-STUb delivery.

[0041] Figure 19This is a microscopic image of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricle. A coronal section of the fourth ventricle (4V) in the brain shows Ube3a expression after AAV4-STUb delivery.

[0042] Figure 20 Microscopic images of anti-E6-AP antibody staining in AS mice injected with AAV4-STUb into the lateral ventricles. Coronal section of the brain, higher magnification images of Ube3a expression in the lateral ventricle (LV) and (C) third ventricle (3V) after AAV4-STUb delivery.

[0043] Figure 21 This is a diagram of the human UBE3A vector construct used in this invention. Major genes are annotated.

[0044] Figure 22 This is a Western blot of HEK293 cell lysates transfected with the hSTUb construct. Proteins were stained with anti-E6AP antibody.

[0045] Figure 23 The image shows a dot blot of anti-E6AP antibody on HEK293 cells transfected with an hSTUb construct that has GDNF or insulin signaling, indicating that insulin signaling works better for expression and secretion.

[0046] Figure 24 It uses anti-HA tag antibodies to confirm the dotted marks of insulin signal secretion.

[0047] Detailed description of preferred embodiments

[0048] When used herein, designations without a specific quantity include plural designations unless the context clearly indicates otherwise. Thus, for example, the designation "polypeptide" may include a mixture of two or more polypeptides, etc.

[0049] When used in this text, “about” means approximately or close to, and in the case of the numerical values ​​or ranges stated, it means ±15% of the numerical value.

[0050] The term "administration" describes the process of delivering the compounds of the present invention, alone or in combination with other compounds, to a patient. The compositions can be administered via various routes, including oral, parenteral (referring to intravenous and intra-arterial routes and other suitable parenteral routes), intrathecal, intramuscular, subcutaneous, colonic, rectal, and nasal administration. Each of these conditions can be readily treated using other routes of administration of the compounds of the present invention to treat the disease or condition. As is known in the art, the dosage of the compounds and compositions of the present invention to achieve therapeutic or preventative effects is determined by the patient's condition. The dosage administered to the patient herein can be achieved by individual or unit doses of the compounds or compositions herein, or by doses of compounds or compositions in combination, pre-packaged, or pre-formulated. An average 40g mouse has a brain weighing 0.416g, a 160g mouse has a brain weighing 1.02g, and a 250g mouse has a brain weighing 1.802g. The average weight of the human brain is 1508g, which can be used to guide the required or useful therapeutic dose to achieve the treatments described herein.

[0051] The pharmaceutical compositions of the present invention can be formulated according to known methods for preparing pharmaceutically useful compositions. Furthermore, as used herein, the phrase "pharmaceutical-grade carrier" refers to any of the standard pharmaceutical-grade carriers. The pharmaceutical-grade carrier may include diluents, adjuvants, and media, as well as implant carriers, and inert, non-toxic solid or liquid fillers, diluents, or encapsulating materials that do not react with the active ingredients of the present invention. Examples include, but are not limited to, phosphate-buffered saline, physiological saline, water, and emulsions, such as oil / water emulsions. The carrier may be a solvent or dispersion medium containing, for example, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Formulations are described in many sources well known and readily available to those skilled in the art. For example, Remington Pharmaceutical Sciences (… Remington's Pharmaceutical Sciences (Martin EW

[1995] Easton Pennsylvania, Mack Publishing Company, 19th edition) describes formulations that can be used in conjunction with the present invention.

[0052] As used herein, “animal” means a multicellular eukaryotic organism classified in the kingdom Animalia or Metazoa. This term includes, but is not limited to, mammals. Non-limiting examples include rodents, mammals, aquatic mammals, domesticated animals such as dogs and cats, farm animals such as sheep, pigs, cattle, and horses, and humans. In the use of the term “animal,” it is contemplated that it also applies to any animal.

[0053] When used herein, the term "homologous" refers to a nucleotide sequence that has at least 80% sequence identity, preferably at least 90% sequence identity, more preferably at least 95% sequence identity, and even more preferably at least 98% sequence identity with the target sequence. Variations in the nucleotide sequence can be conserved mutations in the nucleotide sequence, i.e., mutations in the triplet codon encoding the same amino acid, as shown in the table.

[0054] When used in this article, the term "therapeutic effective amount" refers to an amount of treatment (e.g., a therapeutic agent or carrier) sufficient to cause improvement of Angelman syndrome or other UBE3A-related conditions or one or more of their symptoms, prevent the progression of Angelman syndrome or other UBE3A-related conditions, or induce the remission of Angelman syndrome or other UBE3A-related conditions.

[0055] When used herein, "patient" is used to describe the animal, preferably a human, to which treatment is administered, including preventative treatment using the compositions of the present invention.

[0056] Example 1

[0057] To test the efficacy of the secretion signal, GFP was cloned within the frame along with human insulin, GDNF, or IgK signal peptides. The constructs were inserted into pTR plasmids and transfected into HEK293 cells (American Type Culture Collection, Manassas, VA). HEK293 cells were grown in Dulbecco's modified essential medium (DMEM) containing 10% FBS and 1% Pen / Strep at 37°C and 5% CO2, and passaged at 80% confluence.

[0058] The vector (2 μg / well in a 6-well plate) was transfected into the cells using the PEI transfection method. Two days before transfection, the cells were cultured in 6-well plates with DMEM medium at a concentration of 0.5 x 10⁻⁶ mg / well. 6 Cells / well passaged. The medium was changed the night before transfection. Endotoxin-free dH2O was heated to approximately 80°C to dissolve the polyethyleneimine (Sigma-Aldrich Co. LLC, St. Louis, MO). The solution was allowed to cool to approximately 25°C and neutralized with sodium hydroxide. For each transfected well, AAV4-STUb vector or negative control (medium only) was added at a ratio of 2 µg per 200 μL to serum-free DMEM, and 9 μL of 1 μg / μL polyethyleneimine was added to the mixture in each well. The transfection mixture was incubated at room temperature for 15 minutes, then added at 210 μL / well to each cell well and incubated for 48 hours.

[0059] Culture medium was collected from each well and 2 μL was spotted onto a nitrocellulose membrane using a narrow-tip pipette. After the sample dried, the membrane was blocked by applying TBS-T containing 5% BSA and incubating at room temperature for 30 minutes to 1 hour. The membrane was then incubated at room temperature in BSA / TBS-T with chicken anti-GFP antibody (5 µg / mL, Abcam PLC, Cambridge, UK; #ab13970) for 30 minutes. The membrane was washed three times with TBS-T for 5 minutes each time. The membrane was then incubated with HRP-conjugated anti-chicken HRP conjugate secondary antibody (Southern Biotechnology, Thermo Fisher Scientific, Inc., Waltham, MA; #6100-05, 1 / 3000) at room temperature for 30 minutes, followed by washing the membrane three times with TBS-T for 15 minutes each time, then 5 minutes each time. The membrane was washed with TBS for 5 minutes at room temperature and incubated for 1 minute with a luminescent reagent (Millipore, Merck KGaA, Darmstadt, DE; #WBKLS0100). The membrane was then recorded on a GE Amersham Imaging System 600 (General Electric, Fairfield, CA). Figure 1 As shown.

[0060] from Figure 1 As can be seen, compared with untransfected control cells, all three secretion signals resulted in the release of GFP-tagged proteins from the cells. Among the three secretion constructs, the IgK construct showed the highest secretion level, but clone 2 of the GDNF construct did indeed similarly show high secretion of GFP-tagged proteins.

[0061] Example 2

[0062] A mouse-UBE3A vector construct was generated using the pTR plasmid. (Mouse) Mus musculus The UBE3A gene is formed from the following cDNA (U82122.1): atgaagcgag cagctgcaaa gcatctaata gaacgctact accatcagtt aactgagggctgtggaaatg aggcctgcac gaatgagttt tgtgcttcct gtccaacttt tcttcgtatg gataacaatgcagcagctat taaagccctt gagctttata aaattaatgc aaaactctgt gatcctcatc cctccaagaaaggagcaagc tcagcttacc ttgagaactc aaaaggtgca tctaacaact cagagataaa aatgaacaagaaggaa aagattttaa agatgtgatt tacctaactg aagagaaagt atatgaaatt tatgaatttgtagagagagag tgaggattat tcccctttaa ttcgtgtaat tggagaata tttctagtg ctgaggcactggttctgagc tttcggaaag tcaaacagca cacaaaggag gaattgaaat ctcttcaaga aaaggatgagacaaggatg aagatgaaaa ggaaaaagct gcatgttctg ctgctgctat ggagaagac tcagaagcatcttcttcaag gatgggtgat agttcacagg gagacaacaa tgtacaaaaa ttaggtcctg atgatgtgactgtggatatt gatgctatta gaagggtcta cagcagtttg ctcgctaatg aaaaaattaga aactgccttcctgaatgcac ttgtatatct gtcacctaac gtggaatgtg atttgacata tcataatgtg tatactcgagatcctaatta tctcaatttg ttcattatg taatggagaa tagtaatctc cacagtcctg aatatctggaaatggcgttg ccattattt gcaaagctat gtgtaagcttat gccctttgaag ctcaaggaaa actgattaggctgtggtcta aatacagtgctgaccagatt cggagaatga tggaaacatt tcagcaactt attacctacaaagtcataag caatgaattt atagccgaa atctagtgaa tgatgatgat gccattgttg ctgcttcaaagtgtttgaaa atggtttact atgcaaatgt agtgggaggg gatgtggaca caaatcatagagagagatc gtccagcgaa ttaacacttc aggagcttct gggagatgaa agaagaaataagaaaggtcc tcgagtggat ccactagaaa ccgaacttgg cgttaaaact ctagactgtc gaaaaccacttatctctcttt gaagaattca ttaatgaacc actgaatgat gttctagaaacatacattatc aaacagagaa caaattctct tttatgacat gtccctttat attgaatgct gtcacaaagaatctgggatt atattatgac aatagaattc gcatgtacag tgaaagaaga atcactgttc tttacagcctagttcaagga cagcagttga atccgtattt gagactcaaa gtcagactatgcaggatt aggagatt tgctatggaa aatcctgcag acttgaagaa gcagttgtat gtggaatttgaaggagaaca aggagtaatg agggaggcgt ttccaaagag ttttttcagt tgggttgtgg aggaaatttttaatccaaat attggtatgt tcacatatga tgaagctacg aaattatttt ggtttaatcc atctgagtagct ctctgattgg catatcctgg gtctggctat ttacaataat tgtatactggatgtccattt tcccatggtt gtatacaggaagctaatggg gaaaaaagga acctttcgtg acttgggagactctcaccca gttttatatc agagtttaaa ggatttattg gaatatgaag ggagtgtgga agatgatatgatgatcactt tccagatatc acagacagat ctttttggta acccaatgat gtatgatcta aaagaaaatggtgataaaat tccaattaca aatgaaaaca ggaaggaatt tgtcaatctc tattcagact acattctcaataaatctgta gaaaaacaat tcaaggcatt tcgcagaggt tttcatatgg tgactaatga atcgcccttaaaatacttat tcagaccaga agaaattgaa ttgcttatat gtggaagccg gaatctagat ttccaggcactagaagaaac tacagagtat gacggtggct atacgaggga atctgttgtg attagggagt tctgggaaattgttcattcg tttacagatg aacagaaaag actctttctg cagtttacaa caggcacaga cagagcacctgttggaggac taggaaaatt gaagatgatt atagccaaaa atggcccaga cacagaaagg ttacctacatctcatacttg ctttaatgtc cttttacttc cggaatattc aagcaaagaa aaacttaaag agagattgttgaaggccatc acatatgcca aaggatttgg catgctgtaa (SEQ ID No. 1).

[0063] The cDNA was subcloned and sequenced. The mouse UBE3A gene (SEQ ID No. 1) was fused into a DNA sequence encoding a secretion signal peptide (SEQ ID No. 2) and an HIV TAT sequence (SEQ ID No. 4). The secretion signal peptide has the following DNA sequence: atg gcc ctg ttg gtg cac ttc cta ccc ctg ctg gcc ctg ctt gcc ctc tgggag ccc aaa ccc acc cag gct ttt gtc (SEQ ID No. 2), which encodes the following protein sequence: MALLVHFLPLLALLALWEPKPTQAFV (SEQ ID No. 3); Meanwhile, the HIV TAT sequence is: tac ggc aga aag aag agg agg cag aga agg aga (SEQ ID No. 4), which encodes the following protein sequence: YGRKKRRQRRR (SEQ ID No. 5).

[0064] The construct sequence fused with SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 4 was inserted into the pTR plasmid. The plasmid was digested with Age I and Xho I endonucleases, and the construct sequence was ligated using a ligase. The vector contains an AAV serotype 2-terminal repeat sequence, a CMV-chicken-β actin heterozygous promoter, and WPRE, as shown below. Figure 2 As shown. The recombinant plasmid lacks... Rep and Cap The element restricts the integration of the plasmid into the host DNA.

[0065] The vector (AAV4-STUb vector) was then transformed into Escherichia coli (E. coli). Escherichia coli (Escherichia coli) E. coli (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA; SURE2 cells). Briefly, the cells were equilibrated on ice, and 1 pg of the aforementioned vector was added to *E. coli* and incubated for approximately 1 minute. The cells were then electroporated in 0.1 cm cuvettes using a BioRad Gene Pulser (1.7 V, 200 ohms). The *E. coli* were then grown in medium for 60 minutes and then plated on a medium containing ampicillin (50 g / mL). On agar (g / mL), such as ATCC 1065 (American Center for Type Culture Collection, Manassas, VA), *E. coli* was propagated in broth containing ampicillin to collect large quantities of the vector. 。

[0066] Example 3

[0067] The mouse vector characteristics of the constructs generated in Example 2 were tested in HEK293 cells (Manassas, VA, USA). HEK293 cells were grown in Dulbecco's Modified Essential Medium (DMEM) containing 10% FBS and 1% Pen / Strep at 37°C and 5% CO2, and passaged at 80% confluence.

[0068] The vector (2 μg / well in a 6-well plate) was transfected into the cells using the PEI transfection method. Two days before transfection, the cells were cultured in 6-well plates at a concentration of 0.5 x 10⁶ cells / well. 6 Cells / well were passaged in DMEM medium. The medium was changed the night before transfection. Endotoxin-free dH2O was heated to approximately 80°C to dissolve polyethyleneimine (Sigma-Aldrich Co. LLC, St. Louis, MO). The solution was allowed to cool to approximately 25°C and neutralized with sodium hydroxide. For each transfected well, AAV4-STUb vector or negative control (medium only) was added at a ratio of 2 µg per 200 μL to serum-free DMEM, and 9 μL of 1 μg / μl polyethyleneimine was added to the mixture in each well. The transfection mixture was incubated at room temperature for 15 minutes, then 210 μL / well was added to each cell well and incubated for 48 hours.

[0069] Culture media were collected from cells transfected with the AAV4-STUb vector, control cells transfected with culture medium only, and untransfected control cells. Western blotting was performed on the culture media, followed by staining with 0.4 µg / ml of rabbit anti-E6-AP antibody (A300-351A, Bethyl Labs, Montgomery, TX) reactive to human and mouse E6-AP. Secondary conjugation was performed using rabbit-conjugated horseradish peroxidase (Southern Biotechnology, Thermo Fisher Scientific, Inc., Waltham, MA). Results were determined by densitometry measurements, showing that HEK293 cells transfected with AAV4-STUb secreted E6-AP protein into the culture medium, as shown in the following figures. Figure 3 As shown.

[0070] Example 4

[0071] Transgenic mice are created by hybridization with the maternal parent UBE3A (Jiang et al., Mutation of the Angelman ubiquitin ligase in mice causes increased cytoplasmic p53 and deficits of contextual learning and long-term potentiation. Neuron. 1998 Oct; 21(4): 799-811; Gustin et al., Tissue-specific variation of Ube3a protein expression in rodents and in a mouse model of Angelman syndrome. Neurobiol Dis. 2010 Sep; 39(3): 283-91); Heck et al., Analysis of cerebellar function in Ube3a-deficient mice reveals novel genotype-specific behaviors. Hum The vector was derived from mice with deletions in GABARB3 (Mol Genet. 2008 Jul 15;17(14):2181-9). Mice were housed in cages with 12-hour daylight cycles and free access to food and water. Three-month-old mice were treated with the vector.

[0072] Mice were anesthetized with isoflurane and placed in a stereotaxic apparatus (51725D Digital Just for Mice Stereotaxic Instrument, Stoelting, Wood Dale, IL). A sagittal incision was made in the middle of the skull, and the surrounding skin was pushed back to enlarge the opening. The left and right hippocampi were located using the following coordinates: AP 22.7 mm, L 62.7 mm, and V 23.0 mm. Using a 10 mL Hamilton syringe, mice were administered 1 x 10 μL of 20% mannitol at a concentration of 1 x 10⁻⁶ to each hemisphere. 12Bilateral intrahippocampal injections of AAV4-STUb particles (N=2) or media (10 μL of 20% mannitol) per genomic unit / mL were administered. Wounds were cleaned with saline and closed using Vetbond (NC9286393 Fisher Scientific, Pittsburgh, PA). Control animals included uninjected AS mice and littermate wild-type mice (n=2). Mice were rehabilitated in clean, empty cages on warm heating pads and then housed individually until sacrifice. Mice were monitored throughout the experiment.

[0073] On day 30 post-treatment, the commercial euthanasia solution Somnasol was administered via intraperitoneal injection. ® Mice were euthanized (0.22 ml / kg). After euthanasia, CSF was collected and the animals were perfused with PBS, and the brains were removed. The brains were fixed overnight in 4% paraformaldehyde solution and then cryoprotected in sucrose solution. The brains were sectioned at 25 μm using a microtome.

[0074] Most studies on recombinant adeno-associated virus vectors involve direct injection of the vector into the parenchyma, which typically results in limited cellular transduction (Li et al., Intraventricular infusion of rAAV-1-EGFP resulted in transduction in multiple regions of adult rat brain: a comparative study with rAAV2 and rAAV5 vectors. Brain Res. 2006 Nov 29; 1122(1): 1-9). However, attaching the secretion signal sequence and TAT sequence to the Ube3A protein allows for the secretion of the HECT protein (i.e., UBE3A) from transfected cells and the uptake of the peptide by adjacent neurons, thereby allowing injection into discrete sites for use as a protein supply to other parts of the brain.

[0075] Brains from euthanized mice were sectioned using a microtome, and E6-AP protein was stained with anti-E6-AP antibody (A300-351A, BethylLabs, Montgomery, TX) and biotinylated anti-rabbit secondary antibody (Vector Labs #AB-1000). Staining was performed using ABC (Vector Labs) and DAB reactions. Sections were fixed and scanned using a Zeiss Axio Scan microscope. The percentage of stained area was quantified using IAE-NearCYTE image analysis software (University of Pittsburgh Starzl Transplant Institute, Pittsburgh, PA).

[0076] Non-transgenic (Ntg) control mice showed Ube3a expression levels in the brains of normal mice, which were approximately 40%. Figure 4 As shown. In contrast, Angelman syndrome mice (AS) showed approximately 25% Ube3a protein staining levels. Insertion of the AAV4-STUb vector into the lateral ventricle of AS mice showed that the vector increased E6-AP levels to approximately 30-35%.

[0077] Immunohistochemical analysis of brain slices, using region-specific staining, showed that non-transgenic mice had relatively high levels of E6-AP, such as... Figure 5 and 6 As shown. As expected, in the Angelman syndrome model mice, the E6-AP staining pattern was similar, but the level of E6-AP was sharply reduced, such as... Figure 7 and 8 As shown, administering the mouse UBE3A vector to Angelman syndrome model mice did increase E6-AP levels, but not to the levels seen in non-transgenic mice. Figure 9 and 10 As shown. Detailed analysis of the lateral ventricle revealed that injection of the UBE3A carrier resulted in its uptake by ependymal cells, such as... Figure 11 As shown. However, in addition to the uptake of the UBE3A carrier and expression of E6-AP by ependymal cells, adjacent cells in the parenchyma are also positively stained for E6-AP, as indicated by the arrows in the figure. Furthermore, staining was observed in more distal locations, such as in the third ventricle, as shown in the figure. Figure 12 As shown. This indicates that E6-AP is being secreted by transfected cells and successfully taken up by neighboring cells, confirming that this construct can be used to introduce E6-AP and that the E6-AP construct can be used as a therapeutic agent to treat E6-AP expression defects in the whole brain, such as Angelman syndrome. The control treatment using the AAV4-GFP vector did not show uptake of the control protein, as shown. Figure 13 As shown, this is because only ependymal and choroid plexus cells were transduced.

[0078] Detailed analysis of coronal sections in Angelman syndrome model mice confirmed that administration of the UBE3A construct increased E6-AP levels in and around the lateral ventricles, such as... Figures 14 to 20 As shown.

[0079] Example 5

[0080] Human vector constructs were generated using pTR plasmids. The Homo sapiens UBE3A gene was formed from the following cDNA (AH005553.1): ggagtagttt actgagccac taatctaag tttaatactg tgagtgaata ccagtgagtacctttgtta tgtggataac caatacttgg ctataggaag tttttagtt gtgtgtttta tnacacgtatttgactttgt gaatattat ggcttataat tg ttgttagtctcctt ttacagtttcctttaaaaa catgcattga gttttttaat agtccaaccc ttaaaaaaa tgtgttgtat ggccacctgatctgaccact ttcttcatg ttgacatctt taattttaa actgttttat ttagtgctt aatcttgttnacaaaggtagttgt tgattagtcttcct atattttgc taactgtttctcaattgcat tttacagatc aggagaacct cagtctgacg acattgaagc tagccgaatg tagtgtacttggttgaga ctgtggttct tattttgagt tgcctagac tgctttaaat tacgtcacat agggattactgaattaattaat gggagatagg aacataccta ctttttctcagataa ctcataacct cggtaacagt ttactaggtt tctactacta gatagataa tgcacacgcttaattctta gtctttgc tccctgta gcagttgtag ggaataggg aggttgagga agacttactacctacag gttatagata cagagatgcg taatattagttttcaccct acagaaattt atattact cagagtgaa agatgcagaa gcaatatt tcagtcactgaggtagaatg gtatccaaaatacaatagta acatgaagga gtactggagt accaggtatg caataggaatctagtgtaga tggcaggga gtaagagtgg ccaggaaatg ctaagttcag tcttgaaatg tgactgggaatcaggcagct atcaactata agtcaaatgt ttacaagctg ttaaaaatga aatactgatt atgtaaaagaaaaccggatt gatgctttaa atagactcat tttcntaatg ctaattttta aaatgataga atcctacaantcttagctgt aaaccttgtg atttttcagc tgttgtacta aacaacttaa gcacatatac catcagacaagcccccntcc ccccttttaa accaaagga tgtatactct gttaatacag tcagtaagca ttgacattctttatcataat atcctagaaa atatttatta actatttcac tagtcaggag ttgtggtaaa tagtgcatctccattttcta cttctcatct tcatacacag gttaatcact tcagtgcttg actaacttt gccttgatgatatgttgagc tttgtacttg agagctgtac taatcactgt gcttattgtt tgaatgtttg gtacaggaagcgagcagctg caaagcatct aatagaacgc tactaccacc agttaactga gggctgtgga aatgaagcctgcacgaatga gttttgtgct tcctgtccaa cttttcttcg tatggataat aatgcagcag ctattaaagccctcgagctt tataagatta atgcaaaact ctgtgatcct catccctcca agaaaggagc aagctcagcttaccttgaga actcgaaagg tgcccccaac aactcctgct ctgagataaa aatgaacaag aaaggcgctagaattgattt taaaggtaag atgttttattttcaattgag aattgttgcc tgaaaaccat gtgggagatttaaatgtatt agtttatt tgttttttct tctgtgacat aagacattt tgatatcgta gaaccaatttttgtgg taacggacag ggataataac acattttac aggtctaatc atccagtagtagttattattat tgatttgaac tttttaaaat tcttaggaaa aatgtattaagtgtagtga atctccaaa ctattaaga gctgtattat gattaatcag tacatgacat attggttcatatttattat aaagctatac attaatagat atcttgatta taaagaaagt gattacattagttagattagatta ggtcattggt ataggtaggt agttcattgaaaaaatagg taagcattaa atttgttg ctgaatctaa gtattagata ctttaagagt tgtatatcataatt gagcctagaa tgtttggctg ttttacttt agactttt gcaacagagtat tattattagattaccacata ctgattttct agatgtgact tacttacag agagaaggtatatgaatt cttgaattat gtagagaaag agaggattat tcccctta tccgttat tggagagttttctagtg ctgaggcatt ggtacagagc tccggacagaat caccacagaagga gagaaggaa aagatgaaaa ggaaaaagct gcatgttctg ctgctgctatggaagac tcagaagcat ctcctcaag gataggtgatagctcacagg gagacaacaa ttgcaaaataggccctg atgatgtgtc tgtggatatt gatgccatta gaagggtcta caccagattg ctctctaatgaaaaaattga aactgccttt ctcaatgcac ttgtatattt gtcacctaac gtggaatgtg acttgacgtagtatcaatg tacctactatctact tctgaatttg ttcattatcg taatggagaa tagaaatctccacagtcctg aatatctgga aatggctttg ccattatttt gcaaagcgat gagcaagcta ccccttgcagcccaaggaaa actgatcaga ctgtggtcta aatacaatgc agaccagatt cggagaatga tggagacatttcacttcaattacaattac aacgtcgaa atctagtgaa tgatgatgatgccattgttg ctgcttcgaa gtgcttgaaa atggtttact atgcaaatgt agtgggaggg gaagtggacacaaatcacaa tgaagaagat gatgaagagc ccatccctga gtccagcgag ctgacacttc aggaacttgac tcgagtggac cccctggaaa ctgaacttgg tgttaaaaccctggattgtc gaaaaccact tatccctttt gaagagttta ttaatgaacc actgaatgag gttctagaaatggataaaga tttacttttt ttcaaagtag aaacagagaa caaattctct tttatgacat gtcccttta gttaggattcagattc atattatgac aatagaattc gcatgtacag tgaacgaagaatcactgttc tctacagctt agttcaagga cagcagttga atccatatttgagactcaaa gttagacgtgaccatatcat agatgatgca cttgtccggg taagttgggc tgctagatta aaaacctaat aatggggatatcatgataca gttcagtgaa ttcattttaa aagtgactga aaaaaatgat accatatagc ataggacacatggacattactttt cttagttagt aagtttatag atgtgttctacaaagtatcg gttgtattat ataatggtca tgctatcttt gaaaaagaat gggttctta aatcttgaaaactaaatcca aagttctt cattcagaag agatagagt gttgacaaa gaccagacat gaccagaaca agagaatgtggagatctc agatggatagt ggtacagtaa aaccataccataaaattata ggtagtgtcc aaaaaatttcc atcgtgtaaa attcagagtt gcattattgt ggacttgaagaagcagttgt atgtgggacg gtacgataa gcttgatatc gattcctgc agcccggggg atccattagtagttaagttagtcc ctgctttagt attcagtgta tttctttattgaaatatt taacttatga cttagtagat actaagactt aacccttgag ttctattct aaaaggactactaatga caatttgag gttagacctc tactccattg tttttgctga aatgatttag ctgctcattcagcatg agtataaaa tcttattaa tgtagtta atttcataacaatcagtaa agttagctt ttactgct agtgtctgtt tgtgtctgt ctttttgattatctttaagactgaatcttt gtcttcactg gctttttatc agtttgcttt ctgtttccat ttacatacaa aaagtcaaaaatttgtattt gtttcctaat cctactcctt gtttttattt tgtttttttc ctgatactag caatcatcttcttttcatgt ttatcttttc aatcactagc tagagatgat cgctatggaa aatcctgcag acttgaagaagcagttgtat gtggaatttg aaggagaaca aggagttgat gagggaggtg tttccaaaga attttttcagctggttgtgg aggaaatctt caatccagat attggtaaat acattagtaa tgtgattatg gtgtcgtatcatcttttgag ttagttattt gtttatctta ctttgtaaat attttcagct atgaagagca gcaaaagaaggatttggtat ggattaccca gaatcacaca tcatgactga atttgtaggt tttaggaact gatttgtatcactaatttat tcaaattctt ttatttctta gaaggaatat tctaatgaag gaaattatct ctttggtaaactgaattgaa agcactttag aatggtatat tggaacagtt ggagggattt ctttgctttt tgttgtctaaaaccatcatc aaactcacgg ttttcctgac ctgtgaactt caaagaacaa tggtttgaag agtattgagagactgtctca caagtatgtc atgctcaaag ttcagaaaca ctagctgata tcacattaat taggtttatttgctataaga tttcttgggg cttaatatan gtagtgttcc cccaaacttt ttgaactcca gaactcttttctgccctaac agtagctact caggagctga ggcaggagaa ttgtttgaac ctaggaggcagaggttgcagtgagctgaga tcgtgccact ccagcccacc cctgggtaac agagcgagac tccatctca agaaaaaatgaaaaattgt ttcaaaat agtacgtgtg gtacagatat aagtattat atttttaata atgaacat tgttttttattattattat tcagctatgg gtggataaag catgaataataactttctta tgtgttagta gaaaattaga aagcttgaat tttattaacg tattttcta cccgatgccaccaaattact tactacttta ttccttgc ttcataagtaat tacatatcac cattcaccc aatttata tggacacatattgtgt agaaatcaat gttgcatgcc taattacatatattttaaat gtttatatg cataattatt ttaagtttat atttgtatta ttcatcagtc cttaataaatacaaagta atgttattttt aaaaatcatt tcttataggt atgttcacat acgatgaatc tacaaattgttgattcattgttctt gattcattta atccatta ttactctgat tggcatagta ctgggtctggctatttacaa taactgtata ctggatgtac atttcccat ggttgtctac aggaagcta tgggaaaaaggaacttt cgtgactgg gagactctca cccagtagcaagt tcttgtcat ttttcaatttaatttagatt cagttcat tgtcaaatt ttaagtttt tgtttagaat ctttgttgatactctca atagataaa aatgttttaa gtaccagaaa cacttaaaactcaaagggggacatttta tatattgctg tcagcacgaa gctttcgtaa gattgatttc atagagaagt gttctaacattttgttg tgtttagtg aaatcttaag agatagtaa aaatcagagt agccctgct aagggtcttgttacaa cgacctcagcctaccccc acaccacaga attctcatagagcagtg tgaattctat tgctaaattg gtgtaggg gttctcagc agagaatggg acatcacagtgactgacaat ctttcttta taggttggaa actatttggg gggactggagg gatctgtct acactttacattagattagattagattttat tataagatttat ttatttgttg tattttgtagttctatgtg gcctacaattt accattctg gttgctaggt tctatatcag agtttaaag atttattggagtatgaaggg aatgtggaag atgacatgat gatcacttc cagatatcaac agacagatct ttttggtaacccagatgt cagattacaattac tgaaaaacagg aaggtaataatgtttat gtcacatttt gtctctcat taacactttc aaagcatgta tgcttataat ttttaaagaagtatctaata tagtctgtac aaaaaaaaaa caagtaacta agttatagta atgctagag gccacttcagttaagttaagttcgt gcactaaagc cccttttaga gaagaggacatgaagcagg agatagttaa tagctaagtg tggttgtagt ataagcaag aagcagggtgtttcttgtattaagctgtaa gcaggaacct catgattaag gtctttatca cagacaaat aaaaattaca tttaatttacatgtatat cctgttgtg aaaaatac atttctgaaa agtatactt acgtcagatt tggttctattgactaaaat gtcaccattcatcat aaaaaattat gatatagtatacct ttagaaaca tgttatatatt gatataattt tttgatttaa tattatacac actaagggtacaangcat tttcctttta tganttngat acagtagttt atgtgtcagt cagatacttc cacatttgctgaactgga tacatagcataagc nggacttcct ggtttgcttaaatcaatat attgtactct cttaaaacgg ttggcattta taaatagatg gatacatggt ttaatgtgtcttcttnacat acctagttga gagaacctaa agaatttct gcgtctcag catttatat cagttcattagattatattatatatagttatcatcatga t ggccttttca tagcttaatattggctgtaa cagagaattg tgaaattgta agaagtagtt ttcttgtag gtgtaaatt gatttttaagaatattctt gabagtttta tgtatatggc ctttcatag cttaatactg gctatacag agaattgtgaattagaattgttgaat aagattag a gttttttct tggaaaaattaaaaagctat gcagcccaat aacttgtgtt tgtttgcat agcatattat aagaagttcttgtgattaatgtttctaca ggaatttgtc aatctttatt ctgactacat tctcataaa tcagtagaaaacagttcaggctttcgg agaggttc atatggtgac caatgaatct cccttaaagt attagagtcag accagaagaattgaggtgtgc atatagtgc tgtctgcaaa aagtcatgta tcgatttattgttgtaatg atacagtagt atagcagata actaagacat attttcttga atttgcagaa tctagattccaagcactag aagaaactac tgttgactgactt caggactagt aggt caaaggggtg tgtgatttg cttcagacct ttatctctaggtactattc ccaataagc aaactcacaa attgtcattct cagagctag attgtattt gtatataatcatttt cagagctt cttgtgattttcatcatgaa tgaagtgttg ttatattagtag gtattagtaa ggattatcta gtattctag ctggttagag tatgcttact gctggttagagaatattaa ataaggcta ccatgtctgc aatttctct ttctttga ctctgcattt gtgaactgttacatggctc ccaggatca gcactttg agtgacttaccatagattagattag tag atactagtat ttcatttta caccctaaaa aactaagccc tgaattca cagaagatgtagaggttcc cagttctatc tgctttaaa caatgccct tactactcta ctgtctacttctgtgtactacatcatcgta tgtagttgtt tgcatttggg ccagttggtt ggggcagggg tcttttttc tttgtcccttaatctgtat cactttttcc tcccaaagtt gagttaaagg atgagtagac caggagaata aaggaaaggataaataaa atatataccc aaaggcacct ggagttaatt tttccaaata ttcatttcag tcttttcaattcataggat tttgtcttt gctcattact gactgcataa tgtgattata ccatagttta aatagtcacttcctgttat acacacttgg gttttctcaa tttttacta ttgtagtact aatattttc tatattgtaatctaatccaa atttttacgt attcagagct gttcaggata aatttgcttg gaaattttta aatcaccagaagtgatacta tcctgataat taacttccaa gttgtctctt aatatagttt taatgcaaat cataagcttatgttagtacc agtcataatg aatgccaaac tgaaaccagt attgttttt ttctcattag ggagttctgggaaatcgttc attcatttac agatgaacag aaaagactct tcttgcagtt tacaacgggc agacacagagcacctgtggg aggactagga aaattaaaga tgattatagc caaaaatggc ccagacacag aaaggtagtaattattaac ttgtgactgt atacctaccg aaaaccttgc attcctcgtc acatacatat gaactgtctttatagtttct gagcacattc gtgattttat atacaaatcc ccaaatcata ttagacaatt gagaaaaactttgctgtca ttgtgtgagg aaacttttaa gaaattgccc tagttaaaaa ttattatggggctcacattggtttggaatc aaattagtgt gattcattta cttttttgat tcccagcttg ttaattgaaa gccatataacatgatcatct atttagaatg gttacattga ggctcggaag attatcattt gattgtgcta gaatcctgttatcaaatcat tttcttagtc atattgccag cagtgtttct aataagcatt taagagcaca cactttgcagtcttgtaaaa caggtttgag tattttctcc accttagagg aagttacttg acttctcagt gacctaacctctaaagtgca tttactgatg tcctctctgt ggttttgttg tggaaagatt tagttaaatg aactgtaagaattcagtacc taaaatggta tctgttatgt agtaaaaact caatggatac agtatcttat catcgtcactagctttgagt aatttatagg ataaaggcaa cttggtagtt acacaacaaa aagtttatga tttgcattaatgtatagttt gcattgcaga ccgtctcaac tatatacaat ctaaaaatag gagcatttaa ttctaagtgtatttcccatg acttacagtt ttcctgtttt tttccccttt tctctattta ggttacctac atctcatacttgctttaatg tgcttttact tccggaatac tcaagcaaag aaaaacttaa agagagattg ttgaaggccatcacgtatgc caaaggattt ggcatgctgt aaaacaaaac aaaacaaaat aaaacaaaaa aaaggaaggaaaaaaaaaga aaaaatttaa aaaattttaa aaatataacg agggataaat ttt (SEQ ID NO. 6), which encodes: MKRAAAKHLIERYYHQLTEGCGNEACTNEFCASCPTFLRMDNNAAAIKALELYKINAKLCDPHPSKKGASSAYLENSKGAPNNSCSEIKMNKKGARIDFKDVTYLTEEKVYEILELCREREDYSPLIRVIGRVFSSAEALVQSFRKVKQHTKEELKSLQAKDEDKDEDEKEKAACSAAAMEEDSEASSSRIGDSSQGDNNLQKLGPDDVSVDIDAIRRVYTRLLSNEKIETAFLNALVYLSPNVECDLTYHNVYSRDPNYLNLFIIVMENRNLHSPEYLEMALPLFCKAMSKLPLAAQGKLIRLWSKYNADQIRRMMETFQQLITYKVISNEFNSRNLVNDDDAIVAASKCLKMVYYANVVGGEVDTNHNEEDDEEPIPESSELTLQELLGEERRNKKGPRVDPLETELGVKTLDCRKPLIPFEEFINEPLNEVLEMDKDYTFFKVETENKFSFMTCPFILNAVTKNLGLYYDNRIRMYSERRITVLYSLVQGQQLNPYLRLKVRRDHIIDDALVRLEMIAMENPADLKKQLYVEFEGEQGVDEGGVSKEFFQLVVEEIFNPDIGMFTYDESTKLFWFNPSSFETEGQFTLIGIVLGLAIYNNCILDVHFPMVVYRKLMGKKGTFRDLGDSHPVLYQSLKDLLEYEGNVEDDMMITFQISQTDLFGNPMMYDLKENGDKIPITNENRKEFVNLYSDYILNKSVEKQFKAFRRGFHMVTNESPLKYLFRPEEIELLICGSRNLDFQALEETTEYDGGYTRDSVLIREFWEIVHSFTDEQKRLFLQFTTGTDRAPVGGLGKLKMIIAKNGPDTERLPTSHTCFNVLLLPEYSSKEKLKERLLKAITYAKGFGML (SEQ ID No. 7).

[0081] The above cDNA is subcloned and sequenced. The UBE3A gene (SEQ ID No. 6) is fused to one of three genes encoding a secretion signal peptide, said three genes being GDNF-based: ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCC (SEQ ID No.8), From insulin protein: ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCC (SEQ ID No. 9), Or from IgK: ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT (SEQ ID No. 10).

[0082] The construct was inserted into the hSTUb vector under the CMV chicken-β actin hybrid promoter or the human ubiquitin c promoter. The marmot hepatitis post-transcriptional regulatory element (WPRE) was present to increase expression levels.

[0083] Then, the UBE3A secretion signaling construct was linked to a cellular uptake peptide (cell penetration peptide); the peptide is an HIV TAT sequence.

[0084] YGRKKRRQRRR (SEQ ID No. 5); or

[0085] HIV TATk sequence

[0086] YARKAARQARA (SEQ ID No. 11).

[0087] Then, using the thermal shock method described in Example 2, as shown in Example 2, ... Figure 21 The human UBE3A vector shown was transformed into Escherichia coli. The transformed E. coli were multiplied in a broth containing ampicillin to select for the vector and collect a large number of vectors.

[0088] Other sequences of UBE3A include variants 1, 2, or 3, as shown below: Homo sapiens UBE3A variant 1:

[0089] Homo sapiens UBE3A variant 2:

[0090] Homo sapiens UBE3A variant 3:

[0091] Example 6

[0092] Human vector characteristics were tested in HEK293 cells (Manassas, VA, USA), which were grown in DMEM containing 10% FBS and 1% Pen / Strep at 37°C and passaged at 80% confluence.

[0093] The vector (2 μg / well in a 6-well plate) was transfected into the cells using the PEI transfection method. Two days before transfection, the cells were cultured in 6-well plates with DMEM medium at a concentration of 0.5 x 10⁻⁶ mg / well. 6 Cells / well passaged. The medium was changed the night before transfection. Endotoxin-free dH2O was heated to approximately 80°C to dissolve the polyethyleneimine (Sigma-Aldrich Co. LLC, St. Louis, MO). The solution was allowed to cool to approximately 25°C and neutralized with sodium hydroxide. For each transfected well, AAV4-STUb vector or negative control (medium only) was added at a ratio of 2 µg per 200 μL to serum-free DMEM, and 9 μl of 1 μg / μl polyethyleneimine was added to the mixture in each well. The transfection mixture was incubated at room temperature for 15 minutes, then added at 210 μL / well to each cell well and incubated for 48 hours. Cells and medium were harvested by scraping cells from the plate. The medium and cells were then centrifuged at 5000 xg for 5 minutes.

[0094] For Western blotting of the extract, the cell pellet was resuspended in 50 μL of hypotonic buffer and lysed by three freeze-thaw cycles. 15 µL of the lysate was heated with Laemmli sample buffer and run on a BioRad 4-20% acrylamide gel. The lysate was transferred to a nitrocellulose membrane using TransBlot. The blot was blocked with 5% milk, and protein was detected using an anti-E6AP antibody.

[0095] like Figure 22As shown, cells transfected with the construct expressed the UBE3A gene, namely E6-AP. Furthermore, attaching this gene to various secretion signals exhibited mixed results based on the secretion signal peptide. For example, transfection using a construct based on the GDNF secretion signal resulted in lower expression and no detectable secretion from transfected cells, such as... Figure 23 As shown. Insulin secretion signaling resulted in moderate secretion of E6AP from transfected cells, and high expression of the construct within said cells. The results of insulin signaling secretion were confirmed using a construct tagged with HA, as shown. Figure 24 As shown.

[0096] In the foregoing description, all disclosed documents, actions, or information do not constitute an admission that any combination of such documents, actions, or information is publicly available, publicly known, part of the general knowledge in the art, or known at the priority date to be relevant to solving any problem.

[0097] The public content of all the publications cited above is expressly incorporated into this text in its entirety by reference to the same extent as it is incorporated individually by reference.

[0098] While specific embodiments of the method for treating UBE3A defects have been described and illustrated, it will be apparent to those skilled in the art that variations and modifications are possible without departing from the broad spirit and principles of the invention. It should also be understood that the claims are intended to cover all superordinate and subordinate features of the invention described herein, as well as all statements of the scope of the invention that may be considered to fall within the scope of the invention as a matter of language.

Claims

1. A therapeutically effective amount of UBE3A adeno-associated virus (AAV) vector for treating synaptic dysfunction associated with UBE3A deficiency, said vector comprising: Transcription initiation sequence, wherein the transcription initiation sequence is a cytomegalovirus chicken-β actin heterozygous promoter or a human ubiquitin c promoter; The UBE3A sequence is positioned downstream of the transcription initiation sequence, wherein the UBE3A sequence is SEQ ID No. 12; A secretory sequence positioned downstream of the transcription initiation sequence, wherein the secretory sequence is SEQ ID No. 2; and A cell uptake sequence located downstream of the transcription initiation sequence and between the secretion sequence and the UBE3A sequence, wherein the cell uptake sequence is SEQ ID No. 4; The viral load was effective in expressing secreted E6-associated protein (E6-AP) and rescuing E6-AP function in non-transduced brain cells in subjects with UBE3A deficiency.

2. The vector of claim 1, further comprising a cytomegalovirus immediate early enhancer sequence disposed upstream of the transcription initiation sequence.

3. The vector of claim 1, further comprising a post-transcriptional regulatory element for marmot hepatitis.

4. The vector of claim 1, wherein the cell uptake sequence is positioned upstream of the UBE3A sequence and downstream of the secretion sequence.

5. A method for synthesizing a UBE3A vector, comprising: Provide backbone plasmids; The backbone plasmid has a cytomegalovirus immediate early enhancer sequence positioned upstream of the transcription initiation sequence, wherein the transcription initiation sequence is a cytomegalovirus chicken-β actin heterozygous promoter or a human ubiquitin c promoter; The UBE3A construct is formed, which also includes: Provide a UBE3A sequence, wherein the UBE3A sequence is SEQ ID No. 12; The secretion sequence and the cellular uptake sequence are appended to the UBE3A sequence, wherein the cellular uptake sequence is between the secretion sequence and the UBE3A sequence, wherein the secretion sequence is SEQ ID No. 2; and The cellular uptake sequence is SEQ ID No. 4; The UBE3A construct is inserted downstream of the transcription initiation sequence.

6. The method of claim 5, further comprising: The vector is inserted into the amplification host; The amplified host undergoes antibiotic selection; The backbone plasmid contains an antibiotic resistance gene; The amplified host was proliferated in a culture medium containing the selected antibiotic; Collect the amplified host that has proliferated; and The vector is isolated from the amplified host.

7. The method of claim 6, wherein the antibiotic resistance gene is an ampicillin resistance gene, and wherein the antibiotic selection is ampicillin selection.

8. The method of claim 5, further comprising: The backbone plasmid is cleaved with at least one endonuclease; and The UBE3A construct is attached to the cut end of the backbone plasmid.

9. The method of claim 5, wherein the plasmid is based on recombinant adeno-associated virus serotype 2, and wherein the plasmid based on recombinant adeno-associated virus serotype 2 lacks DNA integration elements.

10. Use of a UBE3A carrier in the preparation of a medicament for treating synaptic dysfunction in patients with UBE3A deficiency, wherein the carrier comprises: Transcription initiation sequence, wherein the transcription initiation sequence is a cytomegalovirus chicken-β actin heterozygous promoter or a human ubiquitin c promoter; The UBE3A sequence is positioned downstream of the transcription initiation sequence, wherein the UBE3A sequence is SEQ ID No. 12; A secretory sequence located downstream of the transcription initiation sequence, wherein the secretory sequence is SEQ ID No. 2; A cell uptake sequence positioned downstream of the transcription initiation sequence and between the secretion sequence and the UBE3A sequence, wherein the cell uptake sequence is SEQ ID No. 4; and The UBE3A deficiency disorder mentioned above is Angelman syndrome, Prad-Willi syndrome, or Huntington's disease. In this process, cells transfected with the UBE3A vector express a therapeutically effective amount of E6-associated protein (E6-AP), which is then secreted and taken up by brain cells with E6-AP expression defects to treat synaptic dysfunction.

11. The use of claim 10, wherein the carrier is injected into the brain of a patient suffering from UBE3A deficiency disease.

12. The use of claim 11, wherein the carrier is injected into the hippocampus or ventricle.

13. The use of claim 12, wherein the carrier is injected bilaterally.

14. The use of claim 11, wherein the carrier is approximately 5.55 x 10 11 Genomes per gram of brain mass approximately 2.86 x 10⁻⁶ 12 Genomic / Brain Quality Application.

15. The use of claim 11, wherein the carrier is 5.55 x 10 11 Genomes / gram brain mass up to 2.86 x 10⁻⁶ 12 Genome / gram brain mass, 2.86 x 10⁻⁶ 12 Genome / gram brain mass, 2.40 x 10⁻⁶ 12 Genome / gram brain mass, 9.80 x 10 11 Genomes / gram brain mass or 5.55 x 10 11 Genomic / Brain Quality Application.

Images