Chicken CTSD gene lentivirus vector, construction method and application thereof

CN122772931APending Publication Date: 2026-09-18JIANGSU INST OF POULTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610941546.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-28
Publication Date
2026-09-18

AI Technical Summary

Technical Problem

有研究报道CTSD在人类胃癌、乳腺癌等疾病调控中发挥一定的作用,但CTSD基因与肌肉发育关联研究尚未见相关报道,且现有技术中并未有利用CTSD慢病毒表达载体外源过表达CTSD基因的相关报道

Benefits of technology

[0022] The present invention has the following beneficial effects: by constructing a lentiviral vector for overexpressing the CTSD gene, it not only significantly improves the transfection efficiency of primary myoblasts and greatly increases the success rate of integrating the CTSD gene into the myoblast genome, but also rapidly constructs an in vitro high-efficiency expression model of the CTSD gene, thereby effectively screening and obtaining functional gene molecular markers related to muscle development regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122772931A_ABST
    Figure CN122772931A_ABST
Patent Text Reader

Abstract

The application discloses a chicken CTSD gene lentivirus vector and a construction method and application thereof, and belongs to the technical field of molecular biology. The construction method comprises the following steps: designing primers according to a CDS sequence of a chicken CTSD gene, and acquiring a full-length CDS fragment through PCR amplification; performing double enzyme digestion on the CDS product and an LV5 vector respectively through NotI and BamHI, transforming TOP10 competent cells after directional ligation, screening positive clones, and verifying sequencing to obtain an expression vector plasmid; co-transfecting the expression vector plasmid with pGag / Pol, pRev and pVSV-G packaging plasmids into 293T cells, collecting lentivirus through packaging, and detecting titer, so that a CTSD gene lentivirus recombinant vector is obtained. The vector can efficiently transfect chicken primary myoblasts and stably overexpress the CTSD gene, and provides an effective tool for studying a chicken muscle development regulation mechanism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to a method for constructing and applying a lentiviral recombinant vector that stably overexpresses the CTSD gene in chicken myoblasts. Background Technology

[0002] Primary myoblasts in chickens are the core functional cells regulating broiler muscle development and mediating meat quality formation. Their proliferation and differentiation characteristics, as well as their interaction patterns with adipocytes, directly determine the morphology, structure, and physicochemical properties of muscle tissue, thereby regulating various core indicators of meat quality in multiple dimensions. Specifically, the differentiation rate and direction of myoblasts directly dominate the type, number, and diameter characteristics of muscle fibers; while the proportion, thickness, and distribution density of muscle fiber types are key factors determining broiler muscle yield, palatability, and other meat quality traits. Based on these regulatory mechanisms, breeding new broiler breeds and specialized lines with a high proportion of slow-twitch muscle fibers, moderate fiber diameter, and uniform distribution has become a core objective of modern broiler breeding. Furthermore, in-depth exploration and systematic analysis of key functional genes regulating broiler muscle development can effectively shorten the generation interval of high-quality broiler breeds (lines) and significantly accelerate the process of molecular breeding and germplasm innovation for high-quality broilers.

[0003] The CTSD gene encodes a lysosomal aspartic protease, primarily involved in protein hydrolysis and degradation. Studies have reported that CTSD plays a role in the regulation of diseases such as gastric and breast cancer in humans; however, there are no reports on the association between the CTSD gene and muscle development, and current technologies lack reports on the exogenous overexpression of the CTSD gene using lentiviral expression vectors. Therefore, using lentiviral expression vectors to exogenously overexpress the CTSD gene and confirm its role in chicken myoblast differentiation could serve as a molecular marker for molecular genetic breeding of high-quality broiler pectoral muscle development, accelerating breeding progress. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a CTSD gene lentiviral vector, its construction method, and its application.

[0005] First, based on the CTSD gene CDS sequence published in GenBank, the target gene was retrieved using PCR. Then, the CTSD gene and LV5 vector were digested with enzymes, and the digestion products were purified and ligated. The ligation products were transformed into TOP10 competent cells, and positive clones were sequenced and sequence aligned. Those with completely matching sequences were considered successfully constructed CTSD gene expression plasmid vectors. All constructed CTSD recombinant plasmids were ultrapurely extracted and then lentiviral packaging was performed: packaging plasmids (pGag / Pol, pRev, pVSV-G) and the successfully constructed CTSD gene expression vector plasmids were co-transfected into 293T cells. After lentiviral packaging and collection, titer analysis was performed. Finally, the constructed CTSD overexpression lentiviral vector was transfected into myoblasts, and the expression level of the CTSD gene was detected to explore its regulatory effect on muscle.

[0006] To achieve the above objectives, the present invention is implemented through the following solution: In a first aspect, the present invention provides a lentiviral recombinant vector for stable overexpression of the CTSD gene in primary chicken myoblasts. The lentiviral recombinant vector contains the full-length CDS sequence of the chicken CTSD gene, and the lentiviral recombinant vector is constructed by directional ligation of an LV5 vector and the full-length CDS sequence of the chicken CTSD gene through NotI and BamHI double restriction enzyme sites. The lentiviral recombinant vector can stably overexpress the CTSD gene in primary chicken myoblasts.

[0007] Secondly, the present invention provides a method for constructing a lentiviral recombinant vector for stable overexpression of the CTSD gene in chicken primary myoblasts, comprising the following steps: Step 1: Obtain the full-length CDS amplification product of the chicken CTSD gene by PCR and purify it; Step 2: The full-length CDS amplification product of the CTSD gene obtained in Step 1 is double-digested with NotI and BamHI to obtain the digested target gene fragment. Step 3: The LV5 vector was double-digested with NotI and BamHI to obtain the linearized LV5 vector; Step 4: Purify the enzyme digestion products obtained in Step 2 and Step 3, and then perform directional ligation of the purified target gene fragment with the linearized LV5 vector to obtain the ligation product. Step 5: Transform the ligation product obtained in Step 4 into TOP10 competent cells, culture them, pick clones, and perform sequencing verification and sequence alignment on positive clones. The plasmids that are completely correct in sequence alignment are the successfully constructed CTSD gene expression vector plasmids. Step 6: The CTSD gene expression vector plasmid successfully constructed in Step 5 is subjected to ultrapure extraction. Then, the extracted CTSD gene expression vector plasmid and packaging plasmid are co-transfected into 293T cells for lentivirus packaging, collection, and titer detection to obtain the CTSD gene lentiviral recombinant vector.

[0008] Further, the step 1, which involves obtaining and purifying the full-length CDS amplification product of the chicken CTSD gene using PCR, specifically includes: Step 1.1: Design primers based on the CDS sequence of the CTSD (NM_205177.2) gene published in GenBank. The CDS sequence of the CTSD gene is shown in SEQ ID NO.1. The 5′ end of the upstream primer contains sequences homologous to the NotI site on the LV5 vector, and the 5′ end of the downstream primer contains sequences homologous to the BamHI site on the LV5 vector. Step 1.2: Using the primers designed in Step 1.1, perform PCR amplification with a template containing the full-length CDS of the chicken CTSD gene; Step 1.3: After the PCR reaction is completed, the full-length CDS amplification product of the chicken CTSD gene is separated by agarose gel electrophoresis and the gel is cut and recovered.

[0009] Further, the primer sequences described in step 1.1 are as follows: Upstream primer: 5′- GGTTCCAAGCTTAAGCGGCCGCGCCACCatggcgccccgcggccttctcgtcctgctgctcctcg -3′; Downstream primer 5′-tcagtagagagtgtcggatccttagacacatttggcgaaaccaacagagtcgttatcacggtcaa-3′.

[0010] Furthermore, the reaction conditions for the double digestion in step 2 are as follows: digestion at 37°C for 2 hours, the digestion system is 10× Buffer: 5 μl, CTSD gene full-length CDS product: 42 μl, BamHI and NotI 1.5 μl each.

[0011] Further, in step 3, the LV5 vector was digested with enzymes at 37°C for 2 hours. The enzyme digestion system was as follows: 10×Buffer: 5µl, LV5 vector DNA: 15µl, NotI: 1µl, BamHI: 1µl, ddH2O: 28µl.

[0012] Further, the reaction system for the directional ligation in step 4 is: 4 μl of 5×CE Entry Buffer, 1 μl of purified target gene fragment, 2 μl of linearized LV5 vector, 2 μl of Exnase Entry and 11 μl of ddH2O; after the ligation reaction is completed, the reaction tube is placed in an ice-water bath to cool for 5 minutes.

[0013] Further, the transformation of the ligation product into TOP10 competent cells described in step 5 specifically includes: adding 10 μl of the ligation product to the TOP10 competent cells, gently mixing, and then incubating on ice for 30 minutes; placing the centrifuge tube in a 42°C water bath for 90 seconds for heat shock, and then quickly transferring it to an ice bath for 3 minutes to cool; adding 800 μl of antibiotic-free LB medium to the centrifuge tube, and reviving and culturing it at 37°C and 250 r / min on a shaker for 45 minutes; taking 200 μl of the revived bacterial solution and spreading it evenly on an LB plate containing 50 μg / ml ampicillin, and after the liquid is completely absorbed, inverting the plate and incubating it in a 37°C incubator for 16 hours.

[0014] Further, step 5 involves sequencing and analyzing positive clones. Specifically, clone colonies are picked from the plate, plasmids are extracted and identified to identify positive clones. The procedure is as follows: Individual, plump colonies are picked from the cultured plate and inoculated with 5 ml of 50 µg / ml Ampicillin. In LB medium tubes, bacteria were cultured on a shaker at 37°C and 250 rpm for 16 h. Plasmids were extracted from the cultured bacterial solution. The extracted plasmids were then identified by double enzyme digestion. The total system was prepared as follows: 10×Buffer: 1 µl, plasmid: 1 µl, NotI: 0.5 µl, BamHI: 0.5 µl, ddH2O: 7 µl. The enzymes were digested at 37°C, and electrophoresis was performed 1 h later. Clones showing enzyme digestion bands at the corresponding positions of the target bands were considered positive clones. The bacterial solutions corresponding to the positive clones were sent for sequencing, and the remaining bacterial solutions were stored in glycerol. After the sequencing results were confirmed to be correct with the target gene sequence, the stored glycerol bacterial solutions were inoculated into LB medium for large-scale extraction of recombinant plasmids to obtain sufficient CTSD gene expression vector plasmids.

[0015] Furthermore, the packaging plasmids described in step 6 are pGag / Pol, pRev, and pVSV-G.

[0016] Furthermore, step 6, which involves co-transfecting the CTSD gene expression vector plasmid and packaging plasmid into cells for lentivirus packaging and collection, specifically includes: (1) When the 293T cells have reached 50%-60% confluence, take a sterile centrifuge tube, add 1.5ml of serum-free DMEM medium, then add 3μl each of CTSD gene expression vector plasmid and packaging plasmid, and mix well; take another sterile centrifuge tube, add 1.5ml of serum-free DMEM medium, then add 200μl of RNAi-Mate transfection reagent, mix well, and let stand at room temperature for 5 minutes. Then mix the two tubes and let stand at room temperature for 20-25 minutes to form a transfection mixture; add the transfection mixture to the culture medium of 293T cells and incubate at 37℃ and 5% CO2 for 4-6 hours. (2) Discard the transfection solution, add 10 ml of DMEM culture medium containing 10% FBS, and continue to incubate at 37°C and 5% CO2 for 72 hours; (3) Collect the cell supernatant in the culture dish and centrifuge at 4℃ and 4000rpm for 4 minutes; filter the supernatant after centrifugation with a 0.45μm filter; centrifuge the filtrate at 4℃ and 20000rpm for 2 hours, collect the concentrate, and store it at -80℃ to obtain the CTSD gene lentiviral recombinant vector.

[0017] Thirdly, the present invention provides the use of the CTSD gene lentiviral recombinant vector in chicken primary myoblasts.

[0018] Furthermore, the use of the CTSD gene lentiviral recombinant vector in preparing an in vitro expression model for studying the regulation of chicken muscle development.

[0019] Furthermore, the use includes transfecting the CTSD gene lentiviral recombinant vector into chicken primary myoblasts to achieve stable overexpression of the CTSD gene in chicken primary myoblasts.

[0020] Furthermore, the primary chicken myoblasts are derived from the pectoral muscle tissue of 13-year-old chickens.

[0021] Furthermore, the transfection was performed when the chicken primary myoblasts were about 50% confluent. After transfection, the cells were cultured for another 24 hours, then the culture medium was replaced with fresh medium, and the cells were cultured for another 48 hours.

[0022] The present invention has the following beneficial effects: by constructing a lentiviral vector for overexpressing the CTSD gene, it not only significantly improves the transfection efficiency of primary myoblasts and greatly increases the success rate of integrating the CTSD gene into the myoblast genome, but also rapidly constructs an in vitro high-efficiency expression model of the CTSD gene, thereby effectively screening and obtaining functional gene molecular markers related to muscle development regulation. Attached Figure Description

[0023] Figure 1 * indicates the expression of the CTSD gene in pectoral muscle tissue. p<0.05, ** indicates p <0.01 (the same applies below); Figure 2 This refers to the expression of the CTSD gene during the proliferation and differentiation phases of primary myoblasts. Figure 3 This is a sequence comparison diagram; Figure 4 Fluorescence images of myoblasts transfected with the lentiviral recombinant vector of the CTSD gene and the negative control vector, respectively. Figure 5 Changes in CTSD gene expression after transfection with a lentiviral recombinant vector containing the CTSD gene; Figure 6 The expression of myoblast differentiation marker genes in the CTSD gene lentiviral transfection group and the NC group.

[0024] CDS sequence of the CTSD gene (SEQ ID NO.1): a tggcgccccg cggccttctc gtcctgctgc tcctcgccct ggtggggccc tgcgcggcac tcatcaggat ccccctcacc aaattcacct ccacgcgccg catgctgacc gaggtgggca gcgagatccc tgacatgaac gccatcaccc agttcctcaa gttcaagctg ggttttgctg acctggctga gcccaccccg gaaatcctca agaattacat ggatgcccag tattatggcg agattggcat tgggaccccc ccacagaagt tcactgtggt ctttgacacg ggctcctcca acctctgggt gccgtcagtg cactgtcacc tgctagacat cgcctgtttg ctacaccaca agtatgatgc gtccaaatct agcacctatg tggagaatgg cactgagttt gccatccact atgggactgg gagcctctct ggattcctga gccaggacac agtcacactt ggtaacttga aaatcaagaa ccagatcttc ggggaggctg tgaagcagcc aggcatcacc ttcattgctg ccaagttcga tggcatcttg ggcatggcat tcccgagaat ctctgtggac aaggtcacac ctttctttga taatgtcatg cagcagaagc tgattgagaa aaacatcttc tccttctacc tgaacaggga tcccacagct cagccaggcg gtgagctgct gcttgggggg actgacccca aatactacag tggtgacttc agctgggtga atgtcacacg caaagcctac tggcaggtcc acatggactc ggtggatgtt gccaatgggc tgaccctttg caaagggggc tgcgaggcca ttgtggacac aggcacttcc ctcatcactg gccccaccaa ggaagtgaag gagctgcaaa cagccattgg tgcaaaacca ctcatcaaag gccagtacgt gatctcctgt gataagatct cgtctctgcc tgttgtcaca ctcatgctag gtgggaagcc ctaccagctc actggggagc aatacgtctt caaggtttct gcacaaggag agaccatctg cctgagtggg ttttctggcc tggatgtccc accacctgga ggcccactct ggatcctggg agatgtcttc attggcccct actacactgt ctttgaccgt gataacgact ctgttggttt cgccaaatgt gtctaa CTSD upstream primer (SEQ ID NO.2): GGTTCCAAGCTTAAGCGGCCGCGCCACCatggcgccccgcggccttctcgtcctgctgctcctcg CTSD downstream primer (SEQ ID NO.3): tcagtagagagtgtcggatccttagacacatttggcgaaaccaacagagtcgttatcacggtcaa Detailed Implementation

[0025] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings.

[0026] 1. Detection of CTSD gene expression in chicken breast muscle tissue by quantitative real-time PCR

[0027] 1.1 Expression of CTSD in pectoral muscle tissue The expression of the CTSD gene in the pectoral muscle tissue at different developmental stages of the S3 (medium-speed yellow-feathered broiler) and F (fast-speed yellow-feathered broiler) strains was detected using qPCR. Figure 1 As shown, the expression level of the CTSD gene in the pectoral muscle tissue of different breeds and at different developmental stages exhibits significant breed-specific and developmental differences, indicating that the CTSD gene is involved in the regulation of chicken pectoral muscle development.

[0028] 1.2 Expression of CTSD in myoblasts of pectoral muscle tissue The expression of the CTSD gene during the proliferation and differentiation phases of chicken primary myoblasts was detected using qPCR. Figure 2 As shown, the expression level of the CTSD gene in chicken primary myoblasts during the proliferative phase was significantly lower than that during the differentiation phase. P <0.05). This suggests that the CTSD gene may play a role in promoting the development of chicken breast muscles.

[0029] CTSD gene qPCR primers: Upstream primer (SEQ ID NO.4): 5'-ACTTGCAACCCTGGATCTGG-3' Downstream primer (SEQ ID NO.5): 5'-TGCAAGAAGTGGGCTCTCTG-3'

[0030] 2. Construction of CTSD gene expression vector plasmid (1) Based on the CDS sequence of CTSD (NM_205177.2) published on Genebank, CTSD is 1197 bp long as shown in SEQ ID NO.1. Primers were designed using oligo software, and homologous sequences flanking NotI and BamHI from the LV5 vector were added to the upstream and downstream primers of the CTSD gene for subcloning of the vector. The primer sequences are as follows: Table 1 Primer sequences for CDS amplification of the CTSD gene

[0031] (2) Dissolve the primers in Table 1 in pure water to a concentration of 50 µM. Perform PCR reaction using the diluted primers. The specific system is as follows:

[0032] The loop condition is:

[0033] After the PCR reaction was completed, the chicken CTSD overexpressing lentiviral gene fragment was recovered by Agarose electrophoresis and gel excision.

[0034] (3) The full-length CDS product of the CTSD gene was digested with NotI and BamHI. The digestion system is as follows:

[0035] (4) The chicken CTSD gene was cloned into vector LV5 (LV5 vector was provided by Suzhou Jima Biotechnology Co., Ltd.). Vector LV5 was digested with NotI and BamHI at 37℃ for 2 hours. The digestion system is as follows:

[0036] (5) Electrophoresis: The enzyme digestion products of the full-length CDS amplification product of the chicken CTSD gene and the enzyme digestion products of the LV5 vector were recovered using a DNA gel recovery kit. Using the ClonExpress® Entry One Step Cloning Kit, the recovered fragments were recombinantly cloned into the linearized LV5 vector. The reaction system is as follows:

[0037] Use a pipette to blow the mixture up and down several times to mix the components. After the reaction is complete, immediately place the reaction tube in an ice-water bath to cool for 5 minutes.

[0038] (7) Transform the ligation product into TOP10 competent cells, which were provided by Suzhou Jima Co., Ltd. Add 10 µl of recombinant ligation product to the competent cells, mix gently, and incubate on ice for 30 min; place the centrifuge tubes in a water bath preheated to 42 ℃ and let stand for 90 s, then quickly transfer to an ice bath to cool for 3 min; add 800 µl of antibiotic-free LB medium to each centrifuge tube, and transfer to a shaker at 37 ℃ and 250 r / min for 45 min to recover and culture; take 200 µl of the recovered bacterial solution and spread it evenly on an LB plate containing 50 µg / ml Ampicillin. After the liquid is completely absorbed, invert the plate and incubate at 37 ℃ for 16 h.

[0039] (8) Pick cloned colonies, extract plasmids and identify them, and select positive clones. Pick 4 single, plump colonies from the cultured plate and inoculate them into test tubes containing 5 ml of 50 µg / ml Ampicillin LB medium. Incubate at 37°C and 250 r / min on a bacterial shaker for 16 h. Take 200 µl of the cultured bacterial solution and preserve the remaining bacterial solution with glycerol. Extract plasmids using the Tiangen Biotech DP104-02 plasmid mini-extraction kit (see the kit instructions for details). Sequencing was performed by Suzhou Jima Co., Ltd. Subsequently, the extracted plasmids were identified by double enzyme digestion at 37°C. Prepare the total system:

[0040] Electrophoresis was performed 1 hour later. Clones that showed enzyme digestion bands at the corresponding positions of the target band were considered positive clones.

[0041] The sequencing results were compared with the target gene sequence, and the results were as follows: Figure 3 As shown, the sequence obtained from sequencing is completely identical to the sequence published on Genebank, indicating that the CTSD gene expression vector plasmid was successfully constructed. The preserved glycerol bacterial culture was inoculated into LB medium for extensive plasmid extraction, yielding a sufficient quantity of recombinant plasmids. See the sequence comparison diagram below. Figure 3 .

[0042] 2. Virus Packaging and Collection (1) When the 293T cells have reached about 50-60% fusion, the constructed CTSD gene expression vector plasmid and packaging plasmid (pGag / Pol, pRev, pVSV-G) are transfected into the cells together.

[0043] The transfection method is as follows: Take a sterile 5 mL centrifuge tube, add 1.5 mL of serum-free DMEM, 3 μL each of CTSD gene expression vector plasmid and packaging plasmid (pGag / Pol, pRev, pVSV-G), and mix well; take another sterile 5 mL centrifuge tube, add 1.5 mL of serum-free DMEM, then add 200 μL of RNAi-Mate transfection reagent, mix well, and incubate at room temperature for 5 min. Then mix the two tubes and incubate at room temperature for 20-25 min to form a transfection mixture.

[0044] The transfection mixture formed above was then added to the cell culture medium containing 10% fetal bovine serum and incubated at 37°C in a 5% CO2 incubator for 4-6 hours. (2) Discard the transfection solution and add 10 mL of DMEM culture medium containing 10% FBS. Continue to incubate at 37℃ in a 5% CO2 incubator for 72 h.

[0045] (3) Collect the cell supernatant in the culture dish and centrifuge at 4℃, 4000 rpm for 4 min; filter the supernatant after centrifugation with a 0.45 μm filter; centrifuge the filtrate at 4℃, 20000 rpm for 2 h; collect the concentrate and aliquot it into 1.5 ml centrifuge tubes and store at -80℃.

[0046] (4) Virus titer detection: Take 10 μL of the lentivirus stock solution obtained in step (3), dilute it 10 times with DMEM culture medium of 10% FBS to make 5 gradients, add 100 μL of diluted virus solution to each well of a 96-well plate containing 293T cells, and set up a control group at the same time. Incubate at 37℃ and 5% CO2 for 24 h; discard the diluted virus solution in the 96-well plate, add 100 μL of DMEM culture medium of 10% FBS to each well, and continue to incubate at 37℃ and 5% CO2 for 72 h; calculate the virus titer by fluorescence microscopy in combination with the dilution factor, and find that the titer of the CTSD lentivirus vector is 4*10^8.

[0047] 3. Overexpression of the CTSD gene in chicken primary myoblasts using a lentiviral recombinant vector Using pectoral muscle tissue from 13-year-old high-quality broiler chickens as experimental material, pectoral muscle tissue from 3-4 high-quality broiler hens was used. The tissue was digested with collagenase I for 15 minutes, and digestion was terminated with twice the volume of high-glucose medium. The mixture was centrifuged at 4000 rpm for 10 minutes, and the supernatant was collected. The supernatant was filtered through 100-mesh, 400-mesh, and 600-mesh sieves, and the filtrate was centrifuged at 4000 rpm for 10 minutes. The supernatant was transferred to cell culture dishes and incubated at 37℃ in a 5% CO2 incubator for differential adhesion three times. After 40 minutes of incubation, the cell supernatant was transferred to new cell culture dishes and incubated at 37℃ in a 5% CO2 incubator. Once the cells reached 70% confluence, they were passaged and seeded into 12-well plates.

[0048] Once the cells reached approximately 50% confluence, transfection with the CTSD gene lentiviral recombinant vector was performed. The original culture medium was aspirated from the culture dish and replaced with fresh medium. 20 μL of 4*10^8 titer CTSD gene overexpression lentiviral vector and LV5 vector were transfected dropwise. After addition, the culture plate was gently shaken up and down, and then incubated at 37°C with 5% CO2. After 24 hours, the viral transfection solution was aspirated, fresh medium was replaced, and the cells were incubated for another 48 hours. Fluorescence was observed using an inverted fluorescence microscope. Figure 4 This preliminary result indicates that the lentiviral recombinant vector of the CTSD gene has been successfully transfected into myoblasts. Further, myoblasts were collected, and total RNA was extracted. The expression of CTSD after transfection with the lentiviral recombinant vector was detected using qPCR. The CTSD gene qPCR primer sequences were as follows: upstream primer (SEQ ID NO.4): 5'-ACTTGCAACCCTGGATCTGG-3'; downstream primer (SEQ ID NO.5): 5'-TGCAAGAAGTGGGCTCTCTG-3'. The results are as follows... Figure 5 As shown, the expression of the CTSD gene was significantly increased after transfection with the lentiviral recombinant vector, indicating that the lentiviral recombinant vector model of stable high expression of the CTSD gene in chicken primary myoblasts was successfully constructed.

[0049] Furthermore, qPCR was used to detect the expression changes of cell differentiation marker genes corresponding to the CTSD gene in lentiviral recombinant vectors transfected with the CTSD gene. The results are as follows: Figure 6 As shown, the expression of MyoD, MyoG, and Myomaker genes in the lentiviral transfection group was significantly higher than that in the control group. p <0.001).

[0050] The above description is only a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. Any equivalent modifications or changes made by those skilled in the art based on the content disclosed in the present invention should be included within the scope of protection set forth in the claims.

Claims

1. A lentiviral recombinant vector stably overexpressing the CTSD gene in chicken primary myoblasts, characterized in that, The lentiviral recombinant vector contains the full-length CDS sequence of the chicken CTSD gene, and the lentiviral recombinant vector is constructed by directionally linking the LV5 vector and the full-length CDS sequence of the chicken CTSD gene through NotI and BamHI double restriction sites. The lentiviral recombinant vector can stably overexpress the CTSD gene in chicken primary myoblasts.

2. The method for constructing a lentiviral recombinant vector stably overexpressing the CTSD gene in chicken primary myoblasts as described in claim 1, characterized in that, Includes the following steps: Step 1: Obtain the full-length CDS amplification product of the chicken CTSD gene by PCR and purify it; Step 2: The full-length CDS amplification product of the CTSD gene obtained in Step 1 is double-digested with NotI and BamHI to obtain the digested target gene fragment. Step 3: The LV5 vector was double-digested with NotI and BamHI to obtain the linearized LV5 vector; Step 4: Purify the enzyme digestion products obtained in Step 2 and Step 3, and then perform directional ligation of the purified target gene fragment with the linearized LV5 vector to obtain the ligation product. Step 5: Transform the ligation product obtained in Step 4 into TOP10 competent cells, culture them, pick clones, and perform sequencing verification and sequence alignment on positive clones. The plasmids that are completely correct in sequence alignment are the successfully constructed CTSD gene expression vector plasmids. Step 6: The CTSD gene expression vector plasmid successfully constructed in Step 5 is subjected to ultrapure extraction. Then, the extracted CTSD gene expression vector plasmid and packaging plasmid are co-transfected into 293T cells for lentivirus packaging, collection, and titer detection to obtain the CTSD gene lentiviral recombinant vector.

3. The construction method according to claim 2, characterized in that, Step 1, which describes obtaining and purifying the full-length CDS amplification product of the chicken CTSD gene using PCR, specifically includes: Step 1.1: Design primers based on the CDS sequence of the CTSD gene published in GenBank. The CDS sequence of the CTSD gene is shown in SEQ ID NO.1, wherein the 5′ end of the upstream primer contains sequences homologous to the NotI site on the LV5 vector, and the 5′ end of the downstream primer contains sequences homologous to the BamHI site on the LV5 vector. Step 1.2: Using the primers designed in Step 1.1, perform PCR amplification with a template containing the full-length CDS of the chicken CTSD gene; Step 1.3: After the PCR reaction is completed, the full-length CDS amplification product of the chicken CTSD gene is separated by agarose gel electrophoresis and the gel is cut and recovered.

4. The construction method according to claim 3, characterized in that, The primer sequences mentioned in step 1.1 are as follows: Upstream primer: 5′- GGTTCCAAGCTTAAGCGGCCGCGCCACCatggcgccccgcggccttctcgtcctgctgctcctcg -3′; Downstream primer: 5′-tcagtagagagtgtcggatccttagacacatttggcgaaaccaacagagtcgttatcacggtcaa -3′.

5. The construction method according to claim 2, characterized in that, The reaction system for the directional ligation described in step 4 is as follows: 4 μl of 5×CE Entry Buffer, 1 μl of purified target gene fragment, 2 μl of linearized LV5 vector, 2 μl of Exnase Entry, and 11 μl of ddH2O. After the ligation reaction is completed, the reaction tube is placed in an ice-water bath to cool for 5 minutes.

6. The construction method according to claim 2, characterized in that, Step 5, which describes the transformation of the ligation product into TOP10 competent cells, specifically includes: adding 10 μl of the ligation product to the TOP10 competent cells, gently mixing, and then incubating on ice for 30 minutes; placing the centrifuge tube in a 42°C water bath for 90 seconds for heat shock, and then quickly transferring it to an ice bath for 3 minutes to cool; adding 800 μl of antibiotic-free LB medium to the centrifuge tube and reviving and culturing it at 37°C and 250 r / min on a shaker for 45 minutes; taking 200 μl of the revived bacterial solution and spreading it evenly on an LB agar plate containing 50 μg / ml ampicillin, and after the liquid is completely absorbed, inverting the plate and incubating it in a 37°C incubator for 16 hours.

7. The construction method according to claim 2, characterized in that, The packaging plasmids mentioned in step 6 are pGag / Pol, pRev, and pVSV-G.

8. The construction method according to claim 2, characterized in that, Step 6, which involves co-transfecting the CTSD gene expression vector plasmid and packaging plasmid into cells for lentivirus packaging and collection, specifically includes: (1) When the 293T cells have reached 50%-60% confluence, take a sterile centrifuge tube, add 1.5ml of serum-free DMEM medium, then add 3μl each of CTSD gene expression vector plasmid and packaging plasmid, and mix well; take another sterile centrifuge tube, add 1.5ml of serum-free DMEM medium, then add 200μl of RNAi-Mate transfection reagent, mix well, and let stand at room temperature for 5 minutes. Then mix the two tubes and let stand at room temperature for 20-25 minutes to form a transfection mixture; add the transfection mixture to the culture medium of 293T cells and incubate at 37℃ and 5% CO2 for 4-6 hours. (2) Discard the transfection solution, add 10 ml of DMEM culture medium containing 10% FBS, and continue to incubate at 37°C and 5% CO2 for 72 hours; (3) Collect the cell supernatant in the culture dish and centrifuge at 4℃ and 4000rpm for 4 minutes; filter the supernatant after centrifugation with a 0.45μm filter; centrifuge the filtrate at 4℃ and 20000rpm for 2 hours, collect the concentrate, and store it at -80℃ to obtain the CTSD gene lentiviral recombinant vector.

9. Use of the CTSD gene lentiviral recombinant vector according to claim 1 in chicken primary myoblasts.

10. The use of the CTSD gene lentiviral recombinant vector according to claim 1 in the preparation of an in vitro expression model for studying the regulation of chicken muscle development.