Use of hla-c*08:01:01 allele in the detection or assessment of immune-related severe skin adverse reactions
Patent Information
- Application Number
- CN202610840502.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-11
- Publication Date
- 2026-09-18
AI Technical Summary
[0004]目前,免疫检查点抑制剂诱发的皮肤不良反应发生机制尚不明确,缺乏预测此类皮肤不良反应发生的生物标记物,临床对免疫检查点抑制剂相关重症皮肤不良反应的预测能力有限,主要依赖既往病史、用药史和治疗后临床表现,缺乏可在用药前或早期阶段进行风险分层的稳定遗传学标志物
[0022]I. HLA gene typing analysis of cancer patients using whole-exome sequencing revealed that the frequency of the HLA-C*08:01:01 gene was significantly higher in the disease group (cancer patients who developed severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors) than in the control group (cancer patients who did not experience skin adverse reactions after using immune checkpoint inhibitors) (p=0.003, OR=18). This indicates that cancer patients carrying the HLA-C*08:01:01 allele have a higher risk of developing severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors than cancer patients who do not carry this allele. Allele testing can identify high-risk individuals before starting immune checkpoint inhibitor treatment, effectively preventing the occurrence of severe skin adverse reactions related to immune checkpoint inhibitors and improving the quality of life for cancer patients.
Smart Images

Figure CN122772973A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the HLA-C*08:01:01 allele in the detection or evaluation of immune-related severe skin adverse reactions. Background Technology
[0002] The human leukocyte antigen (HLA) gene system, also known as the major histocompatibility complex (MHC), is located on the short arm of chromosome 6. It is a highly polymorphic genetic complex composed of a series of tightly linked gene loci, encoding leukocyte antigens. HLA participates in antigen processing and presentation, playing a crucial role in specific immune responses and immune regulation. Furthermore, HLA molecules are involved in transplant rejection and various pathological processes.
[0003] Immune checkpoint inhibitors (ICIs) have been used to treat various malignant tumors, bringing significant clinical benefits to patients. However, immune-related adverse events (irAEs) caused by excessive activation of specific immune responses induced by ICIs, leading to damage to normal tissues, have become a hot topic of concern in first-line clinical practice. In recent years, skin adverse reactions induced by immune checkpoint inhibitors have emerged as a new type of skin disease. Some severe skin adverse reactions, such as severe erythema multiforme and toxic epidermal necrolysis, not only lead to the interruption of immunotherapy but also endanger the lives of patients.
[0004] Currently, the mechanisms underlying skin adverse reactions induced by immune checkpoint inhibitors remain unclear, and there is a lack of biomarkers to predict their occurrence. Clinically, the predictive ability for severe skin adverse reactions related to immune checkpoint inhibitors is limited, relying mainly on past medical history, medication history, and post-treatment clinical manifestations. Stable genetic markers that can be used for risk stratification before or in the early stages of medication are lacking. HLA molecules are involved in antigen presentation and T cell activation, and different HLA alleles may affect drug-related immune responses. Therefore, screening for HLA alleles associated with severe skin adverse reactions related to immune checkpoint inhibitors and establishing convenient, rapid, and scalable detection methods have significant clinical application value. Summary of the Invention
[0005] Therefore, the main objective of this invention is to provide the application of the HLA-C*08:01:01 allele in the detection or evaluation of immune-related severe skin adverse reactions, specifically a new use of substances that detect the HLA-C*08:01:01 allele for the preparation of products for the detection or evaluation of immune-related severe skin adverse reactions.
[0006] Another objective of this invention is to provide primers for detecting or evaluating immune-related severe skin adverse reactions, which are MGB probe-based real-time fluorescent PCR primers targeting the HLA-C*08:01:01 allele, for rapid and auxiliary typing detection of the subject's genomic DNA.
[0007] Another object of the present invention is to provide a kit for detecting or assessing immune-related severe skin adverse reactions, comprising the above-mentioned primers, which can be used for auxiliary screening of the risk of severe skin adverse reactions and patient stratification management before or during immune checkpoint inhibitor treatment.
[0008] To achieve the above objectives, the present invention provides the following technical solution:
[0009] In a first aspect, the invention provides the use of a substance for detecting the HLA-C*08:01:01 allele in the preparation of products for detecting or assessing immune-related severe skin adverse reactions.
[0010] Preferably, the immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis; individuals carrying the HLA-C*08:01:01 allele have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals not carrying the HLA-C*08:01:01 allele.
[0011] A second aspect of the invention provides the use of a substance for detecting the HLA-C*08:01:01 allele and a readable vector describing an evaluation method in the preparation of a product for detecting or evaluating immune-related severe skin adverse reactions; said evaluation method is as follows: individuals carrying the HLA-C*08:01:01 allele have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals not carrying the HLA-C*08:01:01 allele.
[0012] Preferably, the immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis.
[0013] A third aspect of the present invention provides primers for detecting or evaluating immune-related severe skin adverse reactions, characterized in that they are real-time fluorescent PCR primers for the MGB probe method targeting the HLA-C*08:01:01 allele, with sequences shown in SEQ ID NO.1 and SEQ ID NO.2, specifically:
[0014] HLA-C*08:01:01-F: AGGATGTATGGCTGCGACCT (SEQ ID NO.1);
[0015] HLA-C*08:01:01-R: CAGGGCGATGTAATCCTTGC (SEQ ID NO. 2).
[0016] Preferably, the immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis.
[0017] A fourth aspect of the present invention provides a kit for detecting or evaluating immune-related severe skin adverse reactions, characterized in that it is an HLA-C*08:01:01 allele detection kit containing the primers for detecting or evaluating immune-related severe skin adverse reactions.
[0018] Preferably, the method of using the kit includes: detecting the presence of the HLA-C*08:01:01 allele in the subject's sample; when the sample quality control internal control amplification is effective and the target channel shows effective amplification, the subject is determined to carry the HLA-C*08:01:01 allele, indicating a high risk of developing severe skin adverse reactions related to immune checkpoint inhibitors. This determination result is not used as a sole diagnostic criterion, but is used for comprehensive risk assessment in conjunction with tumor type, immunotherapy regimen, past allergy history, skin disease history, and clinical monitoring results.
[0019] A fifth aspect of the invention provides the use of a substance for detecting HLA allele combinations in the preparation of products for detecting or assessing immune-related severe skin adverse reactions, wherein the HLA allele combination includes the HLA-C*08:01:01 allele and one or more alleles selected from HLA-DQB1*03:01:01, HLA-DQA1*03:02:01, and HLA-DRB1*09:01:02, exhibiting a case group enrichment trend in different clinical phenotypes or subgroups, and can be used in combination with the HLA-C*08:01:01 allele for detecting or assessing immune-related severe skin adverse reactions, for risk stratification, auxiliary screening, and patient management.
[0020] Preferably, the immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis. Individuals carrying the HLA allele combination have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals who do not carry the HLA allele combination.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0022] I. HLA gene typing analysis of cancer patients using whole-exome sequencing revealed that the frequency of the HLA-C*08:01:01 gene was significantly higher in the disease group (cancer patients who developed severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors) than in the control group (cancer patients who did not experience skin adverse reactions after using immune checkpoint inhibitors) (p=0.003, OR=18). This indicates that cancer patients carrying the HLA-C*08:01:01 allele have a higher risk of developing severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors than cancer patients who do not carry this allele. Allele testing can identify high-risk individuals before starting immune checkpoint inhibitor treatment, effectively preventing the occurrence of severe skin adverse reactions related to immune checkpoint inhibitors and improving the quality of life for cancer patients.
[0023] II. HLA class I (MHC I) and class II (MHC II) genes encode molecules that bind and present antigens, enabling cytotoxic T lymphocytes to bind to mature HLA cell surface proteins via antigen-binding grooves. Class I genes primarily present antigens to CD8+ T cells, while class II genes primarily present antigens to CD4+ T cells. The HLA types associated with immune checkpoint inhibitors are mainly HLA class I genes. CD8+ T cells can only be activated by recognizing the short peptides presented by HLA class I molecules. HLA-C*08:01:01 can trigger autoimmune responses by altering the antigen-presenting function of MHC class I molecules. Attached Figure Description
[0024] Figure 1 The HLA-C*08:01:01 allele frequency distribution diagram for the disease group and the control group in the example is shown. Detailed Implementation
[0025] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.
[0026] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0027] Example 1: HLA susceptibility allele screening based on whole-exome sequencing
[0028] To screen for HLA alleles associated with susceptibility to severe skin adverse reactions related to tumor immune checkpoint inhibitors, this embodiment uses whole-exome sequencing technology to sequence the genomic DNA of peripheral blood from cancer patients, and completes HLA allele typing and association analysis based on the sequencing data.
[0029] 1. Research subjects and grouping
[0030] This case study included 42 cancer patients who developed severe adverse skin reactions after receiving immunotherapy or targeted therapy at Zhongshan Hospital affiliated with Fudan University and were hospitalized for dermatological evaluation. The case group included patients with bullous pemphigoid, toxic epidermal necrolysis, severe erythema multiforme, and targeted drug-related or other severe drug eruptions (17 cases of bullous pemphigoid, 15 cases of SJS, 3 cases of TEN, and 7 cases of targeted drug-related or other drug eruptions). The diagnosis of these diseases was based on a comprehensive assessment of the patient's medication history, skin lesion morphology, mucosal involvement, disease progression characteristics, skin histopathological examination, direct or indirect immunofluorescence examination, and relevant serological tests.
[0031] The control group consisted of 19 cancer patients who received immune checkpoint inhibitor therapy concurrently and did not experience skin adverse reactions for at least 9 months after treatment. The control group was used to represent the background HLA allele distribution of individuals receiving immune checkpoint inhibitor therapy but who did not experience skin adverse reactions.
[0032] In the specific analysis, subgroup analysis was further conducted based on the type of adverse skin reaction. Among them, severe erythema multiforme and toxic epidermal necrolysis were combined into a severe epidermal necrolysis-related subgroup, which was used to compare HLA allele frequencies with the control group.
[0033] 2. Sample Collection and DNA Extraction
[0034] Peripheral venous blood samples were collected from the subjects, and genomic DNA was extracted from the peripheral blood using a commercially available genomic DNA extraction kit. The extracted DNA samples were tested for concentration and purity before being used for subsequent library construction. DNA samples that met the sequencing requirements were then used in the subsequent whole-exon capture and high-throughput sequencing process.
[0035] 3. HLA allele typing
[0036] Based on whole-exome sequencing data, HLA-I and HLA-II allele genotypes were inferred from the subjects. The analysis covered HLA loci including HLA-A, HLA-B, HLA-C, HLA-DRB1, HLA-DQA1, and HLA-DQB1. Each subject has two allele copies at each HLA locus; this example uses the allele copy number, 2n, to calculate the frequency of each HLA allele in the case and control groups. The frequency of a specific HLA allele was calculated as follows:
[0037] HLA allele frequency = (the number of copies of the allele detected / the total number of copies of alleles in the group) × 100%.
[0038] 4. HLA candidate allele screening
[0039] Based on the HLA typing results, a systematic screening was performed on HLA alleles that could be compared between the case and control groups. This example analyzed the frequencies of approximately 99 detectable HLA alleles that could be used for statistical comparison in both the case and control groups.
[0040] The screening process is as follows:
[0041] First, the copy number and allele frequency of each HLA allele were statistically analyzed in the case and control groups. Second, preliminary screening was conducted using the difference in allele frequencies between the case and control groups. Third, Fisher's exact test was performed on candidate alleles with significant differences. Finally, combining statistical results, disease subtype characteristics, and the biological functions of HLA molecules in antigen presentation and immune activation, candidate HLA alleles that may be associated with the risk of severe skin adverse reactions related to immune checkpoint inhibitors were screened.
[0042] 5. Statistical Analysis
[0043] Two-tailed Fisher's exact test was used to compare the differences in HLA allele frequencies between the case and control groups. For significantly enriched candidate alleles, the odds ratio and 95% confidence interval were further calculated to assess the strength of the association between the allele and the risk of disease occurrence. A p-value < 0.05 was considered statistically significant for the distribution of the HLA allele between the case and control groups. Considering the large number of HLA alleles, multiple comparisons may introduce Type I error risk. The screening results in this example were used as exploratory findings and were further confirmed by subsequent independent cohort validation, PCR testing, Sanger sequencing, or other HLA genotyping methods.
[0044] 6. Screening Results
[0045] HLA gene typing analysis was performed on tumor patients using whole-exome sequencing. The study found that the frequency of the HLA-C*08:01:01 gene was significantly higher in the disease group (tumor patients who developed severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors) than in the control group (tumor patients who did not experience skin adverse reactions after using immune checkpoint inhibitors) (p=0.003, OR=18). This means that tumor patients carrying the HLA-C*08:01:01 allele have a 9.5-fold higher risk of developing severe erythema multiforme and toxic epidermal necrolysis after using immune checkpoint inhibitors compared to tumor patients without this allele.
[0046] Table 1: HLA-C*08:01:01 allele frequencies in the disease group and the control group.
[0047]
[0048] The frequency distribution of HLA-C*08:01:01 alleles in the disease group and the control group is as follows: Figure 1 As shown, in the disease group, 9 cases tested positive for the HLA-C*08:01:01 allele, and 9 cases did not test positive; in the control group, 1 case tested positive for the HLA-C*08:01:01 allele, and 18 cases did not test positive; the frequency of this allele between the disease group and the control group was statistically different (P=0.0030).
[0049] This embodiment, through whole-exome sequencing, HLA genotyping, and case-control association analysis, screened approximately 99 comparable HLA alleles and found that HLA-C*08:01:01 was significantly enriched in patients with immune checkpoint inhibitor-associated severe erythema multiforme and toxic epidermal necrolysis. These results suggest that HLA-C*08:01:01 could serve as a candidate genetic marker for assessing the risk of severe skin adverse reactions in cancer patients treated with immune checkpoint inhibitors. Based on the detection of this allele, an auxiliary screening method for the risk of severe skin adverse reactions can be constructed, providing a basis for individualized risk assessment before immune checkpoint inhibitor treatment.
[0050] Example 2: Design of primers and MGB probes for HLA-C*08:01 related allele detection
[0051] 1) Obtain HLA-C*08:01:01 and related HLA-C*08:01 sequence regions from NCBI.
[0052] 2) Based on the design requirements of MGB probe method real-time fluorescence PCR, three sets of candidate target primer / probe combinations were designed (Table 2), and GAPDH was set as the internal control amplification system.
[0053] Table 2: Primer and MGB probe design for HLA-C*08:01 related allele detection
[0054]
[0055] Example 3: MGB probe method real-time fluorescence PCR detection system
[0056] 1) The sample type was peripheral blood genomic DNA. The reaction system included PCR premix, upstream primer, downstream primer, MGB probe, template DNA, and nuclease-free water. The target HLA-C*08:01 related sequence was detected using the FAM channel, and the internal control GAPDH was detected using the HEX / VIC channel. Each batch of experiments included a positive control, a negative control, and a template-free control.
[0057] 2) The reaction program is set as follows: pre-denaturation at 95℃ for 5 minutes; followed by 35 to 45 cycles, each cycle including denaturation at 95℃ for 30 seconds and annealing / extend at 60℃ for 30 to 60 seconds. The specific number of cycles and annealing / extend time are optimized according to the actual reagent system and instrument platform.
[0058] 3) Result interpretation principles: A valid Ct value for the GAPDH internal reference indicates that the sample DNA quality and amplification system are effective; if the target channel shows a typical S-shaped amplification curve and the Ct value is lower than the preset threshold, the target allele is determined to be positive for amplification; if the target channel is not amplified or the Ct value is Undetermined, the target amplification is determined to be negative or not detected.
[0059] Example 4: Candidate primer / probe combination screening experiment
[0060] Three candidate primer / probe combinations were screened and validated using MGB probe-based real-time PCR. Their amplification, Ct value distribution, and repeatability consistency were compared between the case and control groups to determine the primer / probe combination suitable for HLA-C*08:01:01 allele detection.
[0061] 1. Sample composition: 4 samples from the case group (case group 1-4), 4 samples from the disease control group (disease control 1-4), and 1 sample from the healthy control group, for a total of 9 DNA samples.
[0062] 2. Detection system: The FAM channel was used to detect the target HLA allele, and the HEX / VIC channel was used to detect the internal reference GAPDH. Each sample was tested 2-3 times for candidate combination 1, candidate combination 2, and candidate combination 3. Case group 4 recorded one effective amplification result for each of candidate combination 2 and candidate combination 3.
[0063] 3. Data Processing: Calculate the average Ct value for repeated tests of the same sample and combination; "Undetermined (UD)" is recorded as not detected. The following indicators are considered when judging the quality of combinations: ① Detection status in the case group; ② Whether amplification occurs in the control group; ③ Whether the Ct value shifts forward and is concentrated; ④ Whether repeated amplification is consistent.
[0064] 4. Internal control determination: GAPDH was effectively amplified in all 9 samples, with Ct values ranging from 25.273 to 30.584, indicating that the sample DNA quality and PCR system were generally reliable. The average Ct values for each sample are shown in Table 3.
[0065] 5. Results: Candidate combination 1 obtained stable amplification signals in all four samples of the case group, with average Ct values of 20.498, 26.290, 25.254 and 16.448, respectively. In the control group, only disease control 1 showed a single late amplification with Ct=34.628, and no amplification was detected in the other control samples. This indicates that the combination has good detection ability in the case group and very little non-specific amplification in the control group.
[0066] Candidate combination 2 showed amplification signals in the case group samples, but also showed amplification in multiple cases in the disease control group and healthy controls. Among them, the healthy controls showed an abnormally low value of Ct=11.743, indicating that the combination had non-specific amplification or system interference, and its specificity and stability were insufficient.
[0067] Although candidate combination 3 can be amplified in the case group, amplification signals can also be detected in all disease control samples and healthy controls. The Ct values of the control group are mainly distributed between 24.945 and 32.049, indicating that this combination lacks sufficient discrimination ability and is difficult to meet the requirements of specific typing detection.
[0068] Based on the detection results of the case group, the background amplification of the control group, the distribution of Ct values, and the consistency analysis results of repeated amplification, candidate combination 1 showed the best overall performance and can be used as the primer / probe combination for detecting the HLA-C*08:01:01 allele in this invention. Candidate combinations 2 and 3 are not preferred implementations because they have insufficient specificity due to the large amount of amplification in the control samples.
[0069] Table 3: Summary of average Ct values for internal controls and candidate primer / probe combinations for each sample (UD indicates not detected).
[0070]
[0071] Example 5: Kit Composition
[0072] 1) Target HLA-C*08:01 allele detection primers and MGB probe, preferably candidate combination 1;
[0073] 2) GAPDH internal control amplification primers and probes;
[0074] 3) PCR reaction buffer, dNTPs, DNA polymerase, Mg2+, and nuclease-free water;
[0075] 4) Positive control: Genomic DNA, plasmid, or synthetic fragment containing the HLA-C*08:01 related allele;
[0076] 5) Negative control: Genomic DNA containing no target allele;
[0077] 6) Template-free control: used for monitoring pollution;
[0078] 7) Interpret the instructions and quality control standards. If this allele is detected, it indicates an increased risk of severe skin adverse reactions induced by immune checkpoint inhibitors (requires clinical evaluation).
[0079] Example 6: Prospective Case Cohort Validation
[0080] To further validate the association between the HLA-C*08:01:01 allele and severe skin adverse reactions associated with immune checkpoint inhibitors, researchers prospectively followed up and included 25 patients who developed SJS / TEN as the validation case group. Simultaneously, 19 patients who did not experience skin adverse reactions after tumor treatment were selected as the control group. Whole-exome sequencing and HLA allele typing analysis were performed in both groups.
[0081] Fisher's exact test was used to compare the differences in candidate HLA allele frequencies between the case group and the control group. The results showed that the frequency of the 2n allele of HLA-C*08:01:01 in the SJS / TEN case group was 12 / 50 (24.00%), which was significantly higher than that in the control group (1 / 38 (2.63%)), with an odds ratio (OR) of 16.62 and a 95% CI of 1.91–144.24 (P = 0.0025) (Table 4). This result further demonstrates in the prospective validation cohort that HLA-C*08:01:01 is associated with immune checkpoint inhibitor-related susceptibility to SJS / TEN.
[0082] Table 4: HLA-C*08:01:01 allele frequencies in the disease group and control group of the validation cohort.
[0083]
[0084] Example 7: Candidate HLA risk alleles in different subgroups of severe adverse skin reactions
[0085] To further explore other potential HLA susceptibility alleles besides HLA-C*08:01:01, researchers compared and analyzed HLA allele frequencies between different clinical subgroups and the control group based on whole-exome sequencing data. The case subgroup included patients with severe adverse skin reactions such as immune checkpoint inhibitor-associated bullous pemphigoid (BP), Stevens-Johnson syndrome (SJS), and toxic epidermal necrolysis (TEN); the control group consisted of patients who did not experience adverse skin reactions after cancer treatment. The frequencies of each HLA allele were calculated using the 2n allele count as the denominator, and Fisher's exact test was used to compare differences between the case subgroup and the control group.
[0086] In the comparison between the BP+SJS+TEN combined subgroup (2n=70) and the control group (2n=38), HLA-C*08:01:01 and HLA-DQB1*03:01:01 were relatively enriched in the case group. The frequency of HLA-C*08:01:01 in the case group was 20.00% (14 / 70), and the frequency in the control group was 2.63% (1 / 38), P=0.0094; the frequency of HLA-DQB1*03:01:01 in the case group was 31.43% (22 / 70), and the frequency in the control group was 15.79% (6 / 38), P=0.0454 (Table 5).
[0087] In the comparison between the BP subgroup (2n=34) and the control group (2n=38), the frequencies of HLA-DQA1*03:02:01 and HLA-DRB1*09:01:02 were increased in the BP subgroup. Specifically, the frequency of HLA-DQA1*03:02:01 in the BP group was 26.47% (9 / 34), while the frequency in the control group was 5.26% (2 / 38), P=0.0248; the frequency of HLA-DRB1*09:01:02 in the BP group was 23.53% (8 / 34), while the frequency in the control group was 7.89% (3 / 38), P=0.0328. These results suggest that HLA class II genes may be involved in immune susceptibility to immune checkpoint inhibitor-associated bullous pemphigoid (Table 6).
[0088] The above analysis results demonstrate that including HLA-DQB1*03:01:01, HLA-DQA1*03:02:01, and HLA-DRB1*09:01:02 in the scope of combined risk markers of this invention, they can be used in combination with HLA-C*08:01:01 to construct a comprehensive risk assessment model for severe skin adverse reactions related to immune checkpoint inhibitors.
[0089] Table 5: Significant differences in HLA allele frequencies between the BP+SJS+TEN subgroup and the control group
[0090]
[0091] Table 6: Significant differences in HLA allele frequencies and Fisher's test results between the BP subgroup and the control group
[0092]
[0093] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of substances that detect the HLA-C*08:01:01 allele in the preparation of products for detecting or evaluating immune-related severe skin adverse reactions.
2. The application according to claim 1, characterized in that, The immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis; individuals carrying the HLA-C*08:01:01 allele have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals who do not carry the HLA-C*08:01:01 allele.
3. The application of substances containing the HLA-C*08:01:01 allele and readable vectors describing assessment methods in the preparation of products for detecting or assessing immune-related severe skin adverse reactions; the assessment method is as follows: individuals carrying the HLA-C*08:01:01 allele have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals not carrying the HLA-C*08:01:01 allele.
4. The application according to claim 1, characterized in that, The immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis.
5. A primer for detecting or evaluating immune-related severe skin adverse reactions, characterized in that, It is a real-time fluorescent PCR primer for the MGB probe method targeting the HLA-C*08:01:01 allele, with sequences shown in SEQ ID NO.1 and SEQ ID NO.
2. The immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis.
6. A kit for detecting or evaluating immune-related severe skin adverse reactions, characterized in that, It is an HLA-C*08:01:01 allele detection kit, containing the primers described in claim 5 for detecting or assessing immune-related severe skin adverse reactions.
7. The kit for detecting or evaluating immune-related severe skin adverse reactions according to claim 6, characterized in that, The method of using the kit includes: detecting the presence of the HLA-C*08:01:01 allele in the subject's sample; when the sample quality control internal reference amplification is effective and the target channel shows effective amplification, the subject is determined to carry the HLA-C*08:01:01 allele, indicating that they have a high risk of developing severe skin adverse reactions related to immune checkpoint inhibitors.
8. The application of a substance containing a combination of HLA alleles in the preparation of a product for detecting or assessing immune-related severe skin adverse reactions, wherein the combination of HLA alleles includes the HLA-C*08:01:01 allele, and also includes one or more alleles selected from HLA-DQB1*03:01:01, HLA-DQA1*03:02:01, and HLA-DRB1*09:01:02, and is used in combination with the HLA-C*08:01:01 allele for detecting or assessing immune-related severe skin adverse reactions.
9. The application according to claim 8, characterized in that, The immune-related severe skin adverse reactions include severe erythema multiforme and toxic epidermal necrolysis. Individuals carrying HLA allele combinations have a higher risk of severe skin adverse reactions after using immune checkpoint inhibitors than individuals without HLA allele combinations.