Primer, kit for detecting circular RNA circCFLAR and application thereof

CN122772991APending Publication Date: 2026-09-18SUQIAN FIRST PEOPLES HOSPITAL (JIANGSU PROVINCIAL PEOPLES HOSPITAL SUQIAN BRANCH)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611202798.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-10
Publication Date
2026-09-18

AI Technical Summary

Technical Problem

然而,当前多数研究仍集中于CRC原发病灶,对CRC肝转移灶的分析有限,亟需进一步鉴定CRC肝转移病灶中的circRNA,并探索参与肝转移的关键circRNA的功能特征

Benefits of technology

[0020] This invention demonstrates that knockdown of circCFLAR promotes cell migration, while overexpression inhibits it, revealing that circRNAs play a role in inhibiting cell migration in CRC. circCFLAR may serve as a potential therapeutic target for preventing CRC metastasis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122772991A_ABST
    Figure CN122772991A_ABST
Patent Text Reader

Abstract

The application provides a primer and a kit for detecting circular RNA circCFLAR and application thereof in preparation of products for diagnosing or prognostic evaluation of colorectal cancer metastasis.The application also provides application of a reagent for overexpressing circular RNA circCFLAR in preparation of a medicine for inhibiting migration of colorectal cancer cells.The application further provides a method for screening a candidate medicine for treating or preventing colorectal cancer metastasis.Knockdown of the circular RNA circCFLAR promotes cell migration, while overexpression of the circular RNA circCFLAR inhibits cell migration, which reveals that the circular RNA circRNA plays a role in inhibiting cell migration in CRC.The circular RNA circCFLAR can serve as a potential therapeutic target for preventing CRC metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to primers, kits, and applications for detecting circular RNA circCFLAR. Background Technology

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. Early identification and prevention of CRC are crucial, and early screening measures are indispensable. The pathogenesis of CRC is often due to a combination of factors, including genetic factors, dietary habits, lifestyle, and environmental factors. Despite continuous advancements in medical technology and treatment protocols in recent years, the prognosis for patients with advanced CRC and distant metastases remains extremely poor, with a low 5-year survival rate. CRC patients may already have liver metastases at initial diagnosis, and the vast majority of liver metastases are not initially resectable. Patients with untreated liver metastases have a short median survival. Therefore, metastasis is the leading cause of death in CRC patients, and its occurrence is a key prognostic factor. However, tumor metastasis is a complex biological process involving multiple genes, steps, and stages. Therefore, elucidating the molecular mechanisms driving CRC metastasis and identifying novel biomarkers for effective therapeutic intervention are essential for improving the prognosis of patients with advanced CRC.

[0003] CircRNAs, as non-coding RNAs, are formed from precursor mRNAs through backsplicing to form closed circular structures. They possess characteristics such as high stability, sequence conservation, and tissue-specific expression. Their molecular structure differs from traditional linear RNAs; circRNAs lack a 5' cap and a 3' polyA tail. This unique structure allows them to resist degradation by exonucleases to some extent, exhibiting stability in body fluids and tissues. This enables them to play a crucial role in regulating cell proliferation, differentiation, and apoptosis, and is closely related to tumorigenesis and development, making them potential biomarkers. Therefore, the role of circRNAs in malignant tumors has received increasing attention in recent years. Advances in high-throughput sequencing and microarray technologies have made the extensive identification of differentially expressed circRNAs in CRC possible. By comparing CRC tissues with their paired normal tissues, researchers identified a large number of aberrantly expressed circRNAs in CRC tissues and confirmed the key roles and mechanisms of differentially expressed circRNAs such as hsa_circ_0064559 and hsa_circ_101555 in promoting CRC proliferation. Furthermore, circNSUN2 and circSTK3 are upregulated in CRC tissues, and these circRNAs are involved in the CRC transfer process. However, the specific functions and molecular mechanisms of most circRNAs in CRC transfer remain to be further elucidated.

[0004] CircCFLAR (hsa_circ_0001092) is a circRNA derived from the CFLAR gene. Although there are relatively few direct studies on its role in tumors, preliminary research evidence suggests that it plays a certain regulatory role in tumor development. For example, circCFLAR has been shown to be downregulated in tumor cells of patients with acute myeloid leukemia, and low expression is associated with shortened patient survival.

[0005] Compared to adjacent normal tissue, our understanding of circRNAs in primary CRC lesions is becoming increasingly profound. However, some studies still focus on primary CRC lesions with or without liver metastases to identify liver metastasis-related circRNAs. Nevertheless, most current research remains concentrated on primary CRC lesions, with limited analysis of CRC liver metastases. Further identification of circRNAs in CRC liver metastases and exploration of the functional characteristics of key circRNAs involved in liver metastasis are urgently needed. Summary of the Invention

[0006] The purpose of this invention is to address the above-mentioned technical problems by providing a novel biomarker that can effectively treat colorectal cancer or predict lymph node or liver metastasis of colorectal cancer.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a primer for detecting circular RNA circCFLAR, comprising a forward primer and a reverse primer, wherein the forward primer has a nucleotide sequence as shown in SEQ ID NO. 1 and the reverse primer has a nucleotide sequence as shown in SEQ ID NO. 2.

[0008] Secondly, the present invention provides a kit for detecting circular RNA circCFLAR, which includes the primers described above.

[0009] Thirdly, the present invention provides the use of the primers or kits described herein in the preparation of products for the diagnosis or prognostic assessment of colorectal cancer metastasis.

[0010] In a preferred embodiment, the nucleotide sequence of the circular RNA circCFLAR is derived from the reverse splicing of exons 6 to 8 of the human CFLAR gene.

[0011] In one preferred embodiment, the product comprises reagents for real-time quantitative PCR, Northern blotting, in situ hybridization, or gene chip detection.

[0012] In a preferred embodiment, the metastasis is a liver metastasis or a lymph node metastasis.

[0013] In a preferred embodiment, the diagnostic or prognostic assessment includes: a) Detect the expression level of circular RNA circCFLAR in the test sample; b) Compare the detected expression levels with those of the control sample; c) If the expression level of circular RNA circCFLAR in the test sample is significantly lower than that in the control sample, it indicates an increased risk of colorectal cancer metastasis or a poor prognosis; The test samples were selected from colorectal cancer tissue, adjacent tissue, blood, or plasma.

[0014] Fourthly, the present invention provides the use of reagents for overexpressing circular RNA circCFLAR in the preparation of drugs for inhibiting the migration of colorectal cancer cells.

[0015] In a preferred embodiment, the drug is a recombinant overexpression vector of the circular RNA circCFLAR.

[0016] In a preferred embodiment, the drug inhibits the migration of colorectal cancer cells by upregulating the expression level of the circular RNA circCFLAR in colorectal cancer cells.

[0017] In a preferred embodiment, the metastasis is a liver metastasis or a lymph node metastasis.

[0018] Fifthly, the present invention provides a method for screening candidate drugs for the treatment or prevention of colorectal cancer metastasis, comprising the following steps: a) Contact the candidate material with colorectal cancer cells expressing the circular RNA circCFLAR; b) Detect the expression level of circular RNA circCFLAR in the cells; c) If the candidate substance can upregulate the expression level of circular RNA circCFLAR, it indicates that it is a potential candidate drug for the treatment or prevention of colorectal cancer metastasis.

[0019] In a preferred embodiment, the colorectal cancer cells are RKO or SW620 cell lines.

[0020] This invention demonstrates that knockdown of circCFLAR promotes cell migration, while overexpression inhibits it, revealing that circRNAs play a role in inhibiting cell migration in CRC. circCFLAR may serve as a potential therapeutic target for preventing CRC metastasis. Attached Figure Description

[0021] Figure 1The heatmap shows that circCFLAR is downregulated in CRC liver metastases. (A) The heatmap shows the expression profiles of 97 circRNAs initially identified as downregulated in liver metastases compared to paired primary colorectal cancer lesions. (B) The heatmap shows that among the top 20 circRNAs most significantly downregulated in liver metastases, 11 also showed significant downregulation in the colorectal cancer tissue dataset (GSE77661) compared to normal tissue. The roles of five of these circRNAs (marked with red boxes) in CRC have been reported in the literature. (C) RT-qPCR validation of the remaining 6 candidate circRNAs in the same paired sample confirmed that hsa_circ_0001092 (circCFLAR) was the gene most significantly downregulated in metastatic lesions. (D) Schematic diagram of the structure of circCFLAR and molecular validation: This gene is formed by reverse splicing of exons 6-8 of the CFLAR gene. PCR amplification was performed using the exon 8 exon expansion primers, and Sanger sequencing confirmed that the exon junction sequence completely matched the continuous sequence of exons 6-8 of the CFLAR gene.

[0022] Figure 2 The results showed that circCFLAR expression was downregulated in human CRC tissues and cell lines. (A) RT-qPCR results showed that circCFLAR expression in CRC tissues (cancer tissues) was significantly lower than in paired non-tumor adjacent tissues (normal tissues) (n=70). (B) RT-qPCR results showed that circCFLAR expression was lower in all five CRC cell lines compared to the normal colonic epithelial cell line FHC. Furthermore, its expression in the metastatic cell line SW620 was lower than in the primary tumor-derived cell line SW480.

[0023] Figure 3 The study showed that circCFLAR inhibits CRC cell migration. (A) Two siRNAs targeting circCFLAR effectively downregulated circCFLAR expression in CRC cells. (B) Transwell assays showed that downregulating circCFLAR expression promoted cell migration. (C) Transfection of CRC cells with a circCFLAR overexpression vector upregulated its expression. (D) Transwell assays showed that overexpression of circCFLAR inhibited cell migration. (E) Wound healing assays confirmed that knockdown of circCFLAR promoted cell migration, while overexpression inhibited it.

[0024] Figure 4 Downregulation of circCFLAR expression was shown to promote liver metastasis of CRC in nude mice.

[0025] Figure 5The circCFLAR is shown to be primarily located in the cytoplasm of CRC cells. (A) FISH shows that the circCFLAR is primarily located in the cytoplasm of CRC cells. Red: Cy3-labeled circCFLAR; Blue: DAPI-stained nuclei.

[0026] Figure 6 This demonstrates a mechanism model for circCFLAR-mediated CRC transfer suppression. Detailed Implementation

[0027] To facilitate understanding of the present invention, a more complete description will be given below with reference to specific embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples and comparative examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0030] 1. Experimental Materials 1.1 Cell lines and clinical samples 1.1.1 Cell lines Human CRC cell lines RKO, SW620, CACO2, HCT-116, SW480, and the normal colonic mucosal epithelial cell line FHC were all purchased from the American Type Culture Collection (ATCC, Manassas, Virginia, USA). All cells were cultured in the recommended culture medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator.

[0031] 1.1.2 Sources of Clinical Tissue Samples The human CRC tissue and its matched adjacent normal tissue (>5 cm from the tumor margin) used in this invention were obtained from patients undergoing radical surgical resection at the Department of General Surgery, Jiangsu Provincial People's Hospital Suqian Branch. All patients were pathologically diagnosed with primary colorectal adenocarcinoma and had not received any neoadjuvant radiotherapy or chemotherapy prior to surgery. All tissues were collected within 30 minutes of excision with the assistance of the pathologist, immediately aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C for subsequent analysis. This invention has been approved by the Ethics Committee of Jiangsu Provincial People's Hospital Suqian Branch (Approval No.: 2025-SR-0022), and all patients signed informed consent forms before surgery.

[0032] 1.2 The main reagents and materials are shown in Table 1.

[0033] Table 1 Main Reagents and Materials

[0034] 1.3 The main experimental instruments are shown in Table 2.

[0035] Table 2 Main Experimental Instruments

[0036] 2 Experimental Methods 2.1 Cell Culture 2.1.1 Cell resuscitation Remove the cell cryopreservation tubes from the -80℃ freezer and quickly place them in a preheated 37℃ water bath, gently shaking until completely thawed. Spray the walls of the cryopreservation tubes with alcohol and place them in a clean bench that has been irradiated with ultraviolet light and ventilated. Transfer the cell suspension to centrifuge tubes and add the appropriate culture medium containing 10% FBS. Mix well by pipetting and centrifuge at 1000 rpm for 5 min. Discard the supernatant, add an appropriate amount of complete culture medium to resuspend the cells, and then transfer the cell suspension to a T25 culture flask. Shake slowly and label the flask, then place it in a constant temperature and humidity cell culture incubator at 37°C and 5% CO2 for static culture.

[0037] 2.1.2 Cell passage When the cell density in a T25 culture flask reaches 80%-90%, discard the supernatant, wash three times with PBS buffer, add 0.25% trypsin-EDTA, gently shake to cover all cells, and incubate for 2-4 minutes. Observe cell morphology. When the cells become round and the gaps between them increase, gently pipette the cells to detach them. Then add complete culture medium, transfer the well-mixed cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 3-5 minutes, discard the supernatant, resuspend in fresh culture medium, aliquot into new culture flasks, add complete culture medium to 10 ml, label, and incubate at 37°C for further culture.

[0038] 2.1.3 Cell cryopreservation Collect cells in the logarithmic growth phase, digest them into a single-cell suspension using the passage method described above, transfer the cell suspension to a centrifuge tube, centrifuge at 1000 rpm for 5 min, discard the supernatant, add cell cryopreservation solution, gently pipette to mix, then transfer to cryovials, aliquot, seal, label with name, passage number, and date, and store. Store in an 80°C refrigerator or in liquid nitrogen.

[0039] 2.2 Reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) 2.2.1 RNA Extraction Collect the desired cells, wash three times with PBS buffer, add 1 mL of RNAiso Plus reagent, and repeatedly pipette until the lysis buffer is clear and free of clumps. Mix thoroughly and let stand at room temperature for 5 min. Add 200 μL of chloroform, shake vigorously for 15 s to emulsify thoroughly, let stand for a while, and centrifuge at 4℃ and 12000 rpm for 15 min. The solution will separate into three layers. Transfer 500 μL of the supernatant to a centrifuge tube, add an equal volume of 500 μL of isopropanol, mix thoroughly, and let stand for 10 min. Centrifuge at 12000 rpm for 10 min at 4℃. A white or translucent gelatinous precipitate will be visible at the bottom of the tube. Discard the supernatant. Add 500 μL of 75% ethanol to the centrifuge tube, vortex for 30 s, centrifuge at 7500 rpm for 5 min, remove the supernatant, and repeat the steps of adding 75% ethanol, vortexing, and centrifuging again. Discard the supernatant, open the centrifuge tube cap, and allow the precipitate to dry at room temperature for 3-5 min. After observing that the white precipitate becomes translucent, add 20 μL of DEPC water to dissolve the RNA precipitate. The RNA sample can be used directly for reverse transcription. It can be stored at -80℃ for a long time. The sample concentration (OD260) and purity (OD260 / OD280) should be between 1.8 and 2.0.

[0040] 2.2.2 circRNA reverse transcription 2.2.2.1 Genomic DNA Removal Reaction (gDNA Eraser Reaction) Prepare the reaction system according to Table 3 on ice in an RNase-free PCR tube, mix well, and react at 42°C for 2 min. It can be stored at 4°C.

[0041] Table 3 Reaction System

[0042] 2.2.2.2 Reverse transcription reaction In the above 10 µL gDNA removal reaction solution, the reaction system was prepared according to Table 4 for RNA reverse transcription. After oscillation and centrifugation, reverse transcription synthesis was performed according to Table 5 to obtain cDNA solution. Anhydrous enzyme was added to dilute it 5 times, and then it was stored in a -20℃ freezer.

[0043] Table 4 Reaction System

[0044] Table 5 Reaction conditions

[0045] 2.2.3 RT-qPCR The PCR reaction system was prepared according to Table 6 using the SYBR Green qPCR Master Mix kit, and after vortexing and centrifugation, the reaction was performed according to the procedure in Table 7. All primers were synthesized by Ribobio. Endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for circCFLAR, and the relative gene expression level was calculated using the 2^(-ΔΔCt) method. The relevant primer sequences are shown in Table 8.

[0046] Table 6 Reaction System

[0047] Table 7 Reaction Procedure

[0048] Table 8 Primer sequences

[0049] 2.3 PCR amplification of circCFLAR Prepare the reaction system in PCR tubes according to Table 9 on ice, centrifuge briefly, and then place them in the PCR instrument. Perform the reaction cycle according to the reaction program in Table 10.

[0050] Table 9 Reaction System

[0051] Table 10 Reaction Procedure

[0052] 2.4 Agarose gel electrophoresis and Sanger sequencing 2.4.1 Agarose Gel Electrophoresis Experiment Prepare a 1.5% agarose gel, heat until completely dissolved, remove and allow to cool naturally. Add nucleic acid dye, mix well, pour into a gel casting plate, insert a comb to avoid air bubbles, and remove the comb after cooling and setting. Place the agarose gel in an electrophoresis tank and pour in 1× TAE buffer to submerge the gel. Carefully add the PCR product to the sample wells after mixing with 6× DNA Loading Buffer. Electrophoresis is performed at a constant voltage of 120 V until the bromophenol blue band migrates to the appropriate distance in the gel. Under UV light, accurately cut a single, bright, and specific target band and place it into a pre-weighed 1.5 ml sterile centrifuge tube. After purification using a gel extraction kit, the purity is measured to be OD260 / 280 ≥ 1.8 and the concentration ≥ 20 ng / μL.

[0053] 2.4.2 Sanger Sequencing RT-qPCR products needed to be verified by Sanger sequencing alignment. The amplified products were purified using a 1.5% agarose gel electrophoresis kit and sent to Guangzhou Ribo Biotechnology Co., Ltd. for Sanger sequencing. The returned sequencing results were viewed using Chromas (Version 2.6.6) software. After verification, the obtained sequences were compared with the target sequences using NCBI BLASTA to confirm that the reverse splicing site sequences were consistent with the circBase database.

[0054] 2.5 circCFLAR overexpression vector, small interfering RNA, and cell transfection 2.5.1 Reagent preparation and dilution Guangzhou Ruibo Biotechnology Co., Ltd. successfully constructed the circCFLAR-pCD5-ciR plasmid overexpressing circCFLAR (the empty vector was pCD5-ciR plasmid from Guangzhou Gise Biotechnology Co., Ltd.; containing the full-length sequence of circCFLAR, as shown in SEQ ID NO. 1). A large amount of plasmid DNA was extracted. The plasmid concentration and purity (A260 / A280 ratio between 1.8 and 2.0) were measured, and the plasmid was stored at -20°C for later use. Sanger sequencing was used to verify the correctness of the circCFLAR insertion sequence, ensuring the integrity of the circular structure.

[0055] The small interfering RNA (siRNA) targeting the gene was provided by Suzhou Gemma Gene Co., Ltd. The siRNA sequence is detailed in Table 11. The siRNA was prepared into a 20 μM stock solution using sterile RNase-free water, aliquoted, and stored at -20°C, avoiding repeated freeze-thaw cycles. The stock solution was then diluted to the desired final concentration (20–100 nM) using serum-free medium.

[0056] Table 11 siRNA Sequences

[0057] 2.5.2 Cell Transfection Cells in the logarithmic growth phase were digested with trypsin and prepared into a single-cell suspension. 24 hours before transfection, cells were seeded at an appropriate density in 6-well plates to achieve 70%-80% cell confluence at transfection. The transfection complex was then prepared using two sterile EP tubes. Tube 1: 3.75 μL of Lipofectamine 3000 reagent was added to 125 μL of serum-free medium, gently mixed, and incubated at room temperature for 5 min. Tube 2: An appropriate amount of overexpression plasmid or siRNA was added to 125 μL of serum-free medium (experimental group: 2 μg circCFLAR-pCD5-ciR plasmid; 5 μL siRNA; control group: equal volume of scrambled siRNA or empty vector plasmid). Solution A was slowly added to solution B, gently mixed, and incubated at room temperature for 10 min to form the liposome-nucleic acid complex. Cell transfection was then performed. The original culture medium in the cell culture wells was aspirated, and the cells were gently washed once with PBS. 250 μL of the complex solution was slowly added to the cell wells, and the culture plate was gently agitated to ensure even distribution. The cells were incubated at 37°C with 5% CO2 for 6–8 hours, then the medium was replaced with complete medium containing 10% FBS and cultured for another 48 hours. RNA was extracted to verify circCFLAR expression 48 hours after transfection. All procedures were performed under aseptic conditions to avoid RNase contamination.

[0058] 2.6 Transwell migration experiment Cell migration ability was assessed using Transwell chambers. Treated cells were resuspended in serum-free medium at a concentration of 1 × 10⁶ cells per chamber. 5 Cells were seeded at a density of [number] cells per cell in the upper chamber. Complete culture medium containing 20% ​​FBS was added to the lower chamber as a chemotactic agent. The culture plate was incubated at 37°C with 5% CO2 for 48 hours. After incubation, the upper chamber was carefully removed, the lower chamber culture medium was discarded, and the lower surface of the membrane was gently washed twice with PBS. Migrating cells on the membrane were fixed with methanol for 10 minutes, followed by Giemsa staining for 15 minutes. After gentle rinsing with PBS, five cells were randomly selected at 200x magnification under a microscope for counting and statistical analysis.

[0059] 2.7 Cell scratch healing experiment Cells were seeded into 6-well plates. After cell treatment, when cell confluence reached ≥90%, a 10 μl sterile pipette tip was used to streak lines on the monolayer of cells perpendicular to the well plate to create scratches. Exfoliated cells were gently washed away with PBS, and the medium was replaced with serum-free medium. The scratched areas were photographed under a microscope, with 5 fields of view (×100) randomly selected at each time point.

[0060] 2.8 Fluorescence in situ hybridization Subcellular localization of circCFLAR was detected using FISH assays. Using a commercially available FISH kit, cultured CRC cells were fixed, permeabilized, and hybridized with Cy3-labeled DNA probes targeting circCFLAR. Unbound probes were then eluted. All images were acquired using confocal laser scanning microscopy.

[0061] 2.9 Cecal Orthotopic Implantation for Liver Metastasis Experiment SW620 cells with stable downregulation of circCFLAR and control cells were subcutaneously inoculated into the backs of nude mice. When the tumor grew to about 1 cm, the subcutaneous tumor tissue was cut into small tissue blocks of about 1.0 mm3 and sutured to the cecal serosa of the nude mice using a purse-string suture method. Ten mice were inoculated in each group. 500 μl of bispecific antibody was injected into the peritoneum to prevent infection. After the operation, the mice were observed regularly in small animal in vivo imaging. After the appearance of liver metastases, the nude mice were sacrificed about 1 week later and the liver tissue was removed to observe the metastasis.

[0062] 2.10 Statistical Analysis All statistical analyses were performed using GraphPad Prism 9.5.1 software. Quantitative data are expressed as mean ± standard deviation. Independent samples t-tests (two-tailed) were used for comparisons between two independent samples; paired t-tests were used for comparisons of circCFLAR expression levels between CRC tissues and their matched adjacent normal tissues. The association between circCFLAR expression and clinicopathological parameters was determined using the chi-square test and Fisher's exact test. Statistical significance was defined as follows: P<0.05, P<0.01, P<0.001, P < 0.0001; N indicates no significant difference.

[0063] 3. Results 3.1 circRNA sequencing revealed that the expression level of circCFLAR in liver metastases was lower than that in matched primary CRC lesions. To preliminarily explore circRNAs that may be involved in CRC liver metastasis, high-throughput circRNA sequencing technology was used to analyze primary CRC tissues and their paired liver metastases. The results showed that, compared with the primary lesion, 97 downregulated circRNAs were detected in the liver metastases. Figure 1 A). Among the circRNAs with the highest downregulation, 11 also showed lower expression in colon cancer tissues than in normal tissues in the public GEO database (GSE77661). Figure 1 B). A literature search revealed that five circular RNAs (hsa_circ_0026782, hsa_circ_0001136, hsa_circ_0000284, hsa_circ_0008285, and hsa_circ_0000567) have been reported in colorectal cancer. Therefore, RT-qPCR was used to validate the remaining six unreported circRNAs (hsa_circ_0000437, hsa_circ_0001788, hsa_circ_0014606, hsa_circ_0000915, hsa_circ_0001776, and hsa_circ_0001092). The results showed that hsa_circ_0001092 (circCFLAR) expression was most significantly downregulated in metastatic lesion samples. Figure 1 C). After amplifying the full-length sequence of hsa_circ_0001092 (SEQ ID NO. 1) using exponential primers, PCR and Sanger sequencing confirmed that it originated from exons 6-8 of the protein-coding gene CFLAR (Gene ID: 8837). Figure 1 D).

[0064] The full-length sequence of hsa_circ_0001092 (circCFLAR) is as follows (3'→5'): CTCCATAATGGGAGAGTAAAGAACAAAGACTTAAGGAACAGCTTGGCGCTCAACAAGAACCAGTGAAGAAATCCATTCAGGAATCAGAAGCTTTTTTGCCTCAGAGCATACCTGAAGAGAGATACAAGATGAAGAGCAAGCCCCTAGGAATCTGCCTGATAATCGATTGCATTGGCAATGAGACAG.

[0065] 3.2 circCFLAR is downregulated in CRC tissues and cell lines and is correlated with the patient's metastatic status. To investigate the expression characteristics of circCFLAR in CRC, the expression level of circCFLAR in 70 pairs of CRC tissues and adjacent normal tissues was first detected by RT-qPCR. The results showed that the expression level of circCFLAR in cancerous tissues was significantly lower than that in the corresponding adjacent normal tissues. Figure 2 Similarly, compared to the normal colonic epithelial cell line FHC, circCFLAR expression was generally downregulated in all five CRC cell lines (including SW480, SW620, etc.). Notably, the expression level of circCFLAR in the metastatic SW620 cell line was even lower than that in the primary lesion-derived SW480 cell line. Figure 2 Further correlation analysis with clinicopathological parameters showed that low expression of circCFLAR was associated with lymph node metastasis and liver metastasis in patients (Table 12). These results indicate that circCFLAR is a downregulated molecule in CRC, and its loss of expression may be closely related to the tumor metastasis process.

[0066] Table 12 Correlation between circCFLAR expression and clinicopathological features in CRC

[0067] (a) Patients were grouped according to the median expression level of circCFLAR.

[0068] (b) The age used for grouping is the median age of the patients.

[0069] (c) Group tumor sizes according to median.

[0070] (d) Since the theoretical frequency of ≥20% of cells is less than 5, Fisher's exact probability method is used.

[0071] 3.3 circCFLAR inhibits CRC cell migration Functional experiments were conducted to elucidate the effect of circCFLAR on the migration ability of CRC cells.

[0072] RT-qPCR analysis confirmed that transfection with two specific siRNAs targeting circCFLAR effectively downregulated the expression of circCFLAR in CRC cells. Figure 3 Transwell assays showed that knockdown of circCFLAR significantly enhanced cell migration (A). Figure 3 Conversely, circCFLAR overexpression vector successfully upregulated its expression in CRC cells, and this overexpression significantly inhibited cell migration. Figure 3C, D). Scratch healing experiments further validated this inhibitory effect: circCFLAR knockdown accelerated scratch healing, while circCFLAR overexpression significantly delayed scratch healing. Figure 3 In summary, these results indicate that circCFLAR plays a role in inhibiting cell migration in CRC.

[0073] 3.4 Downregulation of circCFLAR expression promotes liver metastasis of CRC in nude mice. To elucidate the effect of circCFLAR on CRC liver metastasis in vivo, animal experiments were conducted. Results showed that downregulating circCFLAR expression in SW620 cells resulted in liver metastasis in 9 out of 10 nude mice, compared to only 3 out of 10 mice in the control group. Figure 4 Therefore, circCFLAR also plays a role in regulating liver metastasis in vivo.

[0074] 3.5 circCFLAR is mainly located in the cytoplasm of CRC cells. Because circRNAs located in the nucleus and cytoplasm participate in different mechanisms of action, FISH was used to determine the subcellular localization of circCFLAR in CRC cells in order to elucidate the molecular mechanisms underlying the biological function of circCFLAR. The results showed that circCFLAR is mainly located in the cytoplasm (…). Figure 5 ).

[0075] 4. Discussion This invention reveals the inhibitory role of circCFLAR in colorectal cancer (CRC) metastasis and its potential molecular mechanism. It was found that circCFLAR directly binds to hnRNPA2B1, blocking its nuclear importation. This interaction, in turn, reduces hnRNPA2B1-mediated miR-33b-5p production, thereby relieving the inhibition of the tumor suppressor SIK1 and ultimately inhibiting CRC metastasis. This not only reveals a novel function of circCFLAR as a tumor suppressor, suggesting a potential therapeutic target for CRC, but also elucidates a four-level regulatory network of circRNA-RNA-binding protein (RBP)-miRNA-mRNA. Unlike the classic miRNA sponge model, which is localized in the cytoplasm, circRNA influences miRNA regulation of mRNA by regulating the nucleoplasmic localization of RBP.

[0076] The stability inherent in the unique closed circular structure of circRNAs makes them closely associated with tumorigenesis and development. High-throughput sequencing of liver metastases has identified significantly downregulated circRNAs. Current research largely focuses on primary CRC lesions and their matched adjacent normal tissues, while analysis of liver metastases is relatively limited. In this invention, circCFLAR was found to play a tumor-suppressive role in CRC, exhibiting potential differences in function compared to its parental gene. Correlation analysis with clinicopathological parameters showed a correlation between low circCFLAR expression and metastasis, indicating clinical significance. Due to the unique stability of circRNAs in body fluids, future research could further explore the expression levels of circRNAs in the plasma or exosomes of CRC patients to assess their clinical value as a biomarker for predicting metastasis risk.

[0077] This invention screens differentially expressed circRNAs starting from CRC liver metastases, improving the efficiency of identifying key metastasis-related molecules. Furthermore, regarding the mechanism of action, it reveals a mechanism different from the classic ceRNA sponge mechanism and encoded polypeptide mechanism: circRNAs can influence miRNA processing and maturation by affecting RBP subcellular localization. Preliminary in vitro and in vivo experiments show that circCFLAR inhibits CRC metastasis by upregulating SIK1 expression through the hnRNPA2B1 / miR-33b-5p / SIK1 axis.

[0078] circCFLAR is expressed at low levels in primary CRC lesions and shows preliminary correlation with liver and lymph node metastasis. In vitro experiments have demonstrated that circCFLAR can inhibit the migration ability of CRC cells. Its molecular mechanism (…) Figure 6 Cytoplasmic circCFLAR binds to hnRNPA2B1 and inhibits its nuclear translocation, which reduces the biosynthesis of hnRNPA2B1-dependent oncogenic miR-33b-5p, thereby upregulating the expression of the tumor suppressor SIK1 and ultimately inhibiting CRC metastasis.

[0079] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Therefore, any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A primer for detecting circular RNA circCFLAR, characterized in that, The primers include a forward primer and a reverse primer, the forward primer having a nucleotide sequence as shown in SEQ ID NO. 1, and the reverse primer having a nucleotide sequence as shown in SEQ ID NO.

2.

2. A kit for detecting circular RNA circCFLAR, comprising the primers as described in claim 1.

3. The use of the primers as described in claim 1 or the kits as described in claim 2 in the preparation of products for the diagnosis or prognostic assessment of colorectal cancer metastasis.

4. The application according to claim 3, characterized in that, The metastasis refers to liver metastasis or lymph node metastasis.

5. The application according to claim 3, characterized in that, The diagnostic or prognostic assessment includes: a) Detect the expression level of circular RNA circCFLAR in the test sample; b) Compare the detected expression levels with those of the control sample; c) If the expression level of circular RNA circCFLAR in the test sample is significantly lower than that in the control sample, it indicates an increased risk of colorectal cancer metastasis or a poor prognosis; The test samples were selected from colorectal cancer tissue, adjacent tissue, blood, or plasma.

6. Application of reagents for overexpressing circular RNA circCFLAR in the preparation of drugs for inhibiting the migration of colorectal cancer cells.

7. The application according to claim 6, characterized in that, The drug is a recombinant overexpression vector of the circular RNA circCFLAR.

8. The application according to claim 6, characterized in that, The drug inhibits the migration of colorectal cancer cells by upregulating the expression level of the circular RNA circCFLAR in colorectal cancer cells.

9. A method for screening candidate drugs for the treatment or prevention of colorectal cancer metastasis, characterized in that, Includes the following steps: a) Contact the candidate material with colorectal cancer cells expressing the circular RNA circCFLAR; b) Detect the expression level of circular RNA circCFLAR in the cells; c) If the candidate substance can upregulate the expression level of circular RNA circCFLAR, it indicates that it is a potential candidate drug for the treatment or prevention of colorectal cancer metastasis.

10. The application according to claim 9, characterized in that, The colorectal cancer cells were RKO or SW620 cell lines.