Snps associated with chicken rectal length and use thereof

Abstract

The application provides a SNP molecular marker related to the length of a chicken rectum and an application thereof, and belongs to the field of animal genetic breeding and biotechnology. The SNP molecular marker comprises RL_tag1 or RL_tag2. The Ensembl number of the RL_tag1 is rs314848001, which corresponds to the 33053818th position of the positive strand of a chromosome 2 in a chicken reference genome bGalGal1.mat.broiler.GRCg7b sequence 2 published by NCBI, is located in the 1st intron of a gene JAZF1, and the base at the position is C or G. The Ensembl number of the RL_tag2 is rs314840368. The SNP molecular marker is helpful to genetically improve the length of a rectum of a laying hen, is applied to genetic breeding of a chicken, is favorable to improve the length of a rectum, and is favorable to obtain a laying hen breed with better water-salt balance.

Description

Technical Field

[0001] This invention belongs to the fields of animal genetics and breeding and biotechnology, and specifically relates to SNP molecular markers related to the length of the chicken rectum and their applications. Background Technology

[0002] The rectum is a vital organ for water absorption and electrolyte metabolism in laying hens. Current research has found that the rectum plays a crucial role in sodium, chloride, and water balance in chickens; partial rectal removal increases the water content of excrement, affecting metabolic function. Therefore, rectal length can serve as an important indicator for selective breeding of laying hens. However, rectal length is primarily determined post-slaughter, making conventional selection difficult. Compared to traditional breeding methods, molecular selection using trait-related markers can effectively accelerate the breeding process. Therefore, identifying molecular marker sites that influence rectal length and improving breeding populations is of great significance for the production performance and economic benefits of laying hens.

[0003] In recent years, GWAS methods have been extended to the analysis of the genetic structure of quantitative traits in laying hens, mainly used for studies on egg production, feed utilization efficiency, and egg quality. However, the genetic structure of rectal length in laying hens is rarely analyzed using GWAS. Rectal length is regulated by multiple genes with minor effects, and conventional breeding methods are unlikely to achieve significant genetic progress. Only by clarifying the genetic structure of rectal length and improving the accuracy of breeding through genomic selection can we achieve a genetic impact on rectal length. Summary of the Invention

[0004] To genetically improve the rectal length of laying hens, this invention provides SNP molecular markers related to chicken rectal length. These SNP molecular markers help to genetically improve the rectal length of laying hens. Applying them to chicken genetic breeding can improve rectal length and obtain laying hen breeds with better water and salt balance.

[0005] This invention also provides the application of SNP molecular markers related to chicken rectal length in chicken genetic breeding.

[0006] This invention is achieved through the following technical solution: This invention provides SNP molecular markers related to the length of the chicken rectum, wherein the SNP molecular markers include RL_tag1 or RL_tag2; The Ensembl number of RL_tag1 is rs314848001, which corresponds to position 33053818 on the positive strand of chromosome 2 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b sequence published by NCBI. It is located in the first intron of the gene JAZF1, and the base here is C or G. The Ensembl number of RL_tag2 is rs314840368, which corresponds to position 33049475 on the positive strand of chromosome 2 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b sequence published by NCBI. Here, the base is either A or T.

[0007] Based on the same inventive concept, this invention provides the application of SNP molecular markers related to chicken rectal length in chicken genetic breeding.

[0008] Based on the same inventive concept, the present invention provides an early selection method for the chicken rectal length trait, the early selection method comprising early selection of the chicken rectal length trait based on the genotype of the above-mentioned SNP molecular markers related to chicken rectal length.

[0009] Optionally, the early selection method specifically includes: Detect the genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested; Early selection of the rectal length trait in the target chickens based on the genotypes of RL_tag1 and / or RL_tag2; Among them, the rectal length of individuals with the GG genotype of RL_tag1 was greater than that of individuals with the CC genotype (P<0.01), and the rectal length of individuals with the CG genotype was greater than that of individuals with the CC genotype (P<0.01). The rectal length of individuals with the TT genotype in RL_tag2 was greater than that of individuals with the AT genotype (P<0.01), and the rectal length of individuals with the AT genotype was greater than that of individuals with the AA genotype (P<0.01).

[0010] Optionally, the detection of the genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested specifically includes: The genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested were detected. The method for detecting the RL_tag1 genotype in the chicken genome is as follows: Using Pr_RL1f and Pr_RL1r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 33053818 on the positive strand of chromosome 2 of the chicken to be tested; The detection method for the RL_tag2 genotype in the chicken genome to be tested is as follows: Using Pr_RL2f and Pr_RL2r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 33049475 on the positive strand of chromosome 2 of the chicken to be tested; The nucleotide sequence of Pr_RL1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_RL1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_RL2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_RL2r is shown in SEQ ID NO.4.

[0011] Preferably, the breed of chicken to be tested includes Dongxiang green-shelled chicken and / or White Leghorn chicken.

[0012] Based on the same inventive concept, the present invention provides detection primers for SNP molecular markers related to chicken rectal length, the detection primers including primers for detecting RL_tag1 and / or primers for detecting RL_tag2; The primers for detecting RL_tag1 include Pr_RL1f and Pr_RL1r, and the primers for detecting RL_tag2 include Pr_RL2f and Pr_RL2r; The nucleotide sequence of Pr_RL1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_RL1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_RL2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_RL2r is shown in SEQ ID NO.4.

[0013] Based on the same inventive concept, this invention provides the application of detection primers for SNP molecular markers related to chicken rectal length in chicken genetic breeding.

[0014] Based on the same inventive concept, the present invention provides a kit containing detection primers for the above-mentioned SNP molecular markers related to chicken rectal length.

[0015] Based on the same inventive concept, the present invention provides the application of the above-mentioned reagent kit in chicken genetic breeding.

[0016] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention relates to SNP molecular markers associated with chicken rectal length, including RL_tag1 and RL_tag2. Dominant genotypes of RL_tag1 and RL_tag2 have significantly longer rectal lengths than other genotypes. Both RL_tag1 and RL_tag2 contribute to genetically improving rectal length in laying hens. Applying them to chicken genetic breeding can improve rectal length, resulting in laying hen breeds with better water and salt balance, and can also accelerate the breeding process. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Manhattan plot of GWAS analysis of rectal length in resource population in Embodiment 2 of the present invention; Figure 2 This is a QQ plot of GWAS analysis of rectal length in the resource population in Embodiment 2 of the present invention; Figure 3 Box plots of rectal length in individuals with different genotypes in Examples 3-4 of this invention. Detailed Implementation

[0019] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0020] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0021] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0022] The following will provide a detailed description of the SNP molecular markers related to chicken rectal length and their applications, in conjunction with embodiments and experimental data.

[0023] Example 1 Resource Group Building To analyze the genetic structure of laying hens' traits, a laying hen resource population was constructed based on the F2 design. The local Dongxiang Green-shelled Chicken and the selectively bred White Leghorn Chicken were used as parents, and the F1 generation was obtained through reciprocal crosses. The F2 generation was then bred using the F1 generation as parents. Pedigree information was recorded. Experimental chickens were individually tagged with wing tags and housed in single cages in a fully enclosed chicken house. Artificial lighting was provided for 16 hours during the laying period, and cooling was achieved using fans and evaporative cooling pads. Routine immunizations were administered according to the immunization program established by the Jiangsu Provincial Institute of Poultry Science. Feed was supplied by COFCO, and the laying hen feed composition included 16.5% crude protein and 11511 kJ / kg metabolizable energy. During the laying period, chickens had free access to feed, with water provided by nipple drinkers, feed supplied by a traveling feeder, and manure removed by a manure conveyor belt. Rectal length was measured according to industry standards.

[0024] The rectal length data underwent initial screening to remove obviously erroneous and duplicate data, outliers were removed, and the data was compiled into an Excel spreadsheet. After data cleaning, the F2 generation rectal length dataset of the resource population had 1416 records remaining, which were used for the next step of GWAS analysis to analyze its genetic structure.

[0025] Example 2 GWAS analysis of rectal length The experimental chickens were adult hens from the F2 generation of the laying hen resource population constructed in Example 1. Approximately 0.5 ml of blood was collected from the wing vein of the experimental chickens and placed in BD anticoagulant tubes (Suzhou BD Medical Instruments Co., Ltd.) for storage at -70℃. Genomic DNA was extracted and analyzed by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry. After passing the analysis, the DNA sample was diluted to 50±5 ng / μl for genotyping using a gene chip.

[0026] Using Affymetrix gene chip from Affymetrix Axiom Genotyping was performed using a 600K Chicken Genotyping Array. Data quality control was conducted according to the array's instruction manual, including: pre-genotyping quality control using APT software; PLINK quality control to remove SNPs with a detection rate below 0.97 and those deviating from Hardy-Weinberg equilibrium; SNP screening using metrics.R, SNP_filter.R, and SNP, CR, and FLD information analysis; and genotyping using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0027] Prior to genome-wide association analysis (GWAS), multidimensional principal component analysis (PCA) was performed to eliminate false positives and assess population structure. The first five principal components were added as covariate parameters to the genetic model, and the chicken coop effect was incorporated into the model as a fixed effect. The independence test estimates for each SNP were calculated using the R script "simpleM" method, yielding 59,308 independent markers. Using multiple correction, a significant genomic threshold of 1.69 × 10⁻⁶ was determined. -5 The rectal length of laying hens was analyzed using a mixed linear model, and the p-values ​​for the significance test of each SNP were obtained. The matrix expression of the linear model is as follows:

[0028] Where y represents the sample phenotypic value vector; W represents the covariance matrix; α is the intercept vector; x is the marker genotype vector; β is the marker effect value; G is the genetic relationship matrix constructed based on the microarray; u is the random effect vector (here, the breeding value); and ε is the residual.

[0029] GWAS screening yielded RL_tag1 and RL_tag2 (Table 1) associated with rectal length. Genome-wide association analysis was performed on rectal length in 1416 chickens, and the results are as follows: Figure 1 , Figure 2 As shown. By Figure 1 The Manhattan plot shows that a genome-wide marker is present on chicken chromosome 2, specifically located in the JAZF1 gene. The QQ plot further verifies the reliability of the GWAS results.

[0030] Table 1 Molecular markers associated with rectal length ; Wherein: the physical location of the marker chromosome is referenced to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b).

[0031] Example 3 Detection and validation of molecular marker RL_tag1 Candidate gene association analysis was performed on the Dongxiang green-shelled egg-laying chicken-Leihun chicken resource population using the aforementioned SNP molecular markers. The specific steps are as follows: 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. Primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0032] Table 2. Amplification primers used for detecting the molecular marker RL_tag1 for chicken rectal length. ; 2) Genomic DNA extraction: Genomic DNA was extracted from 1395 blood samples using the phenol-formaldehyde method. After passing the tests by ultraviolet spectrophotometer and agarose electrophoresis, PCR amplification was performed.

[0033] 3) PCR amplification process: ① Reaction system: The 20μl system includes 50ng of DNA template for identification, 10ng each of forward and reverse primers, 10μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0034] ②Reaction procedure: First, denature at 94℃ for 2 min; then denature at 94℃ for 30 s, anneal at 55.2℃ for 30 s, extend at 72℃ for 30 s, for a total of 30 cycles; extend at 72℃ for 5 min, and store at 4℃.

[0035] 4) The amplified products are sent to a sequencing company for sequence polymorphism detection.

[0036] The amplified fragment sequence is shown below: >RL_tag1 CACCCCTTCTGGTCACTCAG GTGCATTGCATGCACCTGAGCTCCCCTGGGCTGGTCCTGTCTTCCCACCAGGAGCTCAATCACTAATTCAAGCCATGACAGCATTTCCACTACATCTTCCACAAACTACTTCCATTCCTTGCTTCAACTTCAATTTTATC CCCTCTTTATGCCTTGTTATACTCTGCTTCTTTGCTTCCTCTAGCAGGGAGTGTGTGAAAGATCAGGAAAGAGATGTTAG[C / G]CATCAGTAAAGAATTGAGCCAATACATGCAGGCTAGTTTCTTCTTGACTCCAAACCT TGGTATTTCAGCATTAGTCCTTCAGCTTGAGAGATGAATATCACACCCTCAATGAAGACAGAAAAGGAACTTTCTGTATTTAGTGGGTTCAAGTACAAACACAGGGTTCTTATCAGTAAGTATCACAAGTAAACTGTATCA TACTATTATATTTGTGTAAGCATTCTGTTCCAAAGCTGTACTTGCACCACAGAGTATAAAAAAATAAATAAATCAGATCAGTGAGCATTCACAAGAAAGAAAGCTTTGAGATTTTACATGATGGAGTGGTTCTGTAGTTT CAGGACAGAGGAGCAGCAAC In the sequence, [ ] indicates mutation sites, where allele variation is represented, and bold and underlined sequences are primer sequences.

[0037] 5) Association analysis: All participants had their genotype and rectal length, and then a significance test was performed. The analysis results are as follows: Figure 3 As shown, the rectal length of individuals with the GG genotype was 7.67±1.61 cm, that of individuals with the CG genotype was 7.54±1.60 cm, and that of individuals with the CC genotype was 7.21±1.66 cm. One-way ANOVA showed that the differences in rectal length among the three genotypes were extremely significant, and pairwise comparisons further confirmed the extremely significant differences in rectal length. Increasing the frequency of the G allele through genotyping technology can significantly improve the rectal length in laying hens.

[0038] Example 4 Detection and validation of molecular marker RL_tag2 Candidate gene association analysis was performed on the Dongxiang green-shelled egg-laying chicken-Leihun chicken resource population using the aforementioned SNP molecular markers. The specific steps are as follows: 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. Primer information is shown in Table 3. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0039] Table 3. Amplification primers used for detecting the molecular marker RL_tag2 for chicken rectal length. ; 2) Genomic DNA extraction: Genomic DNA was extracted from 1395 blood samples using the phenol-formaldehyde method. After passing the tests by ultraviolet spectrophotometer and agarose electrophoresis, PCR amplification was performed.

[0040] 3) PCR amplification process: ① Reaction system: The 20μl system includes 50ng of DNA template for identification, 10ng each of forward and reverse primers, 10μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0041] ②Reaction procedure: First, denature at 94℃ for 2 min; then denature at 94℃ for 30 s, anneal at 55.1℃ for 30 s, extend at 72℃ for 30 s, for a total of 30 cycles; extend at 72℃ for 5 min, and store at 4℃.

[0042] 4) The amplified products are sent to a sequencing company for sequence polymorphism detection.

[0043] The amplified fragment sequence is shown below: >RL_tag2 CACTCCAGCATCTTCAGCCT ACTCCTTTACACAGGAGGCAACCCAGCCCTGCTGCTCACCAGCTGCTTCCACCTCCCTTGGGTTCATTCTCTTAGTGACCAGCCTGAGCCAAGTGGCGCTTGCAGTAACTTCTACATATGGAAAAGGC ACACCTCCAAGCATCAATGTTTATTATTGCCATCAACTTATCTATAACTTTAACATTGTTATCAACCAATACCTTGCACTT[A / T]AGCAGGAAAATTATGTTCACTTGCTGTCTTTCATTACACAGTA TTCCCTTCCCTCTTTCGCCTAAGTCAACGTGGAAATTCATACATCAGACCAATATCTGAAACAGCATTTTCACCTCCACAGGAACATGGTCACGTACTGGAAAACCTTAGAATTCAGATTTTCATCCCTTTTATTACTATTTGAAAGATTTGGCAGAAAACAAACAAACAAAATAACAAAACCAAACCAAACATTTTTAAACAGGGCAAAGATAAGATAGCAGTGCTTTAAGTAAAAAAACCAACCAAAAAAGGAAC CCCACAGGACGCAATCATCA In the sequence, [ ] indicates mutation sites, where allele variation is represented, and bold and underlined sequences are primer sequences.

[0044] 5) Association analysis: All participants had their genotype and rectal length, and then a significance test was performed. The analysis results are as follows: Figure 3 As shown, the rectal length of individuals with the TT genotype was 7.68±1.61 cm, that of individuals with the AT genotype was 7.50±1.64 cm, and that of individuals with the AA genotype was 7.20±1.58 cm. One-way ANOVA showed that the differences in rectal length among the three genotypes were extremely significant, and pairwise comparisons further confirmed the existence of extremely significant differences in rectal length. Increasing the frequency of the T allele through genotyping technology can significantly improve the rectal length in laying hens.

[0045] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0046] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0047] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A SNP molecular marker associated with chicken rectal length, characterized in that, The SNP molecular markers include RL_tag1 or RL_tag2; The Ensembl number of RL_tag1 is rs314848001, which corresponds to position 33053818 on the positive strand of chromosome 2 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b sequence published by NCBI. It is located in the first intron of the gene JAZF1, and the base here is C or G. The Ensembl number of RL_tag2 is rs314840368, which corresponds to position 33049475 on the positive strand of chromosome 2 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b sequence published by NCBI. Here, the base is either A or T.

2. The application of the SNP molecular markers related to chicken rectal length as described in claim 1 in chicken genetic breeding.

3. A method for early selection of chicken rectal length traits, characterized in that, The early selection method includes early selection of the chicken rectal length trait based on the genotype of the SNP molecular marker as described in claim 1.

4. The method for early selection of chicken rectal length traits according to claim 3, characterized in that, The early selection method specifically includes: Detect the genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested; Early selection of the rectal length trait in the target chickens based on the genotypes of RL_tag1 and / or RL_tag2; Among them, the rectal length of individuals with the GG genotype of RL_tag1 is greater than that of individuals with the CC genotype, and the rectal length of individuals with the CG genotype is greater than that of individuals with the CC genotype. The rectal length of individuals with the TT genotype in RL_tag2 is greater than that of individuals with the AT genotype, and the rectal length of individuals with the AT genotype is greater than that of individuals with the AA genotype.

5. The method for early selection of chicken rectal length traits according to claim 4, characterized in that, The detection of the genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested specifically includes: The genotypes of molecular markers RL_tag1 and / or RL_tag2 in the genome of the chicken to be tested were detected. The method for detecting the RL_tag1 genotype in the chicken genome is as follows: Using Pr_RL1f and Pr_RL1r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 33053818 on the positive strand of chromosome 2 of the chicken to be tested; The detection method for the RL_tag2 genotype in the chicken genome to be tested is as follows: Using Pr_RL2f and Pr_RL2r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 33049475 on the positive strand of chromosome 2 of the chicken to be tested; The nucleotide sequence of Pr_RL1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_RL1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_RL2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_RL2r is shown in SEQ ID NO.

4.

6. A method for early selection of chicken rectal length traits according to claim 4 or 5, characterized in that, The breeds of chickens to be tested include Dongxiang Green-shelled Egg Chicken and / or White Leghorn Chicken.

7. The detection primers for SNP molecular markers related to chicken rectal length as described in claim 1, characterized in that, The detection primers include primers for detecting RL_tag1 and / or primers for detecting RL_tag2; The primers for detecting RL_tag1 include Pr_RL1f and Pr_RL1r, and the primers for detecting RL_tag2 include Pr_RL2f and Pr_RL2r; The nucleotide sequence of Pr_RL1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_RL1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_RL2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_RL2r is shown in SEQ ID NO.

4.

8. The application of the detection primers for SNP molecular markers related to chicken rectal length as described in claim 7 in chicken genetic breeding.

9. A reagent kit, characterized in that, The kit contains the detection primers for the SNP molecular markers related to chicken rectal length as described in claim 7.

10. The application of the kit as described in claim 9 in chicken genetic breeding.

Images