SNP molecular marker related to maturity period of apple fruit and application

Abstract

The present application relates to a SNP molecular marker related to the maturity period of apple fruit and application. According to the result of the correlation analysis of the base at position 29044419 in the gene coding region of chromosome 3 of Malus sieversil haploid v1.0 genome and the maturity of apple, it is found that different genotypes of the site are significantly related to the maturity period of apple fruit, and there is a molecular marker for early selection of the maturity period of apple fruit. Through KASP method, accurate genotyping identification is carried out on the site, and it is found that the genotype of the site is related to the early and late maturity of apple fruit and the genotype as follows: CC genotype is early than CG genotype, GG genotype. Therefore, the SNP molecular marker of the present application can effectively identify the maturity period of apple fruit, and then the KASP method can be used to quickly, efficiently and low-costly assist in breeding early-maturing apple varieties in the seedling stage of apple.

Description

Technical Field

[0001] This invention relates to the field of apple molecular breeding, specifically to a SNP molecular marker and its application related to the ripening period of the Tianshan wild fruit forest Sevezi apple. Background Technology

[0002] Apple production plays a vital role in my country's agriculture. Currently, my country's apple varieties are predominantly late-maturing, with relatively few early-maturing varieties, and these are mainly imported varieties, lacking high-quality early-maturing apple varieties with intellectual property rights. Furthermore, the limited number of early-maturing apple varieties and their inconsistent ripening times easily lead to insufficient yields and high prices for early-maturing apples. Therefore, cultivating new high-quality early-maturing apple varieties can not only enrich apple germplasm resources but also increase the diversity of the apple market, reduce the price of early-maturing apples, and promote the development of the apple industry. The Xinjiang wild apple (also known as the Serweis apple) is the main dominant species in the wild fruit forests of the Tianshan Mountains, accounting for about 90% of the total area of ​​wild fruit forests in the Tianshan Mountains. It is an important germplasm resource for studying the genetic diversity and gene evolution of apple trees; therefore, using it to study the ripening period of apple fruits is of great significance for cultivating early-maturing apple varieties.

[0003] The ripening period of apple fruit is closely related to the fresh fruit supply period and fruit quality, and its genetic regulatory mechanism has attracted much attention in fruit tree research. Research on the ripening period of apple fruit is limited. Current studies using genome-wide association studies (GWAS) and expression profiling have identified the NAC transcription factor MdNAC18.1 as a core gene regulating apple ripening. It can activate the expression of key biosynthetic genes MdACS1 and MdACO1-like, promoting ethylene production and thus accelerating fruit ripening. Simultaneously, the NAC transcription factor MdNAC18.1 also has a self-suppression mechanism. It forms a CTAAC recognition site through a 61-bp repeat in its promoter region, suppressing its own expression, reducing ethylene synthesis, and delaying fruit ripening. Early-maturing varieties lack this sequence, creating a difference between them and late-maturing varieties.

[0004] There are few reports on the development and application of markers for apple fruit ripening time. Currently proposed markers include MdNAC18.1-STS, MdACS1-Indel, and MdNAC25-Indel, but methods for selecting and breeding apple fruit ripening time markers are limited. Therefore, enriching the markers for apple fruit ripening time and accurately and efficiently identifying the ripening time of apple fruits is an urgent problem that needs to be solved.

[0005] KASP (Kompetitive Allele-Specific PCR) is a genotyping technique based on PCR and fluorescent probes. It uses specific base pairing at the primer ends to genotype SNP loci. This technique is widely used for SNP detection and analysis due to its advantages of high throughput, strong genetic stability, accuracy, convenience, and low cost. Discovering SNP loci related to apple fruit ripening and developing related molecular markers can provide a deeper understanding of the molecular genetic mechanisms affecting apple ripening, offering a theoretical basis for the genetic improvement of apple fruit ripening traits and accelerating the breeding of new apple varieties in my country. Summary of the Invention

[0006] The purpose of this invention is to provide a SNP molecular marker related to apple fruit ripening period and its application. Different genotypes of this SNP locus are significantly associated with apple fruit ripening period traits, and its dominant allele is C. This SNP molecular marker can serve as a basis for early selection of apple fruit ripening period traits.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides a SNP molecular marker related to the ripening period of apple fruit. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1. The SNP molecular marker is located at position 29044419 of the gene coding region on chromosome 3 of the Malus sieversilhaploid v1.0 genome, and the alleles of the SNP molecular marker are C and G.

[0008] Based on the above scheme, the dominant allele of the SNP molecular marker is C.

[0009] This invention provides a primer pair for detecting the above-mentioned SNP molecular markers, wherein the KASP primers are shown in SEQ ID NO. 1-3: Specifically, the nucleotide sequences of the primer pairs are shown in the upstream typing primer-F, upstream typing primer-H, and downstream primer-R: Upstream typing primer-F: 5'GAAGGTGACCAAGTTCATGCTCATGTTGGTGCAATGGTGGAGTCTC 3' (SEQ ID NO.1); Upstream typing primer-H: 5'GAAGGTCGGAGTCAACGGATTCATGTTGGTGCAATGGTGGAGTCTG 3' (SEQ ID NO.2); Downstream primer-R: 5'GACGGCTGCTGTTCCTTCATCAAGC 3' (SEQ ID NO.3).

[0010] The application of a SNP molecular marker associated with apple fruit ripening period in detecting apple fruit ripening period is characterized by the detection of early-maturing apple varieties through the identification of the SNP molecular marker.

[0011] A method for determining the ripening period of apples, characterized by comprising the following steps: Step (1): Extract genomic DNA from the apples to be tested; Step (2): Using the primer pair described in claim 2, PCR amplification is performed with the DNA of the apple to be tested as a template. After obtaining the PCR amplification product, gel electrophoresis is performed. Step (3): The target band in the gel electrophoresis results is cut and sequenced to obtain the sequencing results; Step (4): Compare the sequencing results with the SNP molecular markers described in claim 1 to determine the ripening period of the apple to be tested; The relationship between the timing of apple fruit ripening and genotype is as follows: the CC genotype ripens earlier than the CG and GG genotypes.

[0012] The application of an SNP molecular marker related to apple fruit ripening period in apple breeding is characterized by selecting early-maturing apple varieties with genotype C / C for breeding.

[0013] The SNP molecular marker and its application related to apple fruit ripening period described in this invention have the following beneficial effects: According to embodiments of the present invention, the relationship between the timing of apple fruit maturity and genotype at the SNP molecular markers described herein is as follows: the CC genotype matures earlier than the CG and GG genotypes. Therefore, the SNP molecular markers of the present invention can effectively identify early-maturing apples, thereby enabling a deeper understanding of the molecular genetic mechanisms influencing apple fruit maturity-related traits, providing a theoretical basis for the genetic improvement of apple fruit maturity-related traits, and accelerating the breeding of new apple varieties in my country. Attached Figure Description

[0014] The present invention includes the following figures: Figure 1 This is a graph showing the results of the genome-wide association analysis of apple fruit ripening period in this invention; Figure 2 The sequencing results of the SNP molecular marker Xinjiang Saiweishi provided in this embodiment of the invention show that the [CC] genotype is an early-maturing apple variety. Figure 3 The results of genotyping of 343 Xinjiang Seves apples using KASP primer pairs are shown in the figure. Figure 4 The results of genotyping of 36 apple varieties using KASP primer pairs are shown in the figure: Germplasm Resources. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to the accompanying drawings. The embodiments are used to illustrate the specific content of the present invention, but are not intended to limit the scope of the invention.

[0016] Example: This invention develops a SNP molecular marker associated with apple fruit ripening period and its application. This molecular marker was obtained by detecting the polymorphism at position 29044419 on chromosome 3 of the Malus sieversil haploid v1.0 genome, and is associated with the apple fruit ripening period trait. The specific development process is as follows: Based on apple fruit maturity, apple fruit maturity is divided into grades 1-7, with grades 1-3 being early-maturing apples, grades 3-5 being mid-maturing apples, and grades 6-7 being late-maturing apples. Combined with whole-genome resequencing data, important associated SNP loci variants on chromosome 3 were identified, such as... Figure 1 As shown.

[0017] Step 1: Extract total DNA from apple leaves In order to extract genomic DNA from Xinjiang Sevesh apples, the applicant took the following specific steps: (1) Take a fresh leaf with a length of 1cm and put it into a 2ml centrifuge tube. Add two steel balls with a diameter of 4mm, quickly immerse it in liquid nitrogen to freeze, and grind it with a grinder.

[0018] (2) Add 300 μL of CTAB to the centrifuge tube and mix it in a constant temperature water bath at 65°C for 30 minutes, gently mixing once every 15 minutes.

[0019] (3) Add 300 μL of a mixture of chloroform and isoamyl alcohol (volume ratio 24:1), gently invert to mix, centrifuge at 10,000 rpm for 10 minutes at room temperature, aspirate 100 μL of the supernatant and transfer it to a new 2 ml centrifuge tube.

[0020] (4) Add 100 μL of isopropanol, place at -20℃ for 30 minutes to precipitate DNA; centrifuge at 10,000 rpm for 5 minutes at 4℃ to precipitate DNA, and discard the supernatant. Wash the precipitate twice with 75% ethanol solution and then place it in a fume hood to dry.

[0021] (5) Add 100 μL of double-distilled water to dissolve the DNA, measure the concentration of DNA with a UV spectrophotometer, adjust to 50 ng / μL, and store in a -20℃ refrigerator for later use.

[0022] Step 2: Primer synthesis and PCR amplification Based on the apple reference genome, KASP primers were designed using DNAMAN and SnapGene. Three primers were used, with two specific primers having FAM and HEX fluorescent sequences attached to their 5' ends, respectively. Two ODs of each primer were synthesized. The upstream genotyping primers -F / H were dissolved in 45 μL of ultrapure water, and the downstream primer -R was dissolved in 228 μL of ultrapure water. After vortexing, 36 μL of each primer was mixed, and the vortexed mixture was used for PCR.

[0023] The constructed primers are shown below: Upstream typing primer-F: 5'-GAAGGTGACCAAGTTCATGCTCATGTTGGTGCAATGGTGGAGTCTC-3'; Upstream typing primer-H: 5'-GAAGGTCGGAGTCAACGGATTCATGTTGGTGCAATGGTGGAGTCTG-3'; Downstream primer-R: 5'-GACGGCTGCTGTTCCTTCATCAAGC-3'; The PCR reaction system of the KASP method is shown in Table 1 below: Table 1 ;

[0024] After preparing the PCR reaction system, add 10 μL of mineral oil for amplification. The amplification reaction program of the KASP method described above is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s / cycle, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ per cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 32 cycles.

[0025] Step 3: Reading fluorescence and genotyping After PCR, the fluorescence signal was read using a Bio-Rad C1000 Touch Thermal Cycler real-time quantitative instrument, and genotyping was performed based on the fluorescence signal. The three genotypes at position 29044419 of chromosome 3 in the Sevis apple were clearly and distinctly divided into three clusters, see [link to documentation]. Figures 3-4 .

[0026] like Figure 2 As shown: According to the sequencing results, the relationship between the SNP molecular markers and the timing of apple fruit ripening and genotype is as follows: the CC genotype ripens earlier than the CG and GG genotypes.

[0027] This SNP molecular marker achieved well-defined population genotyping results in 343 Xinjiang Saiweis apple accessions and 36 apple germplasm resources (Qizaohong, Huangtaiping, Balenghaitang, etc.). After corresponding to the phenotypic data of apple maturity, the accuracy of this SNP molecular marker was 72.26% (in Figure 3 The accuracy rate of the Sevis apple is 71.18%. Figure 4 The accuracy rate in germplasm resources was 73.33%. When the base at position 29044419 of the gene coding region on chromosome 3 of the Malus sieversil haploid v1.0 genome was homozygous C, it was identified as an early-maturing apple variety with an apple maturity grade of 1-3.

[0028] The above experiments demonstrate that the KASP primers provided by this invention have high accuracy and broad applicability in identifying the ripening phenotype of early-maturing apple fruits. Furthermore, the SNP molecular markers detected by this KASP method can be used for marker-assisted breeding selection, demonstrating certain application value.

[0029] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

Claims

1. A SNP molecular marker associated with apple fruit ripening period, characterized in that: The SNP molecular marker is located at position 29044419 in the gene coding region of chromosome 3 of the Malus sieversil haploid v1.0 genome, and the alleles of the SNP molecular marker are C and G.

2. A primer pair for detecting the SNP molecular marker of claim 1, characterized in that, The KASP primers are shown in SEQ ID NO.1-3.

3. The application of the SNP molecular marker as described in claim 1 in detecting the ripening period of apple fruit, characterized in that, Early-maturing apple varieties were detected by identifying the SNP molecular markers.

4. A method for determining the ripening period of apple fruits, characterized in that, It includes the following steps: Step (1): Extract genomic DNA from the apple to be tested; Step (2): Using the primer pair described in claim 2, PCR amplification is performed with the DNA of the apple to be tested as a template. After obtaining the PCR amplification product, gel electrophoresis is performed. Step (3): The target band in the gel electrophoresis results is cut and sequenced to obtain the sequencing results; Step (4): Compare the sequencing results with the SNP molecular markers described in claim 1 to determine the ripening period of the apple to be tested; The relationship between the timing of apple fruit ripening and genotype is as follows: the CC genotype ripens earlier than the CG and GG genotypes.

5. An application of the SNP molecular marker as described in claim 1 in apple breeding, characterized in that, Early-maturing apple varieties with genotype C / C were selected for breeding.

Images