A set of marker genes for identifying the development process of cotton seeds and application thereof
Patent Information
- Application Number
- CN202610831978.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-10
- Publication Date
- 2026-09-18
AI Technical Summary
[0005]然而,现有技术中尚缺乏一套能够稳定、准确反映棉花种子发育进程的分子标记基因体系,也缺乏基于该类标记基因建立的检测方法,因而难以满足棉花发育阶段精准鉴定及相关研究的需求
[0064] (1) A set of stable molecular marker genes is provided: The marker genes screened by this invention have a monotonically increasing or monotonically decreasing expression pattern during cotton seed development. The expression change pattern is clear and stable, and can accurately reflect the seed development process.
Smart Images

Figure CN122773019A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cotton cultivation and relates to a set of marker genes for identifying the developmental process of cotton seeds and their applications. Background Technology
[0002] Cotton (Gossypium hirsutum L.) is an important economic crop, and its seed development directly affects the accumulation and quality formation of nutrients such as oil and protein in cottonseed. Ovule development involves the transport of photosynthetic assimilates, fatty acid synthesis, carbon and nitrogen metabolism, and various signal regulation processes. These biological processes coordinate with each other, jointly influencing the accumulation level of nutrients in cottonseed and its final yield. Therefore, elucidating the molecular regulatory mechanisms of cotton seed development is of great significance for molecular breeding research related to cotton and the creation of high-oil, high-quality germplasm.
[0003] Currently, the determination of cotton ovule development stages mainly relies on days post-anthesis (DPA) or ovule morphological characteristics. While these methods are simple to operate, they are easily affected by factors such as environmental conditions, cultivation management methods, and differences in the genetic background of varieties. This makes it difficult to accurately correspond and compare the developmental processes between different materials and different experiments, thus limiting the accuracy of research on cotton seed development mechanisms and the evaluation of related traits.
[0004] In recent years, with the development of RNA sequencing technology, transcriptomic analysis of samples from different developmental stages has enabled the screening of genes exhibiting specific expression patterns during development. Some of these genes show a sustained increase or decrease in expression throughout development, exhibiting monotonic expression characteristics. These genes have the potential to serve as molecular markers for developmental stages, reflecting changes in tissue development and physiological states.
[0005] However, the existing technology lacks a molecular marker gene system that can stably and accurately reflect the development process of cotton seeds, and there is also a lack of detection methods based on such marker genes, which makes it difficult to meet the needs of accurate identification of cotton development stages and related research. Summary of the Invention
[0006] Current technologies for determining the developmental stage of cotton seeds mainly rely on time indicators or morphological observations, lacking objective criteria at the molecular level, and have at least the following shortcomings:
[0007] 1. It is easily affected by environmental conditions, planting methods and variety differences, and has poor stability;
[0008] 2. It is difficult to achieve a uniform and accurate comparison of developmental stages across different materials and experiments;
[0009] 3. It cannot accurately reflect the development process of cotton seeds at the molecular level;
[0010] 4. There is a lack of marker gene systems and their application methods that can be directly used for developmental stage detection and identification.
[0011] The purpose of this invention is to address the aforementioned shortcomings of existing technologies by providing a molecular marker gene for identifying cotton seed developmental stages and its application method. This invention systematically analyzes transcriptome data during cotton seed development, screening for a group of genes that exhibit monotonically increasing or decreasing expression during development. A molecular marker system is constructed using the expression changes of these genes, thereby achieving accurate identification of cotton seed developmental stages. The technical solution provided by this invention can offer a reliable molecular detection method for further research on the accumulation patterns of nutrients such as oil and protein in cotton seeds, and can provide technical support for cotton molecular breeding, the creation of superior germplasm resources, and related developmental biology research.
[0012] To achieve the above objectives, the present invention provides the following technical solution:
[0013] The first aspect of this invention provides eight marker genes, including the following genes: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, and Gohir.D09G144500.v2.1, with nucleotide sequences as shown in SEQ ID NO:1~8;
[0014] A second aspect of the present invention provides a primer pair combination for amplifying the above-mentioned marker gene, comprising:
[0015] Forward sequence: GGCACAAGCTCACAAACAGG and reverse sequence: CTTTTCCGGGGCCTCTTCAT;
[0016] Forward sequence: CGACGAATTTGATCCGACGC and reverse sequence: AGTCTCATCGGAGGGTTCCA;
[0017] Forward sequence: GGGTTGTTATGTGGGCAGGA and reverse sequence: CATGCGATCACCGAAAGCTC;
[0018] Forward sequence: CGCCGAGGTTTATGCCAATG and reverse sequence: TCCGATCGTTTCCACCCAAG;
[0019] Forward sequence: AGGGTAGCATACAAGCACGG and reverse sequence: ACGTTGGGCACTGGAAAAGA;
[0020] Forward sequence: CCAAGGAAGCTCGAGCAAAG and reverse sequence: GGGGATGCGCTGTATGATGA;
[0021] Forward sequence: GCCGAGGATGGGAAAGTGAA and reverse sequence: GGTATGTGCAGCCAGACCTT.
[0022] A third aspect of the present invention provides a kit comprising the above-described primer pair combination.
[0023] A fourth aspect of the present invention provides the application of the above-described specific primer pair combination and the above-described kit, wherein the application is any of the following:
[0024] (1) Application in marking the developmental process of cotton seeds;
[0025] (2) Application in the preparation of products that mark the developmental process of cotton seeds;
[0026] A fifth aspect of the present invention provides a method for marking the developmental process of cotton seeds, comprising the following steps:
[0027] Step 1: Extract total RNA from the cotton ovule sample to be tested. The total RNA extraction process is as follows:
[0028] Total RNA was extracted from seeds at developmental ages 7, 11, 20, 25, 30, 40, and 45 DPA using the FastPure Universal Plant Total RNA Isolation Kit. The RNA extraction steps are as follows:
[0029] (1) Place the cotton ovule sample in liquid nitrogen and grind it into powder using a grinder. Add 600 μL of Buffer PSL and shake vigorously for 30-60 s to fully lyse it. Centrifuge at 12000 rpm for 5 min.
[0030] (2) Take about 500 μL of the supernatant and transfer it to FastPure gDNA-Filter Column III. Centrifuge at 12000 rpm for 30 s, discard FastPure gDNA-Filter Column III, and collect the filtrate.
[0031] (3) Add 0.5 times the volume of anhydrous ethanol to the collection tube and shake to mix.
[0032] (4) Transfer the above mixture to FastPure RNA Column V, centrifuge at 12000 rpm for 30s, and discard the filtrate.
[0033] (5) Add 700 μL of Buffer RWA to FastPure RNA Column V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.
[0034] (6) Add 500 μL of Buffer RWB to FastPure RNA Column V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.
[0035] (7) Repeat step (6).
[0036] (8) Place the FastPure RNA Column V adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min.
[0037] (9) Transfer FastPure RNA Column V to a new 1.5 mL centrifuge tube, add 30-100 μL of RNAase-free ddH2O to the center of the adsorption column membrane, and centrifuge at 12000 rpm for 30 s. Measure and record the sample RNA concentration using a micro-ultraviolet spectrophotometer (Thermo Scientific, Nanodrop 2000). The extracted RNA can be used directly for downstream experiments or stored at -85 to -65℃ for later use.
[0038] Step 2: Reverse transcribe total RNA into cDNA;
[0039] Step 3: Using the cDNA as a template, perform real-time quantitative PCR using the above-mentioned specific primer pair combination to amplify the above 8 marker genes: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1 and Gohir.D09G144500.v2.1, as well as the internal reference gene with the nucleotide sequence shown in SEQ ID NO:25: GhUBQ7;
[0040] Step 4: Calculate the relative expression levels of each marker gene and standardize them using the internal reference gene as a reference;
[0041] Step 5: Determine the developmental stage of cotton ovules based on the relative expression levels of marker genes: The lower the relative expression levels of Gohir.A07G206400.v2.1, Gohir.A09G052900.v2.1, Gohir.D02G214900.v2.1, and Gohir.D09G144500.v2.1 genes, the later the cotton ovule development process, i.e., the sample is in a more mature developmental stage; the higher the relative expression levels of Gohir.A05G235300.v2.1, Gohir.A08G095700.v2.1, Gohir.A11G002600.v2.1, and Gohir.D08G178000.v2.1 genes, the later the cotton ovule development process, i.e., the sample is in a more mature developmental stage.
[0042] Furthermore, in step two, the reverse transcription process is as follows:
[0043] The extracted RNA was used to synthesize cDNA using the Evo M-MLV reverse transcription kit (which includes a gDNA removal reagent for qPCR). The reverse transcription steps are as follows.
[0044] Removal of genomic DNA:
[0045] Prepare the reaction solution according to the table below and carry out the genomic DNA removal reaction;
[0046] Table 1 Genomic DNA Removal Reaction System
[0047]
[0048] Reaction conditions: 42℃ for 2 min.
[0049] Reverse transcription reaction:
[0050] Prepare the reaction solution according to the table below and carry out the reverse transcription reaction.
[0051] Table 2 Reverse transcription reaction system
[0052]
[0053] Reaction conditions: 37℃ for 15 min; 85℃ for 5 sec
[0054] The obtained cDNA was stored in a -20°C freezer.
[0055] Furthermore, in step three, the real-time quantitative PCR detection reaction process is as follows:
[0056] The above reverse transcription product cDNA solution was diluted 6 times and used as a PCR template for fluorescence quantification.
[0057] Table 3 PCR reaction system
[0058]
[0059] Table 4 PCR reaction procedure
[0060]
[0061] Furthermore, in step three, the amplification primer pair for the internal reference gene is:
[0062] Forward sequence: AGAGGTCGAGTCTTCGGACA and reverse sequence: GCTTGATCTTCTTGGGCTTG.
[0063] The beneficial effects of this invention are:
[0064] (1) A set of stable molecular marker genes is provided: The marker genes screened by this invention have a monotonically increasing or monotonically decreasing expression pattern during cotton seed development. The expression change pattern is clear and stable, and can accurately reflect the seed development process.
[0065] (2) Achieve molecular identification of developmental stage: By detecting the expression level of the marker gene, the developmental stage of cotton seeds can be objectively determined at the molecular level, avoiding the subjectivity and uncertainty of traditional methods that rely on the number of days after flowering or morphological observation.
[0066] (3) Improve the accuracy and reproducibility of developmental stage determination: Compared with the prior art, the present invention is not affected by environmental conditions, cultivation management methods and differences in the genetic background of varieties, and can achieve a unified and accurate comparison of developmental stages among different materials and different experiments.
[0067] (4) Provide technical support for cotton molecular breeding: This invention can be used to accurately determine the key periods of accumulation of nutrients such as oil and protein in cottonseed, and provide a reliable molecular detection method for studying the dynamic development process of cottonseed and creating superior germplasm resources.
[0068] (5) Simple operation and easy to promote: The present invention uses real-time fluorescence quantitative PCR for detection, with short experimental cycle and good repeatability, and has good application prospects and industrialization potential. Attached Figure Description
[0069] Figure 1 The trends of gene expression levels (TPM values) of selected marker genes for cotton seed development at 7, 11, 20, 25, 30, 40 and 50 days after cotton flowering were analyzed from transcriptome data.
[0070] Figure 2The relative expression trends of selected marker genes for cotton seed development at 7, 11, 20, 25, 30, 40 and 50 days after cotton flowering were analyzed by qPCR. Detailed Implementation
[0071] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0072] Example 1: Screening of marker genes
[0073] 1. Plant Materials: Upland cotton varieties Handan M163 and Zhong 75 were used as experimental materials. Cotton plants were cultivated and managed under conventional field conditions, with a Day Post Anthesis (DPA) of 0 on the day of flowering. To systematically analyze the molecular regulatory changes during embryo development, samples were taken at seven time points: 7, 11, 20, 25, 30, 40, and 50 DPA after flowering. At each time point, uniformly developed, disease-free bolls were selected, and the bolls were quickly peeled off on ice to separate the ovules. The attached fibrous tissue and seed coat were then carefully removed, and the resulting fresh embryo tissue was immediately rapidly frozen in liquid nitrogen and then transferred to a −80 °C freezer for storage. Three independent biological replicates (each replicate consisting of a mixture of multiple ovules) were set up for each material at each time point to reduce the influence of individual differences.
[0074] 2. Planting: Two varieties were planted in Anyang, Henan Province from May to October 2023;
[0075] 3. Ovule transcriptome analysis: Seven stages (7, 11, 20, 25, 30, 40, 50 DPA) were selected from the development of ovules of two varieties, and sufficient ovule samples were collected for transcriptome (RNA-seq) sequencing.
[0076] 4. Sequencing data analysis: After obtaining the raw sequencing data, it was uploaded to the Linux system. The FastP software (v0.23.4) was used for quality control to remove low-quality sequences and adapter sequences. Then, Hisat2 was used to align it to the reference genome (TM-1 UTX v2.1). The SAM file obtained in the previous step was converted into a BAM file using the SAMtools software. Finally, the gene expression matrix was obtained using featureCounts.
[0077] 5. Monotonic Correlation Analysis: An expression matrix was constructed with genes as rows and samples as columns. The expression matrix was filtered for low expression, retaining genes with at least two samples showing a TPM ≥ 1 to remove low-abundance and unstable expression genes. Expression trend analysis was performed on each gene in different materials. Spearman correlation analysis was conducted between gene expression levels at each developmental stage and developmental time, calculating the correlation coefficient rho value and significance P-value. Spearman rank correlation analysis is suitable for measuring monotonic associations between variables. Continuous difference analysis was performed on the expression levels of each gene at each developmental stage. When the expression difference between adjacent time points was greater than or equal to 0, it was considered monotonically increasing; when the expression difference between adjacent time points was less than or equal to 0, it was considered monotonically decreasing; all other cases were considered non-monotonic expression.
[0078] 8. Multiple test correction: The P-values obtained from Spearman correlation analysis of each gene were corrected for false discovery rate using the Benjamini–Hochberg method to obtain the FDR value, in order to reduce the false positive effect of multiple comparisons.
[0079] 9. Screening of monotonic expression marker genes: Candidate marker genes are screened based on correlation coefficient, FDR, and monotonicity determination results. When a gene satisfies rho > 0, FDR < 0.05, and its expression trend is monotonically increasing, it is defined as a continuously upregulated gene; when a gene satisfies rho < 0, FDR < 0.05, and its expression trend is monotonically decreasing, it is defined as a continuously downregulated gene.
[0080] 10. Marker gene identification: Genes with consistent expression directions are screened in two or more different cotton materials. Genes that show sustained upregulation or sustained downregulation in all different materials are selected as candidate molecular marker genes that can stably reflect the developmental process of cotton grains. Figure 1 ).
[0081] Eight marker genes were finally screened, including the following genes: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, and Gohir.D09G144500.v2.1, with nucleotide sequences as shown in SEQ ID NO:1~8.
[0082] Example 2: Determination of the developmental process of cotton seeds
[0083] Plant materials: Upland cotton varieties Handan M163 and Zhong 75 were used as experimental materials.
[0084] Step 1: Extract total RNA from cotton ovule samples of the two plant materials mentioned above. The extraction process for total RNA is as follows:
[0085] Total RNA was extracted from seeds at developmental ages 7, 11, 20, 25, 30, 40, and 45 DPA using the FastPure Universal Plant Total RNA Isolation Kit. The RNA extraction steps are as follows:
[0086] (1) Place the cotton ovule sample in liquid nitrogen and grind it into powder using a grinder. Add 600 μL of Buffer PSL and shake vigorously for 30-60 s to fully lyse it. Centrifuge at 12000 rpm for 5 min.
[0087] (2) Take about 500 μL of the supernatant and transfer it to FastPure gDNA-Filter Column III. Centrifuge at 12000 rpm for 30 s, discard FastPure gDNA-Filter Column III, and collect the filtrate.
[0088] (3) Add 0.5 times the volume of anhydrous ethanol to the collection tube and shake to mix.
[0089] (4) Transfer the above mixture to FastPure RNA Column V, centrifuge at 12000 rpm for 30s, and discard the filtrate.
[0090] (5) Add 700 μL of Buffer RWA to FastPure RNA Column V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.
[0091] (6) Add 500 μL of Buffer RWB to FastPure RNA Column V, centrifuge at 12000 rpm for 30 s, and discard the filtrate.
[0092] (7) Repeat step (6).
[0093] (8) Place the FastPure RNA Column V adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min.
[0094] (9) Transfer FastPure RNA Column V to a new 1.5 mL centrifuge tube, add 30-100 μL of RNAase-free ddH2O to the center of the adsorption column membrane, and centrifuge at 12000 rpm for 30 s. Measure and record the RNA concentration of the sample using a micro-ultraviolet spectrophotometer (Thermo Scientific, Nanodrop 2000). The extracted RNA can be used directly for downstream experiments or stored at -85 to -65℃ for later use.
[0095] Step 2: Reverse transcribe total RNA into cDNA; the reverse transcription process is as follows:
[0096] The extracted RNA was used to synthesize cDNA using the Evo M-MLV reverse transcription kit (which includes a gDNA removal reagent for qPCR). The reverse transcription steps are as follows.
[0097] Removal of genomic DNA:
[0098] Prepare the reaction solution according to the table below and carry out the genomic DNA removal reaction;
[0099] Table 1 Genomic DNA Removal Reaction System
[0100]
[0101] Reaction conditions: 42℃ for 2 min.
[0102] Reverse transcription reaction:
[0103] Prepare the reaction solution according to the table below and carry out the reverse transcription reaction.
[0104] Table 2 Reverse transcription reaction system
[0105]
[0106] Reaction conditions: 37℃ for 15 min; 85℃ for 5 sec
[0107] The obtained cDNA was stored in a -20°C freezer.
[0108] Step 3: Using the cDNA as a template, perform real-time quantitative PCR detection using the specific primer pair combination (Table 5) to amplify the following 8 marker genes with nucleotide sequences as shown in SEQ ID NO:1~8: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, and Gohir.D09G144500.v2.1, as well as the internal reference gene with nucleotide sequence as shown in SEQ ID NO:25: GhUBQ7; the real-time quantitative PCR detection reaction process is as follows:
[0109] The above reverse transcription product cDNA solution was diluted 6 times and used as a PCR template for fluorescence quantification.
[0110] Table 3 PCR reaction system
[0111]
[0112] Table 4 PCR reaction procedure
[0113]
[0114] Table 5 Primer pair combinations used in this embodiment
[0115]
[0116] Step 4: Calculate the relative expression levels of each marker gene and standardize them using the internal reference gene as a reference;
[0117] Step 5: Determine the developmental progress of cotton ovules based on the relative expression levels of marker genes: Results are as follows Figure 2As shown, in the seed development process of cotton varieties Handan M163 and Zhong 75, the relative expression levels of the genes Gohir.A07G206400.v2.1, Gohir.A09G052900.v2.1, Gohir.D02G214900.v2.1, and Gohir.D09G144500.v2.1 gradually decreased with the advancement of seed development, while the relative expression levels of the genes Gohir.A05G235300.v2.1, Gohir.A08G095700.v2.1, Gohir.A11G002600.v2.1, and Gohir.D08G178000.v2.1 gradually increased. Therefore, the developmental stage of cotton ovules can be determined by detecting the relative expression levels of these eight genes.
[0118] Since the genes Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, and Gohir.D09G144500.v2.1 exhibit a monotonically increasing or decreasing trend in the developmental process of cotton seeds, if the sampling order of seed samples from different developmental stages of the same cotton variety cannot be determined, the gene Gohir.A can be detected. The expression levels of at least one gene from Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, or Gohir.D09G144500.v2.1, as well as the expression level of the internal reference GhUBQ7, were calculated. The relative expression levels of the genes were then calculated. By comparing the relative expression levels of each marker gene in different samples, the sampling order of each sample was finally determined.
Claims
1. The application of specific primer pair combinations for amplifying marker genes, characterized in that, The application is any one of the following: (1) Application in marking the developmental process of cotton seeds; (2) Application in the preparation of products that mark the developmental process of cotton seeds; The marker genes include the following genes: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1 and Gohir.D09G144500.v2.1, with nucleotide sequences as shown in SEQ ID NO:1~8; The primer pair combinations include: Forward sequence: GGCACAAGCTCACAAACAGG and reverse sequence: CTTTTCCGGGGCCTCTTCAT; Forward sequence: CGACGAATTTGATCCGACGC and reverse sequence: AGTCTCATCGGAGGGTTCCA; Forward sequence: GGGTTGTTATGTGGGCAGGA and reverse sequence: CATGCGATCACCGAAAGCTC; Forward sequence: CGCCGAGGTTTATGCCAATG and reverse sequence: TCCGATCGTTTCCACCCAAG; Forward sequence: AGGGTAGCATACAAGCACGG and reverse sequence: ACGTTGGGCACTGGAAAAGA; Forward sequence: CCAAGGAAGCTCGAGCAAAG and reverse sequence: GGGGATGCGCTGTATGATGA; Forward sequence: GCCGAGGATGGGAAAGTGAA and reverse sequence: GGTATGTGCAGCCAGACCTT; The primer pairs were used to quantitatively detect the expression levels of the marker genes Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1, and Gohir.D09G144500.v2.1; the GhUBQ7 gene was used as an internal control, and the nucleotide sequence of the GhUBQ7 gene is shown in SEQ ID NO:
25. The lower the relative expression levels of the Gohir.A07G206400.v2.1, Gohir.A09G052900.v2.1, Gohir.D02G214900.v2.1, and Gohir.D09G144500.v2.1 genes, the later the cotton ovule development process, meaning the sample is in a more mature developmental stage. Conversely, the higher the relative expression levels of the Gohir.A05G235300.v2.1, Gohir.A08G095700.v2.1, Gohir.A11G002600.v2.1, and Gohir.D08G178000.v2.1 genes, the later the cotton ovule development process, meaning the sample is in a more mature developmental stage.
2. The use of a kit containing the specific primer pair combination as described in claim 1 in identifying the developmental process of cotton seeds.
3. A method for marking the developmental process of cotton seeds, characterized in that, Includes the following steps: Step 1: Extract total RNA from the cotton ovule sample to be tested; Step 2: Reverse transcribe total RNA into cDNA; Step 3: Using the cDNA as a template, perform real-time quantitative PCR detection using the specific primer pair combination described in claim 1 to amplify the following 8 marker genes with nucleotide sequences as shown in SEQ ID NO: 1~8: Gohir.A05G235300.v2.1, Gohir.A07G206400.v2.1, Gohir.A08G095700.v2.1, Gohir.A09G052900.v2.1, Gohir.A11G002600.v2.1, Gohir.D02G214900.v2.1, Gohir.D08G178000.v2.1 and Gohir.D09G144500.v2.1, and the internal reference gene with nucleotide sequence as shown in SEQ ID NO: 25: GhUBQ7; Step 4: Calculate the relative expression levels of each marker gene and standardize them using the internal reference gene as a reference; Step 5: Determine the developmental stage of cotton ovules based on the relative expression levels of marker genes: The lower the relative expression levels of Gohir.A07G206400.v2.1, Gohir.A09G052900.v2.1, Gohir.D02G214900.v2.1, and Gohir.D09G144500.v2.1 genes, the later the cotton ovule development process, i.e., the sample is in a more mature developmental stage; the higher the relative expression levels of Gohir.A05G235300.v2.1, Gohir.A08G095700.v2.1, Gohir.A11G002600.v2.1, and Gohir.D08G178000.v2.1 genes, the later the cotton ovule development process, i.e., the sample is in a more mature developmental stage.
4. The method according to claim 3, characterized in that, In step three, the amplification primer pair for the internal reference gene is as follows: Forward sequence: AGAGGTCGAGTCTTCGGACA and reverse sequence: GCTTGATCTTCTTGGGCTTG.