Specific primers and probes for detecting the dominant pathogen of wheat sharp eyespot and dPCR detection method
Patent Information
- Application Number
- CN202611013168.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-08
- Publication Date
- 2026-09-18
AI Technical Summary
通过qPCR技术进行实际样本的绝对定量时存在以下问题:(1)尤其是提取复杂的土壤样品DNA时,可能在样品中引入杂质,可能包含PCR反应的抑制物,造成实际扩增效率偏低
[0001] This invention relates to detection primers and methods for detecting wheat root rot, and more particularly to specific primers and probes for detecting the dominant pathogen of wheat root rot and dPCR detection methods, belonging to the field of dPCR detection of the dominant pathogen of wheat root rot.
Smart Images

Figure CN122773022A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to detection primers and methods for detecting wheat root rot, and more particularly to specific primers and probes for detecting the dominant pathogen of wheat root rot and dPCR detection methods, belonging to the field of dPCR detection of the dominant pathogen of wheat root rot. Background Technology
[0002] wheat( Triticum aestivum L. Wheat is the world's third largest food crop after rice and corn. Throughout its growth cycle, various fungal diseases continuously threaten wheat yield and quality. One such disease is *Helicobacter pylori* (wheat root rot molluscum). Bipolaris sorokiniana , B. sorokiniana Root rot caused by ) and by *Microsorum nivale* ( Microdochium nivale , M. nivale Snow rot, caused by two diseases, is a highly destructive disease that can cause severe losses in major wheat-producing areas. Wheat root rot can occur throughout the entire growth period, primarily infecting the roots of seedlings. Typical symptoms include browning and rotting of the roots, brown spots on leaves and stems accompanied by a grayish-black mold layer; in severe cases, plants become stunted and yellow, with leaf blight, glumes, ear blight, and black embryos in the grains. It generally leads to a 10% reduction in wheat yield, with severe cases resulting in yield losses of up to 40%. This disease is one of the globally distributed soil-borne fungal diseases. Wheat snow rot can cause damage in both the seedling and mature stages, primarily infecting the base of the stem. Its symptoms are diverse, including bud rot, seedling blight, leaf sheath rot, and leaf death. This disease is widely distributed in my country, particularly in the Xinjiang Uygur Autonomous Region, with the most severe cases in Tacheng Prefecture, Changji Hui Autonomous Prefecture, and Ili Kazakh Autonomous Prefecture. Surveys indicate that severely affected fields can result in wheat yield losses of 20%–30%.
[0003] Root rot caused by *Hymenobacterium tumefaciens* and snow rot caused by *Microsporum nigrum* exhibit highly overlapping above-ground symptoms during the seedling stage and early infection phase: both present with stunted growth, yellowing leaves, and slow growth, and lack specific lesions. Although root symptoms differ somewhat (root rot lesions are dark brown and relatively dry; snow rot lesions are water-soaked and accompanied by pink mycelium), in actual field operations, especially when the two diseases occur together, early and accurate differentiation by visual inspection alone is difficult. Furthermore, traditional pathogen isolation and culture requires 3-7 days and is susceptible to contamination by other microorganisms, failing to meet the needs for latent period detection and early warning.
[0004] With the development of molecular biology techniques, pathogen identification has shifted from traditional morphology to high-precision molecular detection. Early PCR technology identified pathogens by amplifying specific gene fragments and combining them with sequencing, but its sensitivity was insufficient for low-concentration samples.
[0005] Real-time quantitative PCR (qPCR) is currently the most commonly used technique for detecting pathogens. This technique involves adding fluorescent dyes or probes to the PCR reaction system, monitoring the entire amplification process in real time through changes in fluorescence signals, and finally determining the relative content of the target nucleic acid fragment in the sample based on the Ct (Cycle Threshold) value of the sample. If absolute quantification is to be performed, a standard curve needs to be prepared using standards of known absolute concentrations to obtain the actual unknown nucleic acid content of the sample. The following problems exist when performing absolute quantification of actual samples using qPCR technology: (1) Especially when extracting DNA from complex soil samples, impurities may be introduced into the sample, which may contain PCR inhibitors, resulting in a lower actual amplification efficiency. Therefore, the standard curve prepared using standards as templates to quantify the sample concentration is often lower than the actual value; (2) When the content of the target nucleic acid fragment in the sample is very low, the PCR inhibitors it contains can easily cause "false negatives" in the qPCR reaction. The above reasons make it difficult to achieve accurate quantification of nucleic acid samples based on qPCR technology.
[0006] Metagenomic sequencing (MRS) comprehensively analyzes microbial communities by directly sequencing DNA in environmental samples (such as plant tissues and soil) using high-throughput sequencing. In the identification of plant pathogenic fungi, this method can detect difficult-to-culture or unknown fungal species without culturing and can analyze the functional genes of fungi (such as virulence factors and secondary metabolite synthesis genes). By comparing with fungal reference databases, pathogenic fungal species and their relative abundance can be quickly identified, providing a scientific basis for disease diagnosis and control. The following problems exist in the identification of pathogens using this method: (1) This method cannot absolutely quantify pathogens, cannot accurately determine the degree of disease occurrence, and is difficult to achieve early prevention. (2) This method relies on high-performance computing resources and professional bioinformatics skills, and the identification of sequencing results requires professional analysts. (3) The sequencing and data analysis costs are high, which limits its application in small-scale studies. (4) The detection time is long and the data volume is large, which is not suitable for the detection of pathogens in a large number of actual samples.
[0007] Digital PCR (dPCR), also known as third-generation PCR technology, is an emerging molecular detection technique for nucleic acid quantification and is gradually becoming a cutting-edge tool for pathogen identification. dPCR distributes nucleic acid samples into a large number of independent, parallel nano-scale microreaction units, ensuring that each unit contains only one template molecule. After amplification, absolute quantification is achieved through statistical distribution analysis, eliminating the need for a standard curve and avoiding PCR inhibitors and intermolecular interference. It is particularly suitable for detecting target molecules in complex samples such as soil, exhibiting extremely high sensitivity and accuracy.
[0008] In recent years, dPCR has been successfully applied to the detection of diseases such as wheat smut, rice bacterial panicle blight, and potato M virus, but it has not yet been found to target the dominant pathogen of wheat root rot. B. sorokiniana A dPCR quantitative detection method for accurate quantitative detection. Summary of the Invention
[0009] One objective of this invention is to provide specific primers and probes for detecting the dominant pathogen of wheat root rot; The second objective of this invention is to provide a dPCR quantitative detection kit for detecting the dominant pathogen of wheat root rot; A third objective of this invention is to apply the specific primers and probes or the dPCR quantitative detection kit to the quantitative detection of dominant pathogens of wheat root rot.
[0010] The above-mentioned objectives of the present invention are mainly achieved through the following technical solutions: One aspect of this invention is to provide a method for detecting the dominant pathogen of wheat root rot, *Helicobacter pylori* (wheat root rot spores). B.sorokiniana The specific primers and probes are provided, wherein the specific primers consist of a forward primer with the nucleotide sequence shown in SEQ ID No. 1 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No. 3; wherein a fluorescent reporter group is labeled at the 5' end of the probe and a fluorescent quencher group is labeled at the 3' end of the probe; the fluorescent reporter group is preferably CY5.5 and the fluorescent quencher group is preferably BHQ2.
[0011] This invention is based on pathogens B.sorokiniana endogenous transcriptional spacer region ( ITS Nucleic acid fragments, glyceraldehyde-3-phosphate dehydrogenase gene ( gpd Five sets of primers and probes were designed to amplify the pathogenic bacteria targeting the gene. B.sorokiniana The specificity verification results of the five primer and probe sets showed that only those based on the target gene were effective. gpd The designed nucleotide sequences of the forward primer shown in SEQ ID No. 1 and the reverse primer shown in SEQ ID No. 2, along with the probe shown in SEQ ID No. 3, can specifically amplify the target pathogen. B.sorokiniana Therefore, this invention selects a target gene gpd The designed specific primer and probe set was used for B.sorokiniana dPCR-specific quantitative detection.
[0012] Another aspect of the present invention provides a dPCR detection kit for detecting the dominant pathogen of wheat root rot. The dPCR detection kit includes: forward and reverse primers for detecting the pathogen *Hymenochrysis maltii*, and a probe for detecting *Hymenochrysis maltii*. The nucleotide sequence of the forward primer for detecting *Hymenochrysis maltii* is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer for detecting *Hymenochrysis maltii* is shown in SEQ ID No. 2. The nucleotide sequence of the probe is shown in SEQ ID No. 3, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe. The fluorescent reporter group is preferably CY5.5, and the fluorescent quencher group is preferably BHQ2.
[0013] Based on the amplification results, the presence of the dominant pathogen of wheat root rot, *Hymenops malathus*, in the test sample was detected and quantitatively analyzed.
[0014] In a preferred embodiment of the present invention, the dPCR amplification reaction system is preferably as follows: 6 μL of reagent A, 1.5 μL of reagent B, 1.8 μL each of the forward and reverse primers for detecting the pathogen *Hymenochrysis maltii*, 0.75 μL of the probe for detecting *Hymenochrysis maltii*, 1 μL of DNA from the sample to be tested, and the remainder being sterile water, with a total reaction volume of 30 μL.
[0015] In a preferred embodiment of the present invention, the concentration of the primer for detecting the pathogenic fungus *Hymenobacter oryzae* is preferably 600 nmol / L, and the concentration of the probe is preferably 250 nmol / L.
[0016] In a preferred embodiment of the present invention, the dPCR amplification conditions are preferably as follows: Pre-denaturation: 95℃, 10 min; Annealing extension: 94℃, 30 s; 58℃, 1 min; 45 cycles.
[0017] Another aspect of the present invention provides a triple dPCR detection kit for simultaneously detecting the dominant pathogens of wheat root rot, *Hymenobacter oryzae*, and wheat snow rot, *Micrococcus nivali*, comprising: forward primers, reverse primers, and a probe for detecting *Hymenobacter oryzae*; forward primers, reverse primers, and a probe for detecting *Micrococcus nivali*; and a wheat internal reference gene. TaHd1 ( Triticum aestivum Heading date 1) includes forward primers, reverse primers, and probes; The nucleotide sequence of the forward primer for detecting the pathogen *Hymenochrysis maltans* is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer for detecting *Hymenochrysis maltans* is shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No. 3, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe; the fluorescent reporter group is preferably CY5.5, and the fluorescent quencher group is preferably BHQ2. The nucleotide sequence of the forward primer for detecting the pathogenic fungus *Micrococcus nivalis* is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer for detecting the pathogenic fungus *Micrococcus nivalis* is shown in SEQ ID No. 17; the nucleotide sequence of the probe is shown in SEQ ID No. 18, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe; the fluorescent reporter group is preferably ROX, and the fluorescent quencher group is preferably BHQ2. The aforementioned detection internal reference gene TaHd1 The nucleotide sequence of the forward primer is shown as TGCTAACCGTGTGGCATCAC (SEQ ID No. 31), and the detection internal reference gene is described. TaHd1 The nucleotide sequence of the reverse primer is shown as GGTACATAGTGCTGCTGCATCTG (SEQ ID No. 32); the nucleotide sequence of the probe is shown as CATGAGCGTGTGCGTG (SEQ ID No. 33), wherein a fluorescent reporter group is labeled at the 5' end of the probe and a fluorescent quencher group is labeled at the 3' end of the probe; the fluorescent reporter group is preferably labeled with VIC, and the fluorescent quencher group is preferably labeled with MGB.
[0018] By wheat root rot umbellifer ( B. sorokiniana Root rot caused by ) and by *Microsorum nivale* ( M. nivale Both wheat diseases, including snow rot and snow mold, can infect the roots, occur throughout the entire growth period, and are difficult to distinguish visually in the early stages. Current detection technologies lack high-throughput methods for simultaneous absolute quantification of both pathogens and correction for sample differences. This invention designs and screens methods specifically targeting snow rot caused by both pathogens. B. sorokiniana , M. nivale Specific primers and probes were used to detect the flowering time control gene in common wheat. Triticum aestivum Heading date 1, TaHd1A triple dPCR quantitative method was established by introducing the pathogen's target gene DNA copy number as an internal reference gene into the digital PCR system. This method included the dominant pathogens of wheat root rot and snow rot, as well as the wheat internal reference gene. By normalizing the pathogen copy number relative to the host internal reference gene, the severity of root rot and snow rot diseases among different samples was successfully assessed. The quantitative results of triple dPCR showed good consistency with those of single dPCR, with small deviations, indicating high quantitative accuracy of the system. TaHd1 The ratio of the "DNA copy number" to the "DNA copy number" effectively eliminates differences between samples, making the pathogen load comparable across different time periods and samples. This triple dPCR quantitative method achieved a coefficient of determination of 0.9999 for both the expected and measured values of the target sample, thus it can be used as a reliable method. B.sorokiniana and M.nivale This method is an effective means for accurate nucleic acid quantification. By simultaneously detecting multiple pathogens and the host internal control, and applying the normalized quantitative analysis of triple dPCR (pathogen target gene copy number / wheat internal control copy number × 1000), the severity of disease in different infected samples can be compared horizontally. This provides a scientific basis for revealing the infection characteristics of different pathogens at different growth stages of wheat and for formulating targeted prevention and control strategies. Attached Figure Description
[0019] Figure 1 for B.sorokiniana 1D diagram of primer / probe specificity verification; A is gpd -F1 / R1 / P1 primer and probe set amplification 1D diagram; B in the diagram is gpd -F2 / R2 / P2 primer and probe set amplification 1D diagram; C in the diagram is gpd -F3 / R3 / P3 primer and probe set amplification 1D diagram; D in the diagram represents ITS -F4 / R4 / P4 primer and probe set amplification 1D diagram; E in the diagram is ITS -F5 / R5 / P5 primer and probe set amplification 1D diagram.
[0020] Figure 2 for M.nivale 1D diagram of primer / probe specificity verification; A is RPB2 -F1 / R1 / P1 primer and probe set amplification 1D diagram; B in the diagram is RPB2 -F2 / R2 / P2 primer and probe set amplification 1D diagram; C in the diagram is RPB2 -F3 / R3 / P3 primer and probe set amplification 1D diagram; D in the diagram represents TEF1 -F4 / R4 / P4 primer and probe set amplification 1D diagram; E in the diagram is TEF1 -F5 / R5 / P5 primer and probe set amplification 1D diagram.
[0021] Figure 3The results are from linear regression analysis of each target gene in triple dPCR.
[0022] Figure 4 The results are the LoD 95% analysis results for each target gene in triple dPCR.
[0023] Figure 5 The results are based on the analysis of the development patterns of pathogenic bacteria. Detailed Implementation
[0024] The present invention will be further described below with reference to specific experimental examples, and the advantages and features of the present invention will become clearer with the description. However, these experimental examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0025] Experiment Example 1: Design, screening, and specificity verification of specific primer and probe sequences for detecting the dominant pathogen of wheat root rot. 1. Design specific primer and probe sequences Select pathogens B.sorokiniana The internally transcribed spacer ITS Nucleic acid fragments, glyceraldehyde-3-phosphate dehydrogenase gene (Glyceraldehyde-3-phosphate dehydrogenase, gpd Primers and probes were designed for the target, and the 5' and 3' ends of the probe were labeled with the fluorescent reporter group CY5.5 and the fluorescent quencher group BHQ2, respectively; M.nivale Translation elongation factor-1 alpha gene TEF1 RNA polymerase II subunit (DNA-directed RNA polymerase II subunit) RPB2 Primers and probes were designed for target analysis. The 5' and 3' ends of the probes were labeled with the fluorescent reporter group ROX and the fluorescent quencher group BHQ2, respectively. The nucleotide sequences of the designed primers and probes are shown in Table 1. Table 1 Primer and probe sequence information
[0026] [+N] indicates LNA modification.
[0027] 2. Specificity verification choose Bipolaris It belongs to five other pathogenic bacteria, including *Helicobacter pylori*. B. oryzae Corn umbellifer B. maydis Sorghum stalk umbelliferous fungus B. sorghicola Corn umbelliferous spores B. zeicola Corn horn spores B. zeae (Purchased from the China Agricultural Microbial Culture Collection Center); and four other genera of fungi, including *Fusarium pseudogranatum*. Fusarium pseudograminearum Fusarium oxysporum Fusarium oxysporum, Nivulva macrocarpa Microdochium majus and Chaetomium globosum Chaetomium globosum (Derived from the inventor's laboratory collection), DNA was extracted and used as templates, and the specificity of the above 10 primer-probe combinations was verified by dPCR system.
[0028] Based on pathogens B.sorokiniana endogenous transcriptional spacer region ( ITS Nucleic acid fragments, glyceraldehyde-3-phosphate dehydrogenase gene ( gpd Five sets of primers and probes were designed to amplify the pathogenic bacteria, targeting the gene. B.sorokiniana The specificity verification results of the 5 sets of primers and probes are as follows: Figure 1 Display: A is based on target gene gpd The designed F1 / R1 / P1 primer and probe set amplifies the pathogen. B.sorokiniana The 1D effect specifically amplifies only the target pathogen. B.sorokiniana B and C are based on pathogens. B.sorokiniana gpd The designed F2 / R2 / P2 and F3 / R3 / P3 primer probes amplify the pathogens. B.sorokiniana The 1D effect is comparable to other species in the same genus. B. sorghicola, B. zeae Non-specific amplification occurred; D and E are based on the pathogen. B.sorokiniana of ITS The designed F4 / R4 / P4 and F5 / R5 / P5 primers and probes amplify the pathogens. B.sorokiniana The 1D effect, as seen in the amplification results, is similar to that of other species in the same genus. B. sorghicola, B. zeae, B. zeicola, B. oryzae Non-specific amplification occurred; according to the specificity verification results, only one of the five primer and probe sets was effective based on the target gene. gpd The designed F1 / R1 / P1 primer and probe set (SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3) can specifically amplify the target pathogen. B.sorokiniana Therefore, subsequent selection is based on target genes. gpd The designed primer / probe set F1 / R1 / P1 was used for B.sorokiniana dPCR-specific quantitative detection.
[0029] According to respectivelyM.nivale Translation elongation factor 1α gene ( TEF1 RNA polymerase II second large subunit ( RPB2 Five sets of primers and probes were designed to amplify the pathogenic bacteria, targeting the gene. M.nivale The amplification results of the 5 sets of primers and probes are as follows: Figure 2 Display: A is based on pathogens M.nivale RPB2 The designed F1 / R1 / P1 primer and probe set amplifies the pathogen. M.nivale The 1D effect only amplifies the target pathogen. M.nivale B and C are based on pathogens. M.nivaleRPB2 The designed F2 / R2 / P2 and F3 / R3 / P3 primer / probe sets amplified the pathogen. M.nivale The 1D effect is comparable to other species in the same genus. M. majus Non-specific amplification occurred; D and E are based on the pathogen. M.nivale TEF1 The designed F4 / R4 / P4 and F5 / R5 / P5 primer / probe sets amplified the pathogen. M.nivale The 1D effect, the amplification result is in other species of the same genus M. majus Non-specific amplification occurred. Based on the specificity verification results, only one of the five primer / probe sets was effective against the pathogen. M.nivale RPB2 The designed F1 / R1 / P1 primer and probe set (SEQ ID No. 16, SEQ ID No. 17, and SEQ ID No. 18) can specifically amplify the target pathogen. M.nivale Therefore, subsequent selection is based on the target pathogen. M.nivale target genes RPB2 The designed primer / probe set F1 / R1 / P1 was used for M.nivale dPCR-specific quantitative detection.
[0030] Experimental Example 2: Establishment of a dPCR detection method for the dominant pathogen of wheat root rot Fungal DNA extraction: DNA was extracted from cultured fungi using a fungal genomic DNA extraction kit (Beijing Solarbio Science & Technology Co., Ltd.) in accordance with the kit and instrument instructions.
[0031] DNA extraction from wheat roots: The classic CTAB DNA extraction method was used.
[0032] The kit described is Probe dPCR HiTaqMix from Xinyi Manufacturing Technology (Beijing) Co., Ltd. The reaction system for detection is as follows: 6 μL of reagent A, 1.5 μL of reagent B, 1.8 μL each of the upstream and downstream primers (SEQ ID No. 1 and SEQ ID No. 2) for detecting the pathogen *Hymenochrysis maltii*, 0.75 μL of the probe (SEQ ID No. 3) for detecting the pathogen *Hymenochrysis maltii*, 1 μL of DNA from the sample to be tested, and the remainder is sterile water, with a total reaction volume of 30 μL.
[0033] The preferred concentration of primers for detecting the pathogen *Hymenobacterium tumefaciens* is 600 nmol / L, and the preferred concentration of probes is 250 nmol / L.
[0034] The amplification conditions for the dPCR reaction are shown in Table 2 below: Table 2 Triple dPCR amplification conditions
[0035] Experiment Example 3: Comparison of Single dPCR and Triple dPCR Statistical Analysis To evaluate the impact of multiplex detection on quantitative accuracy, single-dPCR and triple-dPCR detection were performed at the same DNA template concentration using the Probe dPCR HiTaqMix kit from NewYi Manufacturing Technology (Beijing) Co., Ltd.
[0036] The singlet dPCR reaction system contains: 6 μL of reagent A, 1.5 μL of reagent B, 1.8 μL each of the upstream and downstream primers for detecting the pathogen *Hymenochrysis maltii*, 0.75 μL of the probe for detecting *Hymenochrysis maltii*, 1 μL of *Hymenochrysis maltii* DNA, and the remainder is sterile water, with a total reaction volume of 30 μL.
[0037] The triple dPCR reaction system includes: 6 μL of reagent A, 1.5 μL of reagent B, and a wheat internal reference gene for detection. TaHd11.8 μL each of the upstream and downstream primers (SEQ ID No. 31 and SEQ ID No. 32) for detecting the pathogen *Hymenobacterium tumefaciens*, 1.8 μL each of the upstream and downstream primers (SEQ ID No. 1 and SEQ ID No. 2) for detecting the pathogen *Micrococcus nivalis*, 1.8 μL each of the upstream and downstream primers (SEQ ID No. 16 and SEQ ID No. 17) for detecting the pathogen *Micrococcus nivalis*, 0.75 μL of the probe (SEQ ID No. 33) for detecting the wheat internal reference gene (labeled with a fluorescent reporter group VIC at the 5' end and a fluorescent quencher group MGB at the 3' end); 0.75 μL of the probe (SEQ ID No. 3) for detecting the pathogen *Hymenobacterium tumefaciens*, labeled with a fluorescent reporter group CY5.5 and a fluorescent quencher group BHQ2 at the 5' and 3' ends respectively; and 0.75 μL of the probe (SEQ ID No. 18) for detecting the pathogen *Micrococcus nivalis*. μL of the sample was labeled with the fluorescent reporter group ROX and the fluorescent quencher group BHQ2, respectively, at the 5' and 3' ends of the probe; 1 μL each of wheat root rot umbellifer DNA, noctuid microsporidium DNA, and wheat DNA were added, with the remainder being sterile water, for a total reaction volume of 30 μL.
[0038] Compared with singlet dPCR, the maximum absolute deviation of triplet dPCR quantification is -2.17%.
[0039] Table 3 Comparison of quantitative detection between singlet dPCR and triplet dPCR
[0040] a Relative Standard Deviation (RSD).
[0041] The test results are shown in Table 3. The results show that the quantitative results of triple dPCR are in good agreement with those of single dPCR, with small deviation, indicating that its quantitative accuracy is high.
[0042] Experimental Example 4: Construction of a Digital PCR Quantitative Standard Curve This experiment used expected values and measured values to plot a standard curve to evaluate the accuracy of nucleic acid quantification of each target gene in triple dPCR.
[0043] The triple dPCR detection system established in this invention is effective against... gpd , RPB2 and TaHd1 All three targets exhibited excellent quantitative performance and showed a high degree of linear correlation. Figure 3 The coefficients of determination of the fitting equations for the three target genes.R² The values were all 0.9999, indicating that the triple system can maintain high accuracy and stability in achieving simultaneous detection of multiple targets, and can meet the requirements for simultaneous absolute quantification of pathogens and host reference genes in complex samples.
[0044] Experimental Example 5: Limit of Detection and Limit of Quantification of Target Genes in Digital PCR Detection System This experiment used Probit regression analysis to evaluate the lowest detection limit (LoD 95%) of each target gene in the triplet dPCR system. The evaluation results showed that: B. sorokiniana of gpd The gene LoD 95% was 6.1 copies / μL (95% CI: 4.1–36.0 copies / μL). M. nivale of RPB The 95% LoD of the two genes was 8.3 copies / μL (95% CI: 5.4-41.3 copies / μL). T. aestivum of TaHd1 The 95% LoD was 10.6 copies / μL (95% CI: 7.5–26.0 copies / μL). Figure 4 The LoD95% of all three target genes was less than 11 copies / μL, indicating that this triplet dPCR detection system has high detection sensitivity and can detect low concentrations of pathogens. B. sorokiniana or M. nivale The effective detection of this technology provides a reliable technical guarantee for the early diagnosis of soil-borne diseases in wheat and the detection of low-load samples.
[0045] The limits of quantitation (LoQ) of each target gene in this triplet dPCR system were determined by evaluating a series of low-concentration samples (3–39 copies / μL) prepared by gravimetric dilution. The evaluation results showed that the LoQs of quantitation for the three target genes were highly similar. TaHd1 It was 19.3 copies / μL. RPB 2 is 18.0 copies / μL. gpd The result was 19.2 copies / μL. These results indicate that the LoQ of each target gene in the established triple dPCR detection system is basically consistent, providing a reliable methodological basis for the simultaneous and accurate quantification of multiple pathogens and host internal controls (Table 4).
[0046] Table 4. LoQ analysis of three target genes
[0047] Note: a The mean of repeated measurements (n = 3) in three independent runs;b Relative Standard Deviation (RSD) is the relative standard deviation.
[0048] Experiment 6: Detection of field samples using dPCR method for the dominant pathogen of wheat root rot. This experiment was based on normalized quantitative analysis of triple dPCR (pathogen target gene copy number / wheat internal reference). TaHd1 (Copy count × 1000), the system analyzed the dynamic changes in the relative abundance of two soil-borne pathogens in the roots of wheat during three growth stages: seedling stage, greening and jointing stage, and grain filling and ripening stage.
[0049] Test results ( Figure 5 The results showed that the relative abundance of *Hymenolepis buergerianus*, the pathogen causing wheat root rot, was consistently high and stable: it maintained a high abundance in all three growth stages, with an average of about 85 in the seedling stage, about 1250 in the greening and jointing stage, and about 1600 in the grain-filling and maturity stage, maintaining a high colonization level throughout the entire growth process. It is an important soil-borne pathogen that can infect wheat throughout its entire growth period. The relative abundance of *Microsporum simulans*, the pathogen causing wheat root rot, showed a dynamic characteristic of being high at first and then low: the relative abundance value in the seedling stage was about 110, the abundance in the greening and jointing stage dropped sharply to below about 350, and the abundance in the grain-filling and maturity stage was close to 0. This indicates that the pathogen mainly infects and damages wheat in the seedling stage, and as the plant grows and its disease resistance increases, the relative abundance of the pathogen decreases significantly.
Claims
1. Detection of the dominant pathogen of wheat root rot, *Helicobacter pylori* (wheat root rot causal agent). Bipolarissorokiniana ) specific primers and probes, characterized in that, The specific primer consists of a forward primer with the nucleotide sequence shown in SEQ ID No. 1 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No. 3, wherein a fluorescent reporter group is labeled at the 5' end of the probe and a fluorescent quencher group is labeled at the 3' end of the probe.
2. The specific primers and probes according to claim 1, characterized in that, The fluorescent reporter group is CY5.5, and the fluorescent quencher group is BHQ2.
3. The application of the specific primers and probes described in claim 1 or 2 in the quantitative detection of *Helicobacter pylori*, the dominant pathogen of wheat root rot.
4. A dPCR detection kit for detecting the dominant pathogen of wheat root rot, characterized in that, The dPCR detection kit includes: a forward primer and a reverse primer for detecting the pathogen *Hymenochrysis maltans*, and a probe for detecting *Hymenochrysis maltans*; wherein the nucleotide sequence of the forward primer for detecting *Hymenochrysis maltans* is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer for detecting *Hymenochrysis maltans* is shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No. 3, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe.
5. The dPCR detection kit according to claim 4, characterized in that, The fluorescent reporter group is CY5.5, and the fluorescent quencher group is BHQ2.
6. A dPCR quantitative detection method for *Helicobacter pylori*, the dominant pathogen of wheat root rot, characterized in that... include: DNA was extracted from the sample to be tested as an amplification template. A dPCR amplification system was established using the forward primer with nucleotide sequence SEQ ID No. 1, the reverse primer with nucleotide sequence SEQ ID No. 2, and the probe with nucleotide sequence SEQ ID No.
3. Based on the amplification results, the presence of the dominant pathogen of wheat root rot, *Hylocereus malathus*, in the sample was detected and quantitatively analyzed.
7. The dPCR quantitative detection method according to claim 6, characterized in that, The dPCR amplification reaction system is as follows: 6 μL of reagent A, 1.5 μL of reagent B, 1.8 μL each of the forward and reverse primers for detecting the pathogen *Hymenochrysis maltii*, 0.75 μL of the probe for detecting *Hymenochrysis maltii*, 1 μL of DNA from the sample to be tested, and the remainder is sterile water, with a total reaction volume of 30 μL.
8. The dPCR quantitative detection method according to claim 6, characterized in that, The dPCR amplification conditions were as follows: pre-denaturation: 95℃, 10 min; annealing extension: 94℃, 30 s; 58℃, 1 min; 45 cycles.
9. A triple dPCR detection kit for simultaneously detecting the dominant pathogen of wheat root rot, *Helicobacter pylori*, and the dominant pathogen of wheat snow rot, *Microcystis aeruginosa*, characterized in that, include: Forward primers, reverse primers, and probes for detecting *Helicobacter pylori*, the dominant pathogen of wheat root rot; Forward primers, reverse primers, and probes for detecting *Micrococcus nivali*, the dominant pathogen of wheat snow rot; detection of wheat internal reference genes. TaHd1 Forward primers, reverse primers, and probes; The nucleotide sequence of the forward primer for detecting the pathogen *Hymenochrysis maltans* is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer for detecting *Hymenochrysis maltans* is shown in SEQ ID No. 2; the nucleotide sequence of the probe is shown in SEQ ID No. 3, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe. The nucleotide sequence of the forward primer for detecting the pathogenic fungus *Micrococcus nivalis* is shown in SEQ ID No. 16, and the nucleotide sequence of the reverse primer for detecting the pathogenic fungus *Micrococcus nivalis* is shown in SEQ ID No. 17; the nucleotide sequence of the probe is shown in SEQ ID No. 18, wherein a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end of the probe. The aforementioned detection internal reference gene TaHd1 The nucleotide sequence of the forward primer is shown in SEQ ID No. 31, and the detection internal reference gene is described. TaHd1 The nucleotide sequence of the reverse primer is shown in SEQ ID No. 32; the nucleotide sequence of the probe is shown in SEQ ID No. 33, wherein a fluorescent reporter group is labeled at the 5' end of the probe and a fluorescent quencher group is labeled at the 3' end of the probe.
10. The triple dPCR detection kit according to claim 9, characterized in that, The probe with the nucleotide sequence shown in SEQ ID No. 3 is labeled with a fluorescent reporter group CY5.5 at the 5' end and a fluorescent quencher group BHQ2 at the 3' end. The probe with the nucleotide sequence shown in SEQ ID No. 18 is labeled with a fluorescent reporter group ROX at the 5' end and a fluorescent quencher group BHQ2 at the 3' end. The nucleotide sequence of the probe is shown in SEQ ID No.
33. The probe is labeled with a fluorescent reporter group VIC at the 5' end and a fluorescent quencher group MGB at the 3' end.