Screening of Candida albicans subtype-specific multicopy sequences and their applications
Patent Information
- Application Number
- CN202611214984.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-12
- Publication Date
- 2026-09-18
AI Technical Summary
本发明旨在解决临床念珠菌诊断周期长、误诊漏诊等问题,实现早期诊断,精准用药之目的
(1)五种念珠菌亚型精准分型检测,实现早期诊断,精准用药
Smart Images

Figure CN122773028A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, and in particular relates to the screening and application of specific multicopy sequences of five Candida subtypes: Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei. Background Technology
[0002] Invasive fungal disease (IFD) is an infectious disease caused by fungi invading human tissues or bloodstreams, triggering inflammatory responses and organ dysfunction. It commonly occurs in immunocompromised, cancerous, and critically ill patients. It is estimated that there are 6.55 million cases of invasive fungal infections globally each year, with 3.75 million deaths, 2.55 million of which are directly caused by fungal infections. Among IFDs, invasive pulmonary fungal disease (IPFD) accounts for the largest proportion. IPFD patients typically have severe conditions, atypical clinical presentations, and are easily misdiagnosed or missed, leading to low treatment rates, heavy medical burdens, and long hospital stays. In China, invasive pulmonary fungal disease is mainly caused by Candida infections, which often lead to candidemia, bronchopulmonary candidiasis, and other conditions with poor prognosis.
[0003] Candida spp. is a type of opportunistic pathogenic yeast-like fungus. Its most prominent biological characteristic is its dimorphism, that is, under normal circumstances, it exists in the form of yeast phase (budding spores) and is not pathogenic; when conditions are suitable or the body's resistance decreases, it can transform into the hyphal phase, forming pseudohyphae and budding spores, thereby acquiring the ability to invade.
[0004] Candida is the most common opportunistic fungal pathogen worldwide. Studies show that Candida albicans can be isolated from oral, pharyngeal, and gastrointestinal specimens in at least 50% of healthy individuals, and it is present in the vagina of 30% of pregnant women. Invasive Candida infections affect more than 1.5 million people globally each year, with a mortality rate of approximately 50% for candidemia. For a long time, Candida albicans has been the leading pathogen of Candida infections, accounting for 80%-90% of clinical isolates. However, in recent years, a global epidemiological trend has emerged, showing a decline in the proportion of Candida albicans and a significant increase in non-Candida albicans. In a study of 7,864 Candida infection cases at a tertiary hospital in southern China from 2016 to 2021, while Candida albicans remained the most common, the proportions of Candida tropicalis and Candida glabrata had increased significantly. This species migration has important clinical significance because non-Candida albicans often exhibit higher drug resistance rates and mortality rates.
[0005] Treatment of invasive candidiasis typically involves triazole antibiotics, echinocandins, and amphotericin B. Echinocandins are the first-line treatment, followed by a step-down approach using triazole antibiotics based on fungal identification. Amphotericin B is used as an alternative for resistant strains. Fluconazole, voriconazole, itraconazole, and posaconazole are commonly used triazole antifungal drugs, with fluconazole being the most widely used clinically. However, its resistance rate varies significantly among different Candida species. Candida glabrata exhibits dose-dependent resistance to fluconazole, while Candida krusei mostly possesses innate resistance to fluconazole. The latest global meta-analysis shows that Candida krusei has the highest inherent resistance rate to fluconazole (pooled resistance rate 78.3%), followed by Candida glabrata (15.9%), Candida tropicalis (13.0%), and Candida dublinis (11.1%). Data from the China Hospital Invasive Fungal Disease Surveillance Network (CHIF-NET) shows a significant upward trend in fluconazole resistance rates among *Candida krusei*, *Candida parapsilosis*, and *Candida tropicalis*. In Guangdong Province, China, the resistance rates of *Candida parapsilosis* to caspofungin, micafungin, and anidulafungin were 5.0%, 4.0%, and 3.8%, respectively, showing a year-on-year increase. Different *Candida* subtypes exhibit varying resistance rates to antifungal drugs, and clinicians select different antifungal drugs based on the subtype. Therefore, *Candida* typing is crucial for precise clinical medication.
[0006] Currently, there are several methods for the clinical diagnosis of invasive candidiasis, including direct microscopy, fungal culture, serological testing, and molecular testing. Specifically: (1) Direct microscopy. Sterile body fluid smears are stained and observed under a microscope. Preliminary identification is made based on morphological characteristics, nutritional properties, and staining properties. Due to the high requirements for personnel and low sensitivity, negative results cannot rule out candidiasis, which limits its widespread clinical application. (2) Fungal culture. It is the gold standard for the diagnosis of invasive fungal diseases, but the culture time for Candida albicans needs to be more than 48 hours. Most patients have already taken medication before the fungal culture, and the culture time for Candida albicans needs to be longer. The operation is complicated, the positive rate of culture is low, and the culture time is long, which hinders early clinical intervention. (3) Fungal G test. It is currently the most widely used serological test at home and abroad. It detects the fungal cell wall component (1,3)-β-D-glucan, but it is not a Candida-specific test. Aspergillus, Pneumocystis jirovecii, Cryptococcus and other fungi can also be detected positively. At the same time, the detection sensitivity is relatively low. (4) Molecular testing. The main diagnostic methods include next-generation sequencing (NGS) and PCR. NGS offers high throughput and broad pathogen coverage, providing some diagnostic evidence for clinical practice; however, it still faces technical challenges such as long testing cycles, high costs, and complex data analysis. PCR detection can detect fungal DNA in a short time, facilitating the early diagnosis of invasive fungi and is currently the preferred clinical diagnostic method. However, there are currently limited registered PCR diagnostic kits for Candida albicans, and they lack typing capabilities, requiring a combination of clinical manifestations and culture results for diagnosis.
[0007] Because the aforementioned Candida detection methods suffer from poor sensitivity, low specificity, long testing cycles, poor repeatability, and frequent false positives or false negatives, leading to misdiagnosis and missed diagnosis, the treatment of candidiasis is currently still in the empirical stage. However, if the Candida subtype is unclear, prolonged empirical use of a single drug can lead to increased drug resistance. Furthermore, epidemiological studies show that different subtypes exhibit varying susceptibility and resistance to different drugs. Current clinical treatment relies heavily on the diagnosis of the specific Candida subtype. Therefore, accurately identifying the Candida subtype is the prerequisite and foundation for precise medication. Summary of the Invention
[0008] To address the problems existing in the prior art, this invention provides a specific multicopy sequence of the genome of five Candida subtypes. Primers and probes are designed using this sequence, experimental conditions are explored, and a nucleic acid detection system is established, which can specifically, sensitively, accurately, and rapidly detect five Candida subtypes in clinical samples: Candida albicans, Candida parapsilosis, Candida glabrata, Candida tropicalis, and Candida krusei.
[0009] The Candida nucleic acid typing reagent of this invention utilizes TaqMan probes for independent amplification in the six fluorescence channels of a nucleic acid analyzer, simplifying the analysis process. Combined with a fully automated fungal nucleic acid extraction reagent, it can rapidly and accurately detect five common clinical Candida subtypes (Candida albicans, Candida parapsilosis, Candida glabrata, Candida tropicalis, and Candida krusei), providing a valuable basis for early clinical diagnosis and precise treatment of candidiasis. This invention aims to solve the problems of long clinical diagnosis cycles, misdiagnosis, and missed diagnosis in Candida, achieving the goal of early diagnosis and precise medication.
[0010] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One objective of this invention is to provide a specific multicopy sequence combination for detecting five Candida subtypes: Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei, including SEQ ID NO.1-SEQ ID NO.5.
[0011] The second objective of this invention is to provide a specific primer-probe combination, including primers and probes designed based on the specific multi-copy sequence combination; the sequences of the primers and probes are shown in SEQ ID NO.6-SEQ ID NO.20.
[0012] The third objective of this invention is to provide a method for screening the specific multicopy sequence combinations, comprising the following steps: downloading reference genome sequences of five Candida species; breaking the reference genome sequences into 200 bp kmer fragments, counting kmer fragments with a frequency ≥2, and constructing a candidate kmer set; obtaining the nucleic acid sequence index numbers of all Candida species from the NCBI database and constructing a GI file; aligning the candidate kmer set to the NCBI nt database after removing the corresponding Candida-specific sequences with an evalue=1.0E-5 threshold, removing non-specific kmers, and obtaining a Candida-specific kmer set; assembling and deduplicating the specific kmer set to obtain specific multicopy sequences SEQ ID NO.1-SEQ ID NO.5.
[0013] The fourth objective of this invention is to provide the application of the specific multicopy sequence combination and / or the specific primer-probe combination in the preparation of products for detecting Candida subtypes.
[0014] Furthermore, the products include reagent kits, nucleic acid compositions, and nucleic acid chips.
[0015] The fifth objective of this invention is to provide a product for detecting Candida subtypes, wherein the Candida subtypes include five Candida subtypes: Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei, and the product contains the specific primer-probe combination.
[0016] Furthermore, the products include reagent kits, nucleic acid compositions, and nucleic acid chips.
[0017] Furthermore, when the product is a kit, the kit also contains a real-time PCR reaction buffer, DNA polymerase, dNTPs, a positive control, and a negative control.
[0018] Furthermore, the positive control is a recombinant plasmid or synthetic nucleic acid containing at least one sequence from SEQ ID NO.1 to SEQ ID NO.5.
[0019] Furthermore, the nucleic acid chip has a solid-phase carrier on which capture probes designed based on SEQ ID NO.1-SEQ ID NO.5 are immobilized.
[0020] Compared with the prior art, the present invention has the following beneficial effects: (1) Precise typing of five Candida subtypes enables early diagnosis and precise medication. The latest global meta-analysis shows that *Candida krusei* has the highest inherent resistance rate to fluconazole, with a total resistance rate of 78.3%, followed by *Candida glabrata* at 15.9%, *Candida tropicalis* at 13.0%, and *Candida dublinii* at 11.1%. Analysis of data published by the China Hospital Invasive Fungal Disease Surveillance Network (CHIF-NET) over time shows a significant upward trend in fluconazole resistance rates among *Candida krusei*, *Candida glabrata*, and *Candida tropicalis*. In Guangdong Province, China, the resistance rates of *Candida glabrata* to caspofungin, micafungin, and anidulafungin are 5.0%, 4.0%, and 3.8%, respectively, showing a year-on-year upward trend. Given the drug resistance characteristics of Candida and the increasing trend of resistance, clinical treatment of different Candida subtypes will inevitably differ. Therefore, accurate Candida typing becomes crucial. This invention focuses on typing, utilizing the "Cormorant" big data mining system to screen for highly specific, high-copy-value genes from tens of millions of base pairs in the genome. Through primer design and reagent optimization, it achieves accurate typing detection of five Candida subtypes, filling a gap in clinical Candida typing diagnosis. This facilitates early diagnosis, precise medication, and reduces drug resistance rates. Simultaneously, it overcomes the shortcomings of clinical culture tests, such as complex operation, high technical requirements, long detection cycles, and low sensitivity.
[0021] (2) One detection system can detect five Candida subtypes simultaneously, with high detection efficiency and low cost. The high-specificity, high-copy-ratio genes screened in this invention do not overlap in sequences across different subtypes or even different species. Therefore, the detection method developed based on this invention can simultaneously detect five Candida subtypes in a single reaction system. It is simple to operate, has low background noise and minimal interference, significantly reduces sample volume, and saves reagents and consumables. This system can be widely used on different detection platforms, especially common clinical detection methods such as six-channel quantitative PCR, and can be rapidly adopted in clinical practice.
[0022] (3) High-specificity, high-copy genes were screened out. The unique primer and probe design greatly improved the specificity and sensitivity. Bioinformatics analysis shows that the Candida-specific multicopy sequences obtained in this invention, compared with the reference genome, show extremely high sensitivity: 7 copies for Candida albicans, 2 copies for Candida glabrata, 8 copies for Candida glabrata, 9 copies for Candida tropicalis, and 3 copies for Candida krusei. ITS region sequences are small, limiting primer design, and specific sequences are fragmented and cross-linked with conserved sequences in the Candida genus. Designing primers and probes targeting ITS regions easily leads to non-specific amplification, and due to the close spacing between primers, multiplex PCR systems are prone to primer dimers. In contrast, the specific multicopy sequences obtained in this invention, screened using independently developed technology, have relatively independent sequence fragments with genes clustered far apart, making non-specific amplification or primer dimers unlikely. Furthermore, there is no specific alignment with other microorganisms causing human diseases or other Candida species. Using these specific multicopy sequences to design primers and probes for clinical detection of five Candida nucleic acid subtypes offers high detection performance (high specificity and high sensitivity), solving the problems of missed and misdiagnosed cases in clinical practice, and has broad clinical application prospects. Attached Figure Description
[0023] Figure 1 This refers to the kmer_200.fa file (kmer fragment number) in this invention.
[0024] Figure 2 This refers to the GI file (index number of the Candida nucleic acid sequence) in this invention.
[0025] Figure 3 This refers to the kmer_spe.fa file (a set of kmers specific to Candida) in this invention.
[0026] Figures 4-8 This is the alignment result of the five Candida Node sequences in this invention with the reference gene blast.
[0027] Figure 9 This is the comparison result between the ITS regions of five Candida species and the reference gene in this invention.
[0028] Figure 10 This is a multiple sequence alignment diagram of the ITS region of various Candida species.
[0029] Figures 11-15 This provides the primer secondary structure information for the five Candida species used in this invention.
[0030] Figure 16 These are the qPCR results of positive samples in this invention.
[0031] Figure 17 Comparison of qPCR results for non-target Candida albicans (with positive control).
[0032] Figure 18 The results of the qPCR experiment for the negative sample (compared with the positive control).
[0033] Figure 19 The results show the consistency between Sanger sequencing and the reagents of this invention.
[0034] Figure 20 This is the analysis result of the consistency between Sanger sequencing and clinical culture. Detailed Implementation
[0035] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0036] The experimental procedure in this invention is as follows: (1) First, the sequence was obtained using the self-developed "Cormorant" biological big data mining system (Example 1).
[0037] (2) Then compare it with the traditional ITS2 region gene sequence (Example 2).
[0038] (3) Next, primers and probes were designed based on the obtained sequences and bioinformatics analysis was performed (Example 3).
[0039] (4) Finally, the clinically widely used technology platform of real-time PCR was selected. Primers and probes were designed, experimental conditions were screened, and a reaction system was established. The detection of the five subtypes of Candida was placed in one reaction system, and its performance indicators such as positive judgment value, sensitivity, specificity, anti-interference, freeze-thaw and shelf-life stability, and consistency with clinical culture results were verified. The efficiency and cost were compared with existing commercial Candida nucleic acid detection methods (Examples 4-9).
[0040] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0041] Example 1: Cormorant Big Data Mining System Retrieves Sequences Using the independently developed "Cormorant" biological big data mining system, reference genome sequences of Candida albican (GenBank: GCA_000182965.3), Candida tropicalis (GenBank: GCA_000006335.3), Candida parapsilosis (GenBank: GCA_000182765.2), Nakaseomyces glabratus (GenBank: GCA_010111755.1), and Pichia kudriavzevii (GenBank: GCA_003054445.1) were downloaded from the international authoritative database GenBank Nucleotide.
[0042] The reference genome sequence was fragmented into 200bp kmer fragments using nucleic acid sequence breaking software. The frequency of different kmers in the genome was counted, and kmer fragments that appeared more than twice were selected and numbered to form a candidate kmer set (named kmer_200.fa). Figure 1 ).
[0043] In the NCBI GenBank database, a search was conducted using the Latin name of Candida as the keyword to export the index numbers of all nucleic acid sequences belonging to Candida, which were then named GI files. Figure 2 ).
[0044] KMER fragment-specific alignment: Using nucleic acid sequence alignment software, the candidate KMER set (kmer_200.fa) was aligned to the NCBI nt database after removing the specific sequences (GI) corresponding to Candida. Using an evalue of 1.0E-5 as a threshold, the non-specific KMER sequences from the alignment were counted. These non-specific KMERs were then removed from the candidate KMER set to obtain the Candida-specific KMER set (named kmer_spe.fa). Figure 3 ).
[0045] The highly specific kmer sequence (kmer_spe.fa) was assembled and deduplicated using nucleic acid sequence assembly software to obtain a longer Candida-specific multicopy sequence (Candida_nodes.fa). Comparison with the reference genome revealed 7 copies of Candida albicans, 2 copies of Candida parapsilosis, 8 copies of Candida glabrata, 9 copies of Candida tropicalis, and 3 copies of Candida krusei. Figures 4-8 The sequence is as follows: >Candida albicans_NODE_length_640 (SEQ ID NO.1) TGGTTTTAAAACCCGAGAGAATCGTTAATAGCGGCAATTAGTTGGGTGCTGCAGGAGCAAAAAGGCCGTTTTGTCCATAGTTAAGAGCACCCTGGTAACCCCGTTTGCTAATAGCACAACCAATTGAAGCTGGTATTTGGTGGCTCTGGTGTCAATTTAT AGCCAACAATAAACATTTTCAAATCCGTCTAGACCGGTCAAAAGAAGAGTTGAGCTTCCATCTCTGGGTCAAAAAAGGCCGTTTTGGCCATAGTTAAGGCCACCCCCTTTCTGTAGCACAACCAATTGAAGTTGGTATTTGGTGGCTCTAGTGCCGATTT GTAGAGTCAAGTTATAGTGTTTGCATCCGAGAGTTTTGATTTATTCAGTGTTGTTTTCATTGGTTGAGGGCAAAAAATTCGCATCGAGCAGAAAAGGTCGTGCCCGGGGCATAGTGGATAGGCAACGATTACTGATGAACCACATGTGCTACAAAGACCA AACTAGGGCCGTTTTGAAGCTACAATCATGTAGAGTATTGGGTGTGAATTAGGCATGAATCGGATCAGAATTGGTTGAGCTATTGAAGAAAATGTTTTCTCCGTGGAAATGTGAAATTAACTCCGCCAAGGCTGACACAGTCAGTTTCGATGCTAGAAAG >Candida tropicalis_NODE_length_(SEQ ID NO.2) GTGATCTCTTCGCATCCGCCGGAGCTGTCAACAGAAACCTTACCCTCGCAGCCATAGAAATGAACCAATTCAGGGTCTTCCCCGAAGAACAAGTGGTCTCCAGAAAGAATCCA >Candida parapsilosis_NODE_length_(SEQ ID NO.3) ATGCTCAGAGTCGTAAGCATGTGAGAGAAGCATATGGATTTACTTGGTATGGCATACTTAAGTTGATTTATGTTATGGTGTATCATAAGGGAGCACGAGCACATGAGGTAGGTGTACTATTCGTTTTTATTGATATGGCATAACTAAGTCTATCTACTACAGTGTACTTTGCACTTTGACCACCTGGGAAAAAACCCCGATGCTCTTACATGATATGTGATGGAATACCCCTAAGGTTCATTTATGTTATGGCATAGCTAAAGAAAGCATGCCAGGTGTATTTTATCTATCTTTATCATTATGGCTTACCCCCCTGTTGAATTTTGGTATGGCATATATATCTAACAAGACATCGCCATGGTCCTCTATCAATTTACCCGGCACTCTTCCATTGAAAAACCACAACCTCCTACAACCTCCTCCCACTCAACCCTGGCAACGCTTACCCGGCACTCCCCCACATAAAACGTCTACAAACTCGCAAGCTCTCGCCCGCAAACTCGTAG >Nakaseomyces glabratus_NODE_length_(SEQ ID NO.4) >Pichia kudriavzevii_NODE_length_(SEQ ID NO.5) CCACGGAGGGAGCGGAGGGGCGTTTTCGGACGGTGCTCAGCCAGCCGGGGGGACGAGGAGCCTTTGGGCTTGCACAGGCGGATGCCCGTCGTGAGACGGGGGTGCGCGGTGACGGGGTTGGTGGACTGCTAGCTGATAGCCAGCGGGAAACTAGCCGAGGGGGAACGGGGGCTGCGCGTAGCCG GCGGAGACGCTGTGACGTGTGGCCGACGCTCTCCACAGACGCGGTGGCGGGTGCTGCGTGCGGAGACGTGCGGAGCGTGCGGGCCGTGGAAGAAAGTCGGAAAGTGCTATGTGGAAGGGCATCTAGCCAAGAGAACTAGACTCGAGCCATTGGGGATAGTTATCTGGTTGATCCTGCCAGTAGT Based on the above, different nucleic acid detection technologies, such as conventional PCR, quantitative real-time PCR, isothermal amplification, and gene chips, can be used to design primers and probes, and develop a variety of Candida nucleic acid detection methods with high sensitivity, high specificity, low cost, and higher detection throughput. The innovation of this invention lies in the following: This invention uses the proprietary "Cormorant" biological big data mining system to break down the complete Candida reference sequence into fixed-length KMERS. Then, nucleic acid sequence alignment software is used to compare the KMERS with the NCBI nt library (a non-redundant nucleic acid database) to obtain multiple copy gene fragments that are repetitive in the Candida genome and not present in other microorganisms. The Candida gene detection method designed based on these gene fragments achieves high sensitivity and high specificity, solving the current difficulty in achieving both high sensitivity and specificity in primer design.
[0046] Example 2: Comparison of gene sequences with the traditional ITS2 region Traditional gene detection methods often target the ITS2 region sequence in Candida ribosomal RNA sequences. This embodiment compares the obtained specific multicopy sequence with the ITS region sequence in the ribosomal RNA sequence at the bioinformatics analysis level, demonstrating significantly high sensitivity and specificity. The results are as follows: A search of the NCBI website using the keywords "Candida albicans ITS region, Candida tropicalis ITS region, Candida parapsilosis ITS region, Nakaseomyces glabratus ITS region, Pichia kudriavzevii ITS region" yielded ITS2 region sequences for five Candida species. Sensitivity alignment of these sequences was performed on NCBI, and the results are shown below. Figure 9 The comparison results showed that Candida albicans had 1 copy, Candida tropicalis had 2 copies, Candida parapsilosis had 2 copies, Candida glabrata had 2 copies, and Candida krusei had 2 copies. The copy number was significantly less than that of the present invention, and theoretically, the sensitivity was lower than that of the present invention.
[0047] In terms of specificity, multiple sequence alignment was performed using the software MAGA (see...). Figure 10 The ITS2 region sequence still exhibits overlapping sequences across different species, particularly between *Candida albicans* and *Candida dublinica*, and between the *Candida spicata* complex, indicating high consistency. This suggests that the ITS2 region sequence has very low specificity. Although primers and probes can be designed to reduce sensitivity and increase specificity, the gene has a high degree of matching with the genomes of non-target *Candida* species. Primers and probes cannot avoid binding to non-target *Candida* genes and causing PCR amplification. When testing clinical samples, positive results for non-target *Candida* species are mistakenly identified as target *Candida* species, leading to clinical misdiagnosis. Furthermore, the available primer and probe length for the ITS region is only 200-300 bp. Within such a small gene sequence, specifically amplifying the targets of the five *Candida* subtypes is not feasible, as numerous experiments have demonstrated that primer and probe design is not feasible. Therefore, using the ITS2 region sequence for *Candida* nucleic acid typing is not feasible.
[0048] Bioinformatics analysis shows that the specific multicopy sequence obtained in this embodiment exists in multiple copies in the whole genome of the target Candida. Compared with the reference genome, there are 7 copies of Candida albicans, 2 copies of Candida parapsilosis, 8 copies of Candida glabrata, 9 copies of Candida tropicalis, and 3 copies of Candida krusei. Theoretically, all of them have extremely high sensitivity. The ITS region sequence fragments are small, limiting primer design. Specific sequences are fragmented and cross-linked with conserved sequences in the Candida genus. Designing primers and probes in this region easily leads to non-specific amplification. Furthermore, due to the close proximity of primers, multiplex PCR systems are prone to primer dimers. In contrast, the specific multicopy sequences obtained in this invention, screened using independently developed technology, produce relatively independent sequence fragments with greater gene spacing, making non-specific amplification or primer dimers less likely. They also lack non-specific comparisons with other microorganisms causing human diseases and other Candida species. Primers and probes designed using these specific multicopy sequences can be used for clinical detection of five Candida nucleic acid subtypes. With high detection performance (high specificity, high sensitivity), low cost, and simple operation, this method solves the problems of missed diagnoses, misdiagnoses, and precision medication in clinical practice. Precise Candida typing has broad application prospects in early clinical diagnosis and personalized treatment.
[0049] Example 3 Primer and probe design and bioinformatics analysis The specific multicopy sequences obtained by this invention can be used to design primers and probes with high sensitivity and specificity and high copy number by adjusting parameters in conventional primer design software such as Genscript and Primer5, depending on the nucleic acid detection method.
[0050] In this practice, primers and probes were designed using the specific multicopy sequences of this invention, based on TaqMan real-time quantitative PCR technology. The product length was limited to 60-150 bp, the primer Tm value was set to 56±4℃, and the probe Tm value was set to 66±4℃. One primer-probe combination was designed for each of the five different Candida subtype-specific multicopy sequences, resulting in five primer pairs and five probes as follows: 1. Primer and probe design 1.1 Candida albicans CA1-F: TAAGAGCACCCTGGTAGCCC (SEQ ID NO. 6); CAI-R: GACCCAGAGATGGAAGGTCA (SEQ ID NO. 7); CAI-P: ACACCAGAGCCACCAAATACCGGCT (SEQ ID NO.8); Secondary structures of primers and probes, such as Figure 11 As shown.
[0051] 1.2 Candida glabrata CPa-F:GACATCGCCATGGTCCGCTA (SEQ ID NO.9); CPa-R: TAAGCGTTGCCAGGGTGGAG (SEQ ID NO. 10); CPa-P: ACCACAACCTCCTACAACCTCCTGCCA (SEQ ID NO. 11); Secondary structures of primers and probes, such as Figure 12 As shown.
[0052] 1.3 Candida glabrata CGl-F: CTCAGCTCCAACGAATGGAG (SEQ ID NO. 12); CGl-R:GGGTCGGAAGTTTGTAGGGC (SEQ ID NO. 13); CGl-P: CCGTCCGAACTCCATCCACTGCCA (SEQ ID NO. 14); Secondary structures of primers and probes, such as Figure 13 As shown.
[0053] 1.4 Tropical Candida CTr-F: CCGGAGCTGTCAACAGGAAC (SEQ ID NO. 15); CTr-R: GGAGACCACTTGTTCTGCGG (SEQ ID NO. 16); CTr-P:ACCCTCGCAGCCATAGAAATGAGCCA (SEQ ID NO. 17); Secondary structures of primers and probes, such as Figure 14 As shown.
[0054] 1.5 grams of Candida albicans CKu-F: GAGACGCTGTGACGGGTG (SEQ ID NO. 18); CKu-R: ATGCCCTTCCACATAGGACT (SEQ ID NO. 19); CKu-P: CCGCACGTCTCCGCACGCAG (SEQ ID NO. 20); Secondary structures of primers and probes, such as Figure 15 As shown.
[0055] 2. Bioinformatics Analysis 2.1 Copy number analysis: The product sequence corresponding to the primer was aligned to the reference genome of the corresponding target Candida. The number of matches obtained is the copy number of the primer and probe in the genome, and the statistics are shown in Table 1. 2.2 Specificity Comparison: Two evaluations were performed using the NCBI BLAST website: one for the product and one for the probe. The corresponding target Candida species were removed from the database, and then each product was matched against the database. The matching results were statistically analyzed, and detailed statistics are shown in Table 1. Table 1. Copy number and specificity analysis. F: Upstream primer; R: Downstream primer; P: Taqman probe.
[0056] As shown in Table 1, the primers and probes designed for the multicopy gene sequences of the Candida subtypes of this invention have a high copy number and exhibit high sensitivity; they did not match other Candida subtypes or other microorganisms that cause human diseases, thus exhibiting high specificity.
[0057] In summary, the primers and probes designed for the Candida subtype multicopy gene sequence of this invention exhibit excellent sensitivity and specificity. Their application in clinical nucleic acid testing can overcome the shortcomings of current laboratory testing methods, such as poor sensitivity, low specificity, poor reproducibility, and the lack of Candida subtype typing methods.
[0058] Example 4: Determination of Positive Judgment Value 1. Based on the parameters of the quantitative PCR instrument, five combinations of six fluorescent quenching groups can be selected from the following six combinations: 5'ATTO425-3'BHQ1, 5'6-FAM-3'BHQ1, 5'VIC-3'BHQ1, 5'ROX-3'BHQ2, 5'CY5-3'BHQ2, and 5'Quasar705-3'BHQ3. These combinations are used to detect the five subtypes of Candida, and one combination is reserved as a human reference gene for detection (internal control).
[0059] 2. Sample preparation: A total of 200 clinically cultured sputum samples were collected, including 79 positive for Candida albicans, 23 positive for Candida glabrata, 42 positive for Candida tropicalis, 24 positive for Candida glabrata, and 32 negative.
[0060] 3. Nucleic acid extraction of sputum samples is performed using the independently developed fungal nucleic acid extraction reagent (a general-purpose nucleic acid extraction reagent for pathogenic fungi and bacteria and its application, CN120249268A) that can be used in conjunction with this invention.
[0061] 4. Use the primers prepared in this invention to configure a fluorescent PCR system: The PCR reaction solution includes 2× PCR reaction solution (Novizan), primers, probes, and water to make up to 20 μL. Detailed preparation is shown in Table 2.
[0062] Table 2 Final Concentration Formulation Table for Fluorescent PCR Reaction
[0063] Prepare the reaction solution by mixing 20µL×n (n is the number of detections), aliquot it into PCR reaction tubes, add 5µL of sample / template, centrifuge briefly, and then perform the detection.
[0064] 5. Fluorescent PCR reaction conditions: A 5-channel PCR reaction was performed using the SLAN-96S from Macrostone. The specific reaction steps are as follows: 25℃, 120s, 1 cycle; 95℃ for 300 seconds, one cycle; 95℃ for 10s, 60℃ for 30s (collect fluorescence), 40 cycles; 37℃, 20s, 1 cycle.
[0065] 6. Perform conventional PCR on the sample nucleic acid using the primers in Table 3, and confirm the target positivity or positivity by Sanger sequencing.
[0066] Table 3 Information on Common PCR Primers
[0067] 7. Standard PCR reaction system: TaKaRa Taq™ Hot Start Version, primers, and water to make up to 50 μL. Detailed preparation is shown in Table 4.
[0068] Table 4 Final Concentration Formulation Table for Conventional PCR Reactions
[0069] 8. Standard PCR reaction conditions: 95℃, 300s, 1 cycle; 95℃, 10s; 60℃, 30s; 72℃, 30s; 45 cycles. 72℃, 300s, 1 cycle.
[0070] 9. Result determination: (1) Conventional PCR is used to determine positive and negative results by 2% agarose gel electrophoresis. If there is a band of the target length, it is sent for sequencing. If the band is the target gene, it is positive. Otherwise, if there is no band or the band is not the target gene, it is negative. (2) The results of quantitative real-time PCR were compared with those of Sanger sequencing, and the positive judgment value was determined by ROC curve.
[0071] 10. Results Analysis: ROC curves were used to determine the positive cutoff values for Candida albicans, Candida glabrata, Candida parapsilosis, Candida krusei, and Candida tropicalis, as detailed in Table 5. The cutoff values were Ct≤30.64 for Candida albicans, Ct≤30.43 for Candida glabrata, Ct≤32.82 for Candida parapsilosis, Ct≤31.86 for Candida krusei, and Ct≤30.15 for Candida tropicalis. Below these cutoff values, the positive and negative concordance rates with Sanger sequencing were both above 90%.
[0072] Table 5 Positive Judgment Value Information Table
[0073] Example 5: Sensitivity and Specificity Evaluation 1. Sample preparation: (1) Positive samples: Five Candida subtypes were cultured, diluted and plated, and colonies were counted. The concentration of active units (CFU / mL) of the stock solution was then calculated. The bacterial suspension was diluted 10 times with physiological saline to 1.0 × 10⁻⁶. 6 CFU / mL ~1.0×10 0 Seven concentration gradients of CFU / mL.
[0074] (2) Other pathogen positive samples: Escherichia coli, Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, Streptococcus agalactiae, Klebsiella pneumoniae, Acinetobacter baumannii, Haemophilus influenzae, Streptococcus stomatitis, Staphylococcus epidermidis, Moraxella catarrhalis, Mycoplasma pneumoniae, adenovirus, Epstein-Barr virus, Influenza A, Influenza B, Respiratory syncytial virus, Rhinovirus, Parainfluenza virus, a total of 12 bacteria, 7 viruses, and 1 mycoplasma; (3) Negative samples: Candida subtypes can be used as negative samples for each other (e.g., a positive sample of Candida albicans can be used as a negative sample of other subtypes).
[0075] 2. The reaction system and reaction conditions are described in Example 4.
[0076] 3. Result determination (based on Ct value, Table 6).
[0077] Table 6 Judgment Results
[0078] 4. Test Results: Depend on Figure 16It can be seen that the samples of Candida albicans, Candida parapsilosis, Candida glabrata, and Candida glabrata were within the range of 1.0 × 10⁻⁶. 6 CFU / mL ~1.0×10 0 There was a good linear relationship between CFU / mL and *Candida tropicalis* at 1.0 × 10⁻⁶. 6 CFU / mL ~1.0×10 1 There was a good linear relationship between CFU / mL, meaning the detection limit for the five Candida subtypes could reach 1.0 × 10⁻⁶. 0 CFU / mL and 1.0×10 1 CFU / mL, verifying that the primers and probes designed with the specific multi-copy sequence of this invention have extremely high sensitivity; by Figure 17 As can be seen, the PCR results showed that the non-target Candida samples did not have a clear amplification curve and were therefore judged as negative; in addition, the other 20 pathogen samples also did not show a clear amplification curve. Figure 18 This verifies that the primers and probes designed with the specific multicopy sequences of this invention have extremely high specificity.
[0079] Example 6 Anti-interference evaluation 1. Sample preparation: Five types of Candida sputum clinical samples were collected and screened, with one strongly positive and one weakly positive sample in each type.
[0080] 2. Based on the characteristics of sputum samples, substances that may be present in the samples or added during sample processing and that may cause PCR inhibition (interfering substances) were selected, including: dithiothreitol, sodium hydroxide, proteinase K, mucin, hemoglobin (bovine hemoglobin), purulent secretions (leukocytes), EDTA, sodium citrate, sodium heparin, levofloxacin, clindamycin phosphate, ceftriaxone, meropenem, amoxicillin, fluconazole, voriconazole, caspofungin acetate, dexamethasone, etc., as interfering substances and added to the reaction system to evaluate the anti-interference ability of the PCR detection system. The concentrations of the added interfering substances are shown in Table 7.
[0081] Table 7. Test Concentration and Amount of Interfering Substances Added 3. Nucleic acid extraction is performed on the processed sputum sample using the independently developed fungal nucleic acid extraction reagent (a general-purpose nucleic acid extraction reagent for pathogenic fungi and bacteria and its application, CN120249268A) that can be used in conjunction with this invention.
[0082] 4. Using the PCR reagents prepared according to the present invention, the extracted nucleic acid samples were subjected to real-time PCR detection. The reaction system and reaction conditions are described in Example 4.
[0083] 5. Result determination: (1) Determination of gender (Table 8): Table 8. Results of Sex Determination
[0084] (2) Strong positive samples: Calculate the CV value by statistically analyzing all test results (Ct value). The CV value should be less than 5%.
[0085] (3) Weak positive samples: The positive rate of the sample should be 100%.
[0086] 6. Test Results: The PCR results are shown in Table 9. For strongly positive samples, the interfering substances had no significant impact on the PCR detection system of this invention. The relatively high CV values in most samples were due to random errors in nucleic acid extraction and reaction system configuration. For weakly positive samples, the interfering substances also had no significant impact on the PCR detection system of this invention, with a positive rate reaching 100%. Therefore, the PCR detection system established using primers and probes designed with specific multi-copy sequences in this invention has high anti-interference ability and is stable and reliable.
[0087] Table 9. Evaluation results of the anti-interference ability of the PCR detection system Example 7: Freeze-thaw and Shelf-life Stability Evaluation 1. Sample Preparation: Collect and screen sputum samples from five Candida subtypes, identifying one strongly positive, one moderately positive, and one weakly positive case. Nucleic acid extraction was performed on the processed sputum samples using a self-developed fungal nucleic acid extraction reagent (a universal nucleic acid extraction reagent for pathogenic fungi and bacteria and its application, CN120249268A) that can be used in conjunction with this invention.
[0088] 2. Reagent preparation: The specific formula is shown in Example 4. It is divided into 24 reaction portions, and a total of 20 portions are prepared.
[0089] 3. The freeze-thaw experiment begins with the first thaw, which is 0 freeze-thaw cycles. Five freeze-thaw experiments are then conducted, with 0, 1, 3, 5, and 7 freeze-thaw cycles respectively.
[0090] Freeze-thaw procedure: Remove the reagent from the -20℃ freezer, thaw it completely at room temperature (15-30℃), then return it to the -20℃ freezer for one day to allow it to freeze completely. Each subsequent thawing and reuse of the reagent constitutes one freeze-thaw cycle. Repeat this process for 3, 5, and 7 freeze-thaw cycles.
[0091] 4. The shelf life experiment begins after the preparation is completed, at which point the shelf life is 0 days. Five shelf life experiments are conducted, namely 0 days, 1 day, 7 days, 1 month, and 3 months.
[0092] Shelf life calculation: Start calculating after the reagent is prepared. Place it in a -20℃ refrigerator for 24 hours (1 day) for shelf life, and place it in a -20℃ refrigerator for one calendar month for shelf life.
[0093] 5. PCR detection: The processed reagents were used to detect nucleic acid in sputum samples of the five Candida subtypes, with three replicates for each sample. Detection conditions are described in Example 4.
[0094] 6. Result determination: Statistically calculate the CV value from all test results (Ct values). The CV value for strong / moderate positive samples should be less than 5%.
[0095] 7. Test Results: The results of the freeze-thaw stability test are shown in Table 10. According to the data table, except for the weak positive sample of Candida tropicalis with a CV greater than 5%, the rest met the evaluation requirements. Moreover, the reagent can stably detect five Candida subtypes under 7 freeze-thaw operations, indicating that the reagent of the present invention has good freeze-thaw stability.
[0096] The shelf-life stability test is shown in Table 11. Except for the weak positive sample of Candida tropicalis with a CV greater than 5%, the rest met the evaluation requirements. The reagent can stably detect five Candida subtypes when stored at 20℃ for 3 months, indicating that the reagent of the present invention has good shelf-life stability.
[0097] Table 10 Results of freeze-thaw stability test Table 11 Results of Shelf Life Stability Test Example 8: Consistency assessment of Sanger sequencing with the present invention and clinical culture results Sanger sequencing is recognized as the gold standard in medical testing, and Candida culture is the most commonly used clinical testing method. This invention and the clinical culture method are compared with Sanger sequencing to determine whether this invention is superior to the clinical culture method.
[0098] 1. Sample preparation: A total of 200 clinically cultured sputum samples were collected, including 79 positive for Candida albicans, 23 positive for Candida glabrata, 42 positive for Candida tropicalis, 24 positive for Candida glabrata, and 32 negative.
[0099] 2. Nucleic acid extraction of sputum samples is performed using the independently developed fungal nucleic acid extraction reagent (a general-purpose nucleic acid extraction reagent for pathogenic fungi and bacteria and its application, CN120249268A) that can be used in conjunction with this invention.
[0100] 3. Using the PCR reagents prepared according to the present invention, the extracted nucleic acid samples were subjected to real-time PCR detection. The reaction system and reaction conditions are described in Example 4.
[0101] 4. The extracted nucleic acid samples were amplified by conventional PCR to obtain the target length bands for Sanger sequencing. The reaction system and reaction conditions are described in Example 4.
[0102] 5. Result determination: (1) Judgment criteria for real-time PCR (Table 12).
[0103] Table 12 Results of Real-Time PCR
[0104] (2) Ordinary PCR is used to determine positive and negative results by 2% agarose gel electrophoresis. If there is a band of the target length, it is sent for Sanger sequencing. If the sequencing result matches the target Candida gene in the database, it is judged as positive. Otherwise, if there is no band or the match is a non-target Candida gene, it is judged as negative.
[0105] 6. Test Results: according to Figure 19 The results show that the present invention has a high degree of consistency with Sanger sequencing, proving that the reagent of the present invention has high accuracy in the detection of Candida subtypes in clinical samples. according to Figure 20 The results show that there is a significant difference in positive consistency between clinical culture and Sanger sequencing. Further data analysis reveals that most of the differences are due to the "Sanger sequencing positive - culture negative" pattern, indicating that the clinical culture method has low sensitivity.
[0106] The results in summary indicate that the nucleic acid detection method of the present invention has higher detection sensitivity than the in vitro culture method. The main reasons for the differences between the methodologies are: (1) Before sample collection, most patients have undergone antifungal drug treatment, which inhibits fungal activity and slows growth, resulting in a negative result during the culture period; (2) Clinical culture relies on the strong professional experience of professionals, and professionals select to report the dominant bacteria as positive or the colonizing bacteria as negative based on the growth of microorganisms in the plate, which involves subjective factors, especially in the examination of non-sterile body fluids such as sputum.
[0107] The primers and probes designed based on specific multicopy sequences in this invention have the following characteristics: (1) high copy number, high sensitivity, low positive judgment value, and more sensitive reaction; (2) high specificity, and will not amplify subtypes other than the five Candida subtypes or 20 common pathogenic microorganisms in sputum; (3) unaffected by drug treatment, even if Candida is drug-induced dead, as long as the gene fragment is present, this invention can detect it; (4) compared with the clinical culture method, the nucleic acid detection speed is faster, which can shorten the diagnostic window period for patients with acute infection; (5) based on different nucleic acid detection technology platforms, detection reagents suitable for different scenarios can be established to expand the feasibility of nucleic acid detection.
[0108] Example 9 Comparison with relevant information of commercially available reagents By using the data query system of the National Medical Products Administration, and based on the keywords "Candida" and "fungus", we searched for existing Candida nucleic acid detection reagents with valid registration certificates. The statistics are summarized in Table 13.
[0109] Table 13 Information on Existing Valid Registered Certificates for Candida Nucleic Acid Detection Products As can be seen from the table, there are eight Candida nucleic acid detection kits with valid registration certificates. Among them, four are single-type Candida albicans detection kits and four are general-purpose Candida detection kits. None of them are multiplexing detection kits. However, this invention can specifically detect five Candida subtypes (these five subtypes account for 98.9% of clinical Candida infections) within a single detection system. Its advantage lies in the typing detection of Candida, providing accurate and rapid medication guidance for clinicians and shortening the treatment window period.
[0110] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A specific multi-copy sequence combination, characterized in that, It is used to detect five Candida subtypes: Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei, including SEQ ID NO.1-SEQ ID NO.
5.
2. A specific primer-probe combination, characterized in that, This includes primers and probes designed based on the specific multicopy sequence combination described in claim 1; the sequences of the primers and probes are shown in SEQ ID NO.6-SEQ ID NO.
20.
3. A method for screening specific multi-copy sequence combinations as described in claim 1, characterized in that, Includes the following steps: Download the reference genome sequences of five Candida species; break the reference genome sequences into 200 bp kmer fragments, count the kmer fragments that appear ≥2 times, and construct a candidate kmer set; The NCBI database was used to obtain the nucleic acid sequence index numbers of all Candida species and construct a GI file. The candidate kmer set was aligned to the NCBI nt database after removing the corresponding Candida-specific sequences with an evalue of 1.0E-5 as the threshold. Non-specific kmers were removed to obtain the Candida-specific kmer set. The specific kmer set was assembled and deduplicated to obtain the specific multicopy sequences SEQ ID NO.1-SEQ ID NO.
5.
4. The use of the specific multicopy sequence combination of claim 1 and / or the specific primer-probe combination of claim 2 in the preparation of products for detecting Candida subtypes.
5. The application according to claim 4, characterized in that, The products include reagent kits, nucleic acid compositions, and nucleic acid chips.
6. A product for detecting Candida subtypes, characterized in that, The Candida subtypes include five Candida subtypes: Candida albicans, Candida tropicalis, Candida parapsilosis, Candida glabrata, and Candida krusei. The product contains the specific primer-probe combination as described in claim 2.
7. The product according to claim 6, characterized in that, The products include reagent kits, nucleic acid compositions, and nucleic acid chips.
8. The product according to claim 7, characterized in that, When the product is a kit, the kit also contains a real-time PCR reaction buffer, DNA polymerase, dNTPs, a positive control, and a negative control.
9. The product according to claim 8, characterized in that, The positive control is a recombinant plasmid or synthetic nucleic acid containing at least one sequence from SEQ ID NO.1 to SEQ ID NO.
5.
10. The product according to claim 7, characterized in that, The nucleic acid chip has a solid-phase carrier on which capture probes designed based on SEQ ID NO.1-SEQ ID NO.5 are immobilized.