Functional kasp molecular marker of major gene pcsipk2 related to salt tolerance of pea and application thereof

Abstract

The application discloses a major gene related to salt tolerance of peas PsCIPK2 The application belongs to the technical field of plant molecular breeding, and discloses a functional KASP molecular marker and an application thereof. Based on whole genome association analysis, a functional SNP site significantly related to salt tolerance is identified at the position of 337,817,277 bp of chromosome 5 of peas, the site is T / G polymorphism, and is located in the coding region of a major gene PsCIPK2 for salt tolerance. A competitive allele-specific PCR molecular marker primer is further developed, and a high-efficiency and accurate genotyping method is established. The marker can realize rapid identification of different salt tolerance genotypes through a fluorescence signal, and has the advantages of simple operation, low cost, intuitive data interpretation and the like. By applying the KASP molecular marker primer, large-scale prospective selection can be carried out on a breeding population at the seedling stage or the seed stage, the breeding cycle is significantly shortened, and the selection efficiency is improved.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a functional KASP molecular marker of the major gene PsCIPK2 related to salt tolerance in peas, and a method for using this marker to assist in the breeding of salt-tolerant pea varieties. Background Technology

[0002] pea( Pisum sativum Peas (L.) are an important edible legume crop. They not only provide high-quality protein but also possess ecological functions such as biological nitrogen fixation and soil fertility improvement. However, existing major varieties generally have poor salt tolerance, and salt stress can lead to a significant decline in photosynthetic physiological indicators, restricting the large-scale cultivation of peas in saline-alkali areas.

[0003] Salt tolerance in peas is a complex quantitative trait, controlled by multiple genes and easily influenced by the environment. Traditional breeding relies on phenotypic selection, but its low efficiency, long cycle, and poor accuracy have hampered the breeding process of salt-tolerant varieties. With the release of the pea reference genome and the development of sequencing technology, SNP-based molecular marker-assisted selection has become an efficient breeding method. Kompetitive allele-specific PCR (KASP) technology has advantages such as high throughput, low cost, and high accuracy, and has been widely used in marker-assisted breeding of crops. However, stable and usable functional KASP molecular markers are still lacking in pea salt tolerance breeding. Summary of the Invention

[0004] To address the problems of existing pea salt tolerance breeding methods, such as the lack of efficient molecular markers, long breeding cycles, and low accuracy, this invention aims to provide a KASP molecular marker for the major gene PsCIPK2 related to pea salt tolerance, along with specific primers and auxiliary breeding methods for the KASP marker. This method first uses genome-wide association analysis to obtain SNPs functionally related to the salt tolerance gene. Then, the SNPs are converted into KASP markers for verification. These markers are then used to amplify the materials to be identified. Based on the genotype, the allelic variations in salt tolerance of the samples are determined, thereby achieving rapid identification of pea salt tolerance genotypes and improving breeding efficiency.

[0005] This invention locates the salt-tolerant major gene PsCIPK2 through GWAS analysis and develops the KASP molecular marker based on the functional missense mutation in its coding region, which can realize rapid and accurate identification of pea salt tolerance and provide a core tool for salt-tolerant pea breeding.

[0006] To achieve the above objectives, the present invention provides the following technical solution: 1. This invention first constructed a core pea germplasm population containing 515 accessions, and then identified its salt tolerance phenotype and genotype. The salt tolerance phenotype was determined in Hangzhou in 2024 using a randomized block design, with three replicates per accession. Peas grown for four weeks were subjected to a 7-day stress of 300 mM NaCl. Plant height, fresh weight, dry weight stress / control ratios, and leaf yellowing were used as indicators of salt tolerance, ultimately obtaining phenotypic data on salt tolerance. Genome-wide association analysis was performed using an EMMAX mixed linear model, and a highly significant association locus was found on chromosome 5 (P = 2.42 × 10⁻⁶). -8 The gene identified was PsCIPK2 (Pisum_027879).

[0007] KASP molecular markers were designed based on the SNP sites at 337,817,277 bp on chromosome 5 of the Zhewan-1 reference genome.

[0008] As some optional embodiments of this application, the nucleotide sequence of the SNP site is shown in SEQ ID No. 1.

[0009] As some alternative embodiments of this application, the SNP site is located at the 101st base of the nucleotide sequence shown in SEQ ID No. 1.

[0010] The molecular marker is of type KASP, and its sequence is shown in SEQ ID No. 1, where nucleotide 101 is a T / G polymorphic site. CTCGAAGATGGGAGACATTGCTAAGCAACTGAGGATGAAAATTAAGAAAAAAGCTGCTGGTTTGCTGAAATTGGAGGGATTGAATGAAGGTAGGAAAGGG[T / G]TTTTATCGATTGATGCAGAGATCTTCGAGGTTACTCCTAACTTCCATTTAGTTGAGGTGAAAAAATCAAATGGAGATACATTAGAATATCAAAAAAATTCT; SEQ ID No: 1.

[0011] 2. The KASP primers for detecting the molecular marker shown in SEQ ID No. 1 consist of a specific forward primer Primer1, a specific forward primer Primer2, and a universal reverse primer, with the following specific sequence: CIPK2_337,817,277 KASP primers: CIPK2_337,817,277 Primer1: 5'-GAATGAAGGTAGGAAAGGGT-3'; SEQ ID No: 2; CIPK2_337,817,277 Primer2: 5'-GAATGAAGGTAGGAAAGGGG-3'; SEQ ID No: 3; CIPK2_337,817,277 Primer1 and CIPK2_337,817,277 Primer2 are two specific primers, each linked to a different fluorescent group; Furthermore, the fluorescent group is selected from FAM, TET, HEX, BHQ, FIFC, TAMRA, or JOE.

[0012] CIPK2_337,817,277Primer_Common: 5'-TGTATCTCCATTTGATTTTTTCACCTC-3'; SEQ ID No: 4.

[0013] Furthermore, CIPK2_337,817,277 Primer1 is linked to the FAM group, and CIPK2_337,817,277 Primer2 is linked to the HEX group.

[0014] KASP: Competitive allele-specific PCR.

[0015] 3. The present invention also provides a kit comprising CIPK2_337,817,277 Primer1, CIPK2_337,817,277 Primer2 and / or CIPK2_337,817,277 Primer_Common primers.

[0016] 4. Application of the KASP primers and kits containing KASP primers described above in the identification of salt-tolerant genotypes in peas or in molecular marker-assisted breeding of salt-tolerant pea varieties.

[0017] 5. A method for breeding salt-tolerant pea varieties using KASP primers, which are functional molecular markers of the major pea salt tolerance gene. The method specifically includes the following steps: S1. Extract genomic DNA from pea plant samples; S2. Using the DNA extracted in S1 as a template, KASP reaction amplification is performed using the KASP primers described in this invention; The KASP primer sequences are shown in SEQ ID No. 2 to SEQ ID No. 4.

[0018] S3. Read the fluorescence signal detected by the KASP reaction. If the genomic DNA of the plant sample shows a single fluorescence signal carried by the specific forward primer Primer1, the sample can be identified as a salt-tolerant homozygous genotype T / T. If the genomic DNA of the plant sample shows a single fluorescence signal carried by the specific forward primer Primer2, the sample can be identified as a salt-sensitive homozygous genotype G / G. When both Primer1 and Primer2 show fluorescence signals simultaneously, the pea germplasm is identified as a heterozygous T / G genotype. The salt tolerance of this genotype is between that of T / T homozygous salt-tolerant pea lines and G / G homozygous sensitive pea lines, and it can be used as an intermediate hybridization material for salt tolerance breeding.

[0019] Furthermore, in the method of breeding pea varieties with different salt tolerance, Primer1 is connected to the FAM group and Primer2 is connected to the HEX group; the FAM signal is T / T (salt-tolerant homozygous genotype) and the HEX signal is G / G (salt-sensitive homozygous genotype).

[0020] Furthermore, in the method for breeding pea varieties with different salt tolerance, the KASP reaction detection also includes the 2X KASPMaster Mix reagent.

[0021] Furthermore, in the method for breeding pea varieties with different salt tolerance, the total volume of the KASP reaction system is 10 μl, which contains 2.0 μl template DNA (10–50 ng), 5.0 μl 2× KASP Master Mix, 0.2 μl primer mixture (10 μM), and the remainder is made up with ddH2O.

[0022] Furthermore, in the method for breeding pea varieties with different salt tolerance, the PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ in each cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.

[0023] The beneficial effects of this invention are as follows: This invention provides a SNP site PsCIPK2 that is related to the function of the major gene for salt tolerance in peas. _A T / G polymorphism exists at chromosome 5 (337,817,277 bp) in the genome of the pea variety Zhewan No. 1 (Zhewan No. 1). Further research developed a related KASP marker for validation, and this marker was used to amplify materials requiring identification. Favorable allelic variations were determined based on the T / G genotype. Peas carrying the salt-tolerant allele T (HapI) showed significantly higher salt tolerance compared to plants carrying the allele G (HapII). Haplotype I carrying the salt-tolerant allele T can serve as a molecular marker. The development and utilization of this marker will provide strong technical support for marker-assisted breeding of pea salt tolerance, offering a rapid, reliable, and practical molecular tool and detection method for genetic improvement of salt tolerance traits or precise selection of salt-tolerant varieties. This research, aimed at breeding new pea varieties with salt tolerance, provides new insights for addressing planting in saline-alkali soils and is of great significance for ensuring food security. Attached Figure Description

[0024] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 KASP marker typing diagram for genes associated with CIPK2_337,817,277 marker sites.

[0025] Figure 2 Salt tolerance differences at CIPK2_337,817,277 marker sites. Detailed Implementation

[0026] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0027] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions or as recommended by the manufacturer.

[0028] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0029] Example 1: This invention first constructed a salt tolerance evaluation population containing 515 core pea germplasm accessions (statistical data of some core germplasm and salt treatment phenotypes are shown in Table 1). The core germplasm population includes germplasm resources obtained through public channels (including improved varieties, local varieties, and wild germplasm preserved in domestic and international gene banks) and commercially available varieties, covering various uses such as vegetable peas, grain peas, and dual-purpose peas (vegetable and seed peas), exhibiting broad genetic diversity. Subsequently, salt tolerance phenotypes and genotypes were identified. Salt tolerance phenotypes were determined in Hangzhou in 2024 using a randomized block design, with three replicates per material. Peas grown for four weeks were subjected to a 7-day stress of 300 mM NaCl. Plant height, fresh weight, dry weight stress / control ratios, and leaf wilting were used as salt tolerance indicators to obtain the final salt tolerance phenotypic data. Genome-wide association analysis was performed using an EMMAX mixed linear model, and a highly significant association locus was obtained on chromosome 5 (P = 2.42 × 10⁻⁶). -8 ), locked gene is PsCIPK2 (Pisum_027879).

[0030] Table 1. Statistical data of some core germplasm and salt treatment phenotypes This site is an SNP mutation: CIPK2_337,817,277, located on chromosome 5 of the ZW1 reference genome (PRJNA1042956) at 337,817,277 bp. The polymorphism is T / G, belonging to nucleotide 1177 of the CDS of the PsCIPK2 gene, causing a missense mutation: c.1177T>G, p.Phe393Val.

[0031] A KASP molecular marker was designed based on this SNP site. The sequence variation of this molecular marker in the population is as follows: CTCGAAGATGGGAGACATTGCTAAGCAACTGAGGATGAAAATTAAGAAAAAAGCTGCTGGTTTGCTGAAATTGGAGGGATTGAATGAAGGTAGGAAAGGG[T / G]TTTTATCGATTGATGCAGAGATCTTCGAGGTTACTCCTAACTTCCATTTAGTTGAGGTGAAAAAATCAAATGGAGATACATTAGAATATCAAAAAAATTCT; SEQ ID No: 1.

[0032] The 101st position is an SNP site with a polymorphism of T or G.

[0033] Furthermore, this sequence was used to design KASP primers for CIPK2_337,817,277, including two specific primers and one universal primer. The primer sequences are as follows: CIPK2_337,817,277 KASP primers: CIPK2_337,817,277 Primer1: 5'-GAATGAAGGTAGGAAAGGGT-3'; SEQ ID No: 2; CIPK2_337,817,277 Primer2: 5'-GAATGAAGGTAGGAAAGGGG-3'; SEQ ID No: 3; CIPK2_337,817,277 Primer1 and CIPK2_337,817,277 Primer2 are two specific primers, each linked to a different fluorescent group; CIPK2_337,817,277 Primer1 is linked to the FAM group, and CIPK2_337,817,277 Primer2 is linked to the HEX group.

[0034] CIPK2_337,817,277 Primer_Common: 5'-TGTATCTCCATTTGATTTTTTCACCTC-3'; SEQ ID No: 4.

[0035] Example 2 Verification In this embodiment, 65 independent pea germplasm accessions were randomly selected from the Vegetable Research Institute of Zhejiang Academy of Agricultural Sciences.

[0036] Salt tolerance phenotypic identification was performed on 65 randomly selected pea germplasm accessions. Salt treatment was conducted using a soil culture method. Two-week-old pea seedlings were treated with 200 mL of 300 mM NaCl for 7 days, and then their fresh weight, dry weight, and leaf yellowing degree were measured to obtain a comprehensive salt tolerance score. Each germplasm accession was used as a control group before salt stress treatment. The comprehensive salt tolerance score was obtained by summing the scores of three salt stress phenotypic indicators: fresh weight (0–2 points), dry weight (0–2 points), and leaf yellowing degree (0–2 points). The scoring rules for each individual indicator were as follows: 2 points for no significant difference in phenotypic value compared with the control under salt treatment, 1 point for moderate suppression of phenotypic value, and 0 points for severe suppression or loss of phenotypic value. The comprehensive score ranged from 0 to 6 points, with higher scores indicating stronger salt tolerance, and a maximum score of 6 points corresponding to the highest salt tolerance level.

[0037] Genomic DNA was extracted from pea seedlings using the CTAB method, and KASP analysis was performed using the IntelliQube genotyping platform. The total volume of the PCR reaction system was 10 μl, containing 2.0 μl template DNA (10–50 ng), 5.0 μl 2× KASP MasterMix, 0.2 μl primer mixture (10 μM), and the remainder was made up with ddH2O. The primer mixture was composed of equimolar amounts of allele-specific primers CIPK2_337,817,277 Primer1 and CIPK2_337,817,277 Primer2, and universal primer CIPK2_337,817,277 Primer_Common. The concentration of each primer in the mixture was 3.33 μM, and the final reaction concentration was 100 nM. The PCR reaction program for KASP reaction detection is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ per cycle, extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.

[0038] Analysis results as follows Figure 1 As shown in the diagram. When the fluorescence signal is red (FAM signal), it indicates that the pea carries the salt-tolerant allele T (HapI). When the fluorescence signal is blue (HEX signal), it indicates that the pea carries the sensitive allele G (HapII). The gray samples in the lower left corner are undetectable samples; the five purple samples in the middle are haplotype samples from Table 2. Figure 1 As shown, the KASP molecular markers of this invention achieved highly consistent and well-defined population genotyping results in pea populations, with different genotypes clearly distinguishable and clustered, demonstrating good genotyping performance.

[0039] Based on its salt tolerance performance (see...) Figure 2 (Table 2 shows the statistical analysis of the genotypes and salt tolerance scores of some selected germplasm at the selected SNP site). This verified that lines carrying the T / T genotype at this SNP site had a higher average salt tolerance score and better salt tolerance; while lines carrying the G / G genotype had a relatively lower average salt tolerance score and poorer salt tolerance. Data analysis showed that the average salt tolerance of lines carrying the T / T genotype was significantly higher than that of the G / G genotype (p = 1.87 × 10⁻⁶). -8 This study confirmed that the marker can effectively distinguish differences in salt tolerance in peas, ultimately achieving the goal of molecular marker screening.

[0040] Table 2. Statistical data of genotypes and salt treatment phenotypes of selected germplasm. Note: The comprehensive salt tolerance score is the sum of three salt tolerance phenotypic scores: fresh weight (0-2 points), dry weight (0-2 points), and leaf yellowing (0-2 points).

[0041] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made to the present invention should be included within the scope of protection of the present invention.

Claims

1. A molecular marker for PsCIPK2, a major gene associated with salt tolerance in peas, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1, where position 101 is an SNP site with a polymorphism of T or G.

2. The method for detecting the KASP primers containing the molecular marker described in claim 1, characterized in that, The KASP primers consist of a specific forward primer Primer1, a specific forward primer Primer2, and a universal reverse primer; the nucleotide sequence of the specific forward primer Primer1 is shown in SEQ ID No.2, the nucleotide sequence of the specific forward primer Primer2 is shown in SEQ ID No.3, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID No.

4. Among them, the specific forward primer Primer1 and the specific forward primer Primer2 are connected to different fluorescent groups.

3. The KASP primer according to claim 2, characterized in that, The specific forward primer Primer1 is linked to the FAM fluorescent group, and the specific forward primer Primer2 is linked to the HEX fluorescent group.

4. A reagent kit, characterized in that, The kit contains the KASP primers as described in claim 2 or 3.

5. The application of the KASP primers of claim 2 or 3, or the kit of claim 4, in the breeding of salt-tolerant pea varieties.

6. A method for breeding salt-tolerant pea varieties using the KASP primers described in claim 2 or 3, characterized in that, The method specifically includes the following steps: S1. Extract genomic DNA from pea plant samples; S2. Using the DNA extracted in step S1 as a template, perform KASP reaction detection using the KASP primers; S3. Read the fluorescence signal detected by the KASP reaction. The genotyping result is one of the following three: 1) Only a single fluorescent signal carried by the specific forward primer Primer1 was detected: the sample was a salt-tolerant homozygous T / T genotype; 2) Only a single fluorescent signal carried by the specific forward primer Primer2 was detected: the sample was a salt-sensitive homozygous genotype G / G; 3) Simultaneous detection of fluorescence signals carried by Primer1 and Primer2: The sample is heterozygous genotype T / G, with moderate salt tolerance.

7. The method according to claim 6, characterized in that, Primer1 is attached to the FAM group, and Primer2 is attached to the HEX group.

8. The method according to claim 7, characterized in that, The KASP reaction assay also includes 2×KASP Master Mix reagent.

9. The method according to claim 8, characterized in that, The total volume of the KASP reaction system is 10 μl, which contains 2.0 μl of template DNA, 5.0 μl of 2× KASP Master Mix, 0.2 μl of primer mixture, and the remainder is made up with ddH2O.

10. The method according to claim 6, characterized in that, The KASP reaction assay procedure is as follows: pre-denaturation at 94℃ for 15 minutes, denaturation at 94℃ for 20 seconds, gradient annealing at 61~55℃ for 60 seconds, with the annealing temperature decreasing by 0.6℃ for each cycle, followed by an extension at 55℃ for 60 seconds, for 10 cycles; then denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, extension for 60 seconds, for 26 cycles.

Images