Identification of SV molecular markers of Auricularia polytricha No.3 and their application

Abstract

This invention discloses the SV molecular marker for identifying Auricularia auricula-judae 'Zhongnong'er 3' and its application, belonging to the field of edible fungi strain identification technology. Addressing the problems of long identification cycles, low accuracy, and difficulties in variety protection for Auricularia auricula-judae strains, this invention provides a primer pair of SV molecular markers for identifying Zhongnong'er 3. Using this primer pair as amplification primers, PCR amplification is performed using the genomic DNA of the Auricularia auricula-judae sample as a template. The amplification products are then detected by electrophoresis. Based on the electrophoresis results, if two specific bands appear in the amplification product, the sample is identified as strain Zhongnong'er 3. The specific primer pair provided by this invention is mainly used for rapid strain identification and variety protection of Auricularia auricula-judae 'Zhongnong'er 3', achieving accurate identification results within 3 hours. This effectively solves the problem of traditional fruiting experiments taking 3-4 months and relying on subjective experience, providing a reliable molecular detection tool for the intellectual property protection and industrial promotion of superior strains.

Description

Technical Field

[0001] This invention belongs to the field of edible fungi strain identification technology, and relates to an SV molecular marker for identifying Auricularia auricula-judae 'Zhongnong'er 3' and its application. Background Technology

[0002] Auricularia cornea is an important cultivated fungus for food and medicine in my country. Its fruiting body has a unique taste and excellent flavor. It is rich in protein, essential amino acids, vitamins and polysaccharides, as well as other nutrients and active ingredients. Modern research has confirmed that its polysaccharides and other functional components have antioxidant and immunomodulatory effects. It has outstanding food and medicinal value and broad market application and development prospects. my country has a wide cultivation area and a solid industrial foundation for Auricularia auricula-judae, with Sichuan Province ranking among the top in terms of industry scale as a core production area. However, the core bottleneck for the current development of the industry is the scarcity of high-quality germplasm resources. The strains used in production are mostly traditional self-saved strains and old domesticated varieties, which have not been systematically selected and targeted for improvement. They generally suffer from problems such as germplasm degradation and unstable genetic traits, making it difficult to achieve high yield, high quality, and strong resistance to adverse conditions. This germplasm defect makes the cultivation process susceptible to interference from external factors such as climate, environment, and pests and diseases, resulting in large fluctuations in yield, uneven fruiting body quality, and low yield of good products. This restricts the standardized and high-quality development of Auricularia auricula-judae. Therefore, breeding new varieties of Auricularia auricula-judae with stable traits, high yield, high quality, and excellent resistance to adverse conditions is the core need to solve the current pain points of the industry.

[0003] Zhongnong'er No. 3 (Ap008) was obtained on March 20, 2016, in Taiping Village, Lingui District, Guilin City, Guangxi Zhuang Autonomous Region (110.17°E, 25.17°N). A single, reddish-brown, 6–8 cm diameter wild Auricularia auricula-judae strain was collected from the trunk of a Quercus glauca tree. After tissue isolation and purification, a wild Auricularia auricula-judae strain was obtained. From 2016 to 2018, through cultivation, domestication, targeted selection, and re-screening, a strain with rapid mycelial consumption, early primordia appearance, excellent fruiting body characteristics, high yield, and strong resistance was obtained.

[0004] With the rapid advancement of high-throughput sequencing technology, especially the widespread application of long-read sequencing, powerful tools have been provided for analyzing large-scale genomic variations. Structural variation (SV) molecular marker technology is a molecular marker technique based on whole-genome resequencing or de novo assembly to systematically identify insertions, deletions, inversions, translocations, and copy number variations in large sequence fragments (50 bp or more) within the genome. Simply put, this technology directly identifies large DNA regions with differences in length or location by comparing the genomic sequences of different individuals, and develops molecular markers that can specifically detect these variations. Polymorphism in samples is ultimately determined by observing different banding patterns or genotype data through primer design for PCR amplification of the target SV site or through sequencing analysis, followed by electrophoresis or bioinformatics analysis. Most SV markers are co-dominant markers, which can reveal far richer genome-level polymorphisms than traditional markers such as SNPs or SSRs. The detection process does not rely on human subjective experience in traditional methods, and can accurately analyze large-scale variations across the entire genome in a single experiment, providing a direct and efficient solution for causal gene localization of important traits. Summary of the Invention

[0005] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0006] To address the problems of long identification cycles, low accuracy, and difficulties in variety protection of Auricularia auricula-judae strains, this invention provides a rapid, specific, and stable method for identifying the SV molecular marker of Auricularia auricula-judae 3 (variety identification number: Chuanrenjun 2025012, hereinafter also referred to as Ap008). To this end, the present invention provides the following technical solution:

[0007] The SV molecular marker for identifying Auricularia auricula-judae 'Zhongnong'er 3' was determined, and its nucleotide sequence is shown in SEQ ID NO:1. The molecular marker type is insertion (underlined part), and 'Zhongnong'er 3' exhibits a heterozygous insertion.

[0008] SEQ ID NO:1 (5'-3')

[0009] TTTGGCCAGGGTTTTGTTAACCCATTGGAAACCAGCACTGTTGTACTGTCG GGATAGAGCATCAGTGAT GTAGATTTGGTTCCGGTTCATCATTCAGTCTTTTCTCTCTTCCCATCACCTCGGGCAGCCAGGAGGCCGCCGCATCGCCTCCCTGAGGAGTTCATGGAGCTTCCGCTTGAAGTCTCCACGCTGCTCCTCAACCTCATCAGCCTCCATGGGCTCCTGTGAGGGAGTGGATGATGTGGATGATGTGCCATCGTCATCAATGACCATCTCCTCGTCCTGTGGCTGCCA

[0010] A specific primer pair for identifying Auricularia auricula-judae No. 3, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0011] A kit for identifying Auricularia auricula-judae No. 3, comprising the aforementioned specific primer pair.

[0012] A method for identifying Auricularia auricula-judae No. 3 includes the following steps:

[0013] a) Extract genomic DNA from the Auricularia auricula strain to be tested;

[0014] b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction;

[0015] c) The PCR amplification products obtained in step b) are detected by agarose gel electrophoresis;

[0016] d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample to be tested is determined to be strain Zhongnong'er 3; if one band appears in the amplification product, the strain to be tested is not Zhongnong'er 3 (Ap008).

[0017] Preferably, in the method for identifying Auricularia auricula-judae No. 3, the PCR amplification reaction procedure in step b) is as follows: pre-denaturation at 95°C for 3-5 minutes; 30-35 cycles, each cycle including denaturation at 95°C for 10-30 seconds, annealing at 55°C for 10-30 seconds, extension at 72°C for 20-40 seconds; and finally extension at 72°C for 3-8 minutes.

[0018] Preferably, in the method for identifying Auricularia auricula-judae No. 3, the PCR amplification reaction procedure is as follows: preheating at 95°C for 3 minutes; then performing 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and finally extending at 72°C for 5 minutes.

[0019] Preferably, in the method for identifying Auricularia auricula-judae No. 3, the electrophoretic detection in step c) is performed using an agarose gel with a concentration of 2% to 3%, electrophoresed at 80 to 120V for 50 to 70 minutes, with a current of 70 to 90mA.

[0020] The application of the specific primer pair or the kit in the identification of Auricularia auricula-judae strain Zhongnong'er 3 is based on the electrophoresis results: if two specific bands appear in the amplification product, the sample to be tested is determined to be strain Zhongnong'er 3.

[0021] The present invention has at least the following beneficial effects:

[0022] The test samples of Auricularia auricula were identified using the special primers provided by this invention. The results showed that only the PCR amplification product of Ap008 showed a specific band, while the PCR amplification products of other Auricularia auricula did not show specific bands. This indicates that the primers designed by this invention can amplify and distinguish the specific gene fragment of Ap008.

[0023] Therefore, the dedicated primers provided by this invention can be applied to the rapid identification and detection of Ap008. These primers not only provide more accurate identification results than conventional morphological methods, but also offer shorter detection times and higher accuracy compared to other detection methods. The detection time is only 3 hours, while the fruiting experiment requires 3-4 months.

[0024] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0025] Figure 1 This is an agarose gel electrophoresis result from one embodiment of the present invention. Detailed Implementation

[0026] The present invention will now be described in further detail so that those skilled in the art can implement it based on the description.

[0027] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0028] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0029] This invention uses published Auricularia auricula-judae genome data as a reference and employs high-throughput sequencing technology to obtain the whole genome data of the strain to be tested. Based on the reference genome, a set of specific primers were designed and synthesized to establish a method for specific identification of Auricularia auricula-judae Ap008. The effectiveness of the established method was evaluated through an experiment.

[0030] To achieve the aforementioned objectives, this invention employs high-throughput sequencing technology to sequence the tested *Auricularia auricula-judae* strains. By comparing the sequences of these strains with a reference genome, a specific molecular marker was identified, as shown in SEQ ID NO: 1. Primers were developed using this specific molecular marker to perform PCR amplification on total DNA extracted from different *Auricularia auricula-judae* strains. The PCR products were then subjected to agarose gel electrophoresis to identify a specific band that could be used to specifically identify Ap008.

[0031] Specific SV molecular marker SEQ ID NO:1 (5'-3'), underlined to indicate a unique heterozygous insertion of Ap008:

[0032] TTTGGCCAGGGTTTTGTTAACCCATTGGAAACCAGCACTGTTGTACTGTCG GGATAGAGCATCAGTGAT GTAGATTTGGTTCCGGTTCATCATTCAGTCTTTTCTCTCTTCCCATCACCTCGGGCAGCCAGGAGGCCGCCGCAT CGCCTCCCTGAGGAGTTCATGGAGCTTCCGCTTGAAGTCTCCACGCTGCTCCTCAACCTCATCAGCCTCCATGGGCTCCTGTGAGGGAGTGGATGATGTGGATGATGTGCCATCGTCATCAATGACCATCTCCTCGTCCTGTGGCTGCCA

[0033] F: 5'-GTTAACCCATTGGAAACCAG-3' (SEQ ID NO: 2)

[0034] R: 5'-CACATCATCCACATCATCCA-3' (SEQ ID NO: 3)

[0035] According to one embodiment of the present invention, a specific primer pair for identifying *Auricularia auricula-judae* strain 'Zhongnong'er 3' is provided, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. This primer pair for identifying *Auricularia auricula-judae* strain 'Zhongnong'er 3' solves the technical problems of long identification cycles, low accuracy, and difficulty in variety protection of existing *Auricularia auricula-judae* strains. Genomic DNA of the *Auricularia auricula-judae* strain to be tested is extracted, and total DNA is extracted from mycelia or fruiting bodies using a modified CTAB method. Using the extracted genomic DNA as a template, the specific primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 is added for PCR amplification. The PCR amplification reaction program is set to 95℃ pre-denaturation for 3 minutes, followed by 30 cycles, each cycle including 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds, and a final extension at 72℃ for 5 minutes. After amplification, the PCR product is subjected to agarose gel electrophoresis using a 3% agarose gel at 100V for 40 minutes. After electrophoresis, the bands were observed under a UV gel imaging system. If two specific bands appeared in the amplification product, the sample was determined to be strain Zhongnong'er 3; if only one band appeared in the amplification product, the sample was not Zhongnong'er 3.

[0036] This detection method eliminates the need to wait for fruiting; from DNA extraction to obtaining electrophoresis results, it takes only a few hours, while traditional fruiting experiments require months. The primer pair directly detects genomic DNA, providing objective and clear results unaffected by environmental conditions or human experience, thus avoiding subjective errors in morphological identification. This primer pair can also be formulated into a kit for easy application and promotion, providing a reliable molecular tool for detecting the purity of the *Auricularia auricula-judae* cultivar Zhongnong'er 3, screening breeding materials, and protecting market varieties, effectively resolving issues of cultivar mixing and intellectual property disputes.

[0037] According to one embodiment of the present invention, a kit for identifying Auricularia auricula-judae 'Zhongnong'er 3' comprises the aforementioned specific primer pair. The kit contains the specific primer pair, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. This invention integrates the specific primers and matching reagents into one unit, achieving standardization and simplification of the identification process. Users do not need to prepare and optimize the system themselves; they only need to follow the instructions to obtain stable detection results. This kit significantly reduces the operational threshold and experimental errors, improves the consistency of detection results between different laboratories, and facilitates its application in edible fungi production and market supervision departments. It effectively solves the problem of unreliable results caused by inconsistent reagents in traditional methods, providing a convenient and reliable solution for the rapid on-site identification of Auricularia auricula-judae 'Zhongnong'er 3'.

[0038] According to one embodiment of the present invention, a method for identifying Auricularia auricula-judae No. 3 includes the following steps:

[0039] a) Extract genomic DNA from the Auricularia auricula strain to be tested;

[0040] b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction;

[0041] c) The PCR amplification products obtained in step b) are detected by agarose gel electrophoresis;

[0042] d) Identification based on electrophoresis results: If two specific bands appear in the amplified product, the sample is identified as *Auricularia auricula-judae* strain 3. This method includes four steps: extracting genomic DNA from the *Auricularia auricula-judae* strain, performing PCR amplification using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3, detecting the PCR product by agarose gel electrophoresis, and identifying the strain based on the electrophoresis results. This method provides objective and clear results, unaffected by environmental factors or operator subjective experience, and exhibits strong reproducibility. Furthermore, the method is simple to operate, requiring only a conventional PCR instrument and electrophoresis equipment, making it suitable for widespread application in grassroots laboratories and testing institutions. It provides an efficient and reliable molecular identification method for the early screening, purity control, and variety rights protection of *Auricularia auricula-judae* strain 3.

[0043] According to one embodiment of the present invention, preferably, in the method for identifying Auricularia auricula-judae No. 3, the PCR amplification reaction procedure in step b) is as follows: pre-denaturation at 95°C for 3-5 minutes; 30-35 cycles, each cycle including denaturation at 95°C for 10-30 seconds, annealing at 55°C for 10-30 seconds, extension at 72°C for 20-40 seconds; and finally extension at 72°C for 3-8 minutes. This method further defines the PCR amplification reaction procedure as follows: pre-denaturation at 95°C for 3-5 minutes; 30-35 cycles, each cycle including denaturation at 95°C for 10-30 seconds, annealing at 55°C for 10-30 seconds, extension at 72°C for 20-40 seconds; and finally extension at 72°C for 3-8 minutes.

[0044] According to one embodiment of the present invention, preferably, in the method for identifying Auricularia auricula-judae No. 3, the PCR amplification reaction procedure is as follows: preheating at 95°C for 3 minutes; then performing 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and finally extending at 72°C for 5 minutes.

[0045] According to one embodiment of the present invention, preferably, in the method for identifying Auricularia auricula-judae No. 3, the electrophoretic detection in step c) is performed using an agarose gel with a concentration of 2% to 3%, electrophoresed at a voltage of 80 to 120V for 50 to 70 minutes, with a current of 70 to 90mA.

[0046] According to one embodiment of the present invention, the specific primer pair or the kit described herein is applied to the identification of *Auricularia auricula-judae* strain Zhongnong'er 3. Identification is based on electrophoresis results: if two specific bands appear in the amplification product, the sample is determined to be strain Zhongnong'er 3. Directly applying this specific primer pair or kit to the identification of Zhongnong'er 3 provides a highly specific molecular detection scheme. This application does not require sequencing, multiple primer combinations, or complex statistical analysis; a clear determination can be made based solely on the presence or absence of two specific bands using only one PCR and one electrophoresis, achieving rapid qualitative identification of the target strain. This application shortens the identification cycle from several months using traditional methods to several hours, and the results are objective and accurate, unaffected by environmental conditions or operator experience. This application effectively solves the pain point of difficulty in proving Zhongnong'er 3 in variety rights disputes, providing reliable technical support for patent protection of superior strains and combating market counterfeits. It can also be used for batch quality control within strain production enterprises and early screening in the breeding process, possessing significant industrial application value.

[0047] According to one embodiment of the present invention, the present invention provides a method for identifying Ap008. The method of the present invention uses primers developed using the above-mentioned Ap008 specific molecular marker to identify Auricularia auricula-judae. The Ap008 amplification product obtained by PCR should show a specific band after electrophoresis.

[0048] Specifically, the method for identifying Ap008 according to the present invention includes:

[0049] a) Extract total genomic DNA from the strains or fruiting bodies of the Auricularia auricula-judae sample to be tested;

[0050] b) Perform PCR amplification on the extracted total DNA using the primers to obtain PCR amplification products;

[0051] c) Perform agarose gel electrophoresis to specifically identify Ap008.

[0052] The preferred PCR amplification program of this invention is as follows: preheating at 95°C for 3 min; 30 cycles: 95°C for 15 s, 55°C for 15 s, 72°C for 30 s; and a final extension at 72°C for 5 min.

[0053] The preferred electrophoresis procedure of this invention is as follows: 3% agarose, constant voltage mode, 100V, 80mA, 60mins.

[0054] Example 1

[0055] Genomic DNA extraction from Auricularia auricula-judae. After culturing Auricularia auricula-judae mycelia for 8 days, the mycelia were collected, and total DNA was extracted using a modified CTAB method.

[0056] Primer design: Wuhan Hope Group Biotechnology Co., Ltd. performed second-generation genome library construction and sequencing on the *Auricularia auricula-judae* mycelial samples obtained above. After quality control by FastQC software, the sequencing data were compared one by one with the reference genome using BWA (Burrows-WheelerAligner) software. Then, the variant information was screened and filtered using GATK (Genome Analysis Toolkit, 4.2.6.1) software to remove variant sites with low confidence. Finally, the unique heterozygous variant site of Ap008 that distinguishes it from other *Auricularia auricula-judae*, as well as the variant sites of other *Auricularia auricula-judae*, were identified through a script. Primers were developed using the heterozygous insertion SV site at position 2,596,063 of JARLTE010000008.1 in *Auricularia auricula-judae* (GCA_030578095.1).

[0057] F: 5'-GTTAACCCATTGGAAACCAG-3' (SEQ ID NO: 2)

[0058] R: 5'-CACATCATCCACATCATCCA-3' (SEQ ID NO: 3)

[0059] PCR amplification and identification of the fungi to be tested. The fungi to be tested were used to extract total DNA using a modified CTAB method. The extracted total DNA was amplified by PCR using the specific primers designed in Example 1. The PCR amplification system is as follows.

[0060] PCR system: 20 μL 2xMix, 2 μL F primer, 2 μL R primer, 25 μL ddH2O, 1 μL DNA.

[0061] PCR program: Preheat at 95℃ for 3 min; 30 cycles: 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s; final extension at 72℃ for 5 min.

[0062] After 3% agarose gel electrophoresis, the results were analyzed using a gel imaging system. Ap008 exhibited a unique heterozygous insertion, showing two specific bands, while other Auricularia auricula strains only showed one band. Figure 1 As shown, Ap008 can be quickly identified through the simple operation of this invention. Figure 1The strains are as follows: Ap001, strain bred by Zhangzhou Agricultural Science Research Institute, Fujian Province; Ap003, strain bred by Zhangzhou Agricultural Science Research Institute, Fujian Province; Ap005, wild-domesticated strain of Zhangzhou Agricultural Science Research Institute, Fujian Province; Ap007, the main cultivated strain "4328" in Fujian Province; Ap020, strain bred by Zhangzhou Agricultural Science Research Institute, Fujian Province; Ap021, strain "Chuanbai Mushroom No. 6" identified by Sichuan Academy of Agricultural Sciences; Ap025, cultivated strain of Shifang Haoyang Agricultural Development Co., Ltd., Sichuan Province. All of the above-mentioned Auricularia auricula strains are commonly available in this field and can be purchased commercially.

[0063] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. A specific primer pair for identifying Auricularia auricula-judae No. 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

2. A reagent kit for identifying Auricularia auricula-judae No. 3, characterized in that, It includes the specific primer pair as described in claim 1.

3. A method for identifying Auricularia auricula-judae No. 3, characterized in that, Includes the following steps: a) Extract genomic DNA from the Auricularia auricula strain to be tested; b) Using the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 as primers, and the genomic DNA extracted in step a) as a template, perform PCR amplification reaction; c) The PCR amplification products obtained in step b) are detected by agarose gel electrophoresis; d) Identification based on electrophoresis results: If two specific bands appear in the amplification product, the sample to be tested is determined to be strain Zhongnong'er No.

3.

4. The method for identifying Auricularia auricula-judae No. 3 as described in claim 3, characterized in that, The PCR amplification reaction procedure described in step b) is as follows: pre-denaturation at 95°C for 3-5 minutes; 30-35 cycles, each cycle including denaturation at 95°C for 10-30 seconds, annealing at 55°C for 10-30 seconds, extension at 72°C for 20-40 seconds; and final extension at 72°C for 3-8 minutes.

5. The method for identifying Auricularia auricula-judae No. 3 as described in claim 4, characterized in that, The PCR amplification reaction procedure is as follows: preheat at 95°C for 3 minutes; then perform 30 cycles: 95°C for 15 seconds, 55°C for 15 seconds, 72°C for 30 seconds; and finally extend at 72°C for 5 minutes.

6. The method for identifying Auricularia auricula-judae No. 3 as described in claim 3, characterized in that, The electrophoresis detection described in step c) involves using an agarose gel with a concentration of 2% to 3%, electrophoresis at 80 to 120V for 50 to 70 minutes, and a current of 70 to 90mA.

7. The application of the specific primer pair as described in claim 1 or the kit as described in claim 2 in the identification of Auricularia auricula-judae strain Zhongnong'er 3, the identification is based on the electrophoresis results: if two specific bands appear in the amplification product, the sample to be tested is determined to be strain Zhongnong'er 3.

Images