A molecular marker primer pair targeting rice brown planthopper resistance locus qBPH53 and application thereof

Abstract

This invention belongs to the field of agricultural biotechnology and discloses a method for targeting and tracking the resistance sites of rice brown planthopper. qBPH53 Molecular marker primer pairs and their applications. These molecular marker primer pairs are shown in SEQ ID NO.1-2. These primer pairs specifically amplify... qBPH53 Linked fragments with sequence differences near the locus were amplified, producing a 146 bp fragment in brown planthopper-resistant materials and a 158 bp fragment in brown planthopper-susceptible materials. The detection method based on this primer pair can not only rapidly identify resistance loci in germplasm resources but also accurately distinguish between homozygous and heterozygous genotypes in marker-assisted backcross breeding. This method exhibits high specificity, overcomes the amplification instability problem in breeding materials with different genetic backgrounds, and is suitable for large-scale germplasm resource screening and marker-assisted breeding applications.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to molecular marker-assisted breeding technology, and particularly to a method for targeting and tracking resistance loci in rice brown planthoppers. qBPH53 Molecular marker primer pairs, kits containing these primer pairs, and their application in screening rice germplasm resources resistant to brown planthopper and in molecular-assisted breeding. Background Technology

[0002] Brown planthopper ( Nilaparvata lugens Stål is one of the major pests that harm rice production. It seriously affects rice yield and quality by sucking sap from the phloem of rice and spreading grass dwarfing virus.

[0003] As brown planthopper populations continue to evolve, rice varieties carrying known planthopper-resistant genes have gradually lost their resistance. This presents a new challenge to rice breeding—there is an urgent need to discover and utilize germplasm resources containing novel planthopper-resistant loci to maintain the sustained resistance levels of rice varieties.

[0004] Traditional methods for identifying newly discovered resistant materials require hybridization with materials possessing known resistance genes. The segregation rate of the offspring is then observed to determine whether the resistance gene carried is a known gene. This method requires at least 2-3 years of field trials, is labor-intensive, and is significantly affected by environmental conditions, making it difficult to meet the demands of modern, high-efficiency breeding.

[0005] Marker-assisted selection (MAS) technology provides a new technical means for the identification of resistance resources and assisted breeding. However, when most existing molecular markers are applied to breeding materials with different genetic backgrounds, the amplification polymorphism is extremely unstable. When tested in materials containing brown planthopper receptors with different genetic backgrounds or with unknown resistance, non-specific heterogeneous bands are easily generated, causing serious interference and leading to an increased false positive rate; or the target resistance linkage fragment cannot be effectively distinguished from the brown planthopper-associated fragment, making it difficult to accurately distinguish between homozygotes and heterozygotes in backcross progeny.

[0006] Therefore, there is an urgent need to provide a molecular marker primer pair and detection method that is highly specific, unaffected by heterogeneous bands in complex genetic backgrounds, and capable of stably targeting and tracking resistance sites in rice brown planthopper. Summary of the Invention

[0007] The purpose of this invention is to provide a method for targeting and tracking the resistance sites of the rice brown planthopper. qBPH53This study aims to develop molecular marker primer pairs and their applications to address the following technical problems in existing molecular marker technology for rice brown planthopper resistance: unstable amplification polymorphism in breeding materials with different genetic backgrounds, easy generation of heterogeneous bands leading to false positives; and traditional allelic testing methods are time-consuming (2-3 years), labor-intensive, and highly susceptible to environmental interference.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: In a first aspect, the present invention provides a molecular marker primer pair for the resistance site of the rice brown planthopper. qBPH53 In the application of detection, the nucleotide sequence of the forward primer of the molecular marker primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the molecular marker primer pair is shown in SEQ ID NO.2; Specifically, when performing PCR amplification using the aforementioned molecular marker primer pair, if a specific target band of 146 bp is amplified without any non-specific interference, it is determined to be a carrier. qBPH53 Rice materials with resistance sites.

[0009] Secondly, this invention provides a method for identifying brown planthopper resistance sites in rice germplasm resources using the aforementioned molecular marker primer pair. qBPH53 The method includes the following steps: S1) Extract genomic DNA from the rice material to be tested; S2) Using the genomic DNA as a template, PCR amplification was performed using the molecular marker primer pair; S3) Electrophoretic detection of PCR amplification products; S4) Determine whether the test material carries the virus based on the consistency of the electrophoretic band size with the positive control. qBPH53 Resistance site.

[0010] Further, in step S4), if the test sample amplifies a specific target band of 146 bp that is completely consistent with the positive control, and there is no non-specific interference, then the test material is determined to be a carrier. qBPH53 Rice materials with resistance sites.

[0011] Furthermore, in step S4), if the test material only amplifies a specific target band of 146 bp, it is determined to be carrying the target band. qBPH53 Homozygous resistance genotype material at the resistance site; if the test material simultaneously amplifies specific target bands of 146bp and 158bp, it is determined to be a carrier. qBPH53 Heterozygous resistant genotypes of resistance sites; if the test material only shows a 158bp specific target band, it is determined to be a brown planthopper-susceptible rice material.

[0012] Furthermore, the electrophoretic detection in step S2) employs polyacrylamide gel electrophoresis.

[0013] Thirdly, this invention provides a molecular marker-assisted backcross breeding method, comprising the following steps: A1) containing qBPH53 Rice materials with resistance sites were used as donors and hybridized and backcrossed with the rice varieties to be improved to obtain each backcross generation; A2) Extract genomic DNA from individual plants of each backcross generation; A3) PCR amplification and electrophoretic detection were performed using the above molecular marker primer pairs; A4) Screening for carriers based on electrophoresis results qBPH53 Target individual plants with resistance sites.

[0014] Furthermore, in step A4), if the test material only amplifies a specific target band of 146 bp, it is determined to be carrying the target band. qBPH53 Homozygous resistance genotype material at the resistance site; if the test material simultaneously amplifies specific target bands of 146bp and 158bp, it is determined to be a carrier. qBPH53 Heterozygous resistance genotypes at resistance sites.

[0015] Fourthly, the present invention provides a method for detecting resistance sites in rice brown planthoppers. qBPH53 The kit contains the aforementioned molecular marker primer pairs, as well as reaction reagents for PCR amplification.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) High targeting specificity: The molecular marker primer pairs provided by this invention have extremely high specificity, which can overcome the interference of mixed bands caused by the complex genetic background of different test materials, fundamentally reduce the false positive rate and improve the reliability of the identification results.

[0017] (2) High detection efficiency: The method of this invention breaks through the limitation of traditional allelic testing relying on years of hybridization experiments. It can complete the understanding of the resistance details of germplasm resources within half a day, significantly shortening the identification cycle and reducing labor intensity.

[0018] (3) The detection results are intuitive: The method of the present invention can intuitively and quickly distinguish between homozygous genotype and heterozygous genotype, providing reliable technical support for molecular marker-assisted backcross breeding.

[0019] (4) Strong versatility: The primer pairs provided by this invention show stable polymorphism in rice breeding materials with different genetic backgrounds, and are not affected by the genetic background of the recipient material. They are suitable for large-scale germplasm resource screening and assisted breeding applications.

[0020] (5) Low technical threshold and low cost: The method of this invention adopts conventional PCR amplification and polyacrylamide gel electrophoresis technology, which does not rely on high-end precision equipment and is most easily promoted and applied in grassroots agricultural technology departments and scientific research units. Attached Figure Description

[0021] Figure 1 Major gene for rice resistance to brown planthopper qBPH53 Location map on the short arm of chromosome 6.

[0022] Figure 2 This is a graph showing the PCR amplification results of the molecular marker primer pairs of the present invention in parent plants, hybrid offspring, and other lines; in which, the first well is Maker (M), the second well is Z964 (P1), the third well is TKB (P2), and the fourth well and subsequent wells (1-30) are all different rice materials.

[0023] Figure 3 Major gene for rice resistance to brown planthopper qBPH53 Distribution map of extremely nearby linked genetic markers. Detailed Implementation

[0024] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.

[0025] Example 1: Rapid identification of rice germplasm resources resistant to brown planthopper 1. Preparation of test materials: Collect rice materials to be identified, including rice varieties (lines) resistant to brown planthopper and control varieties (lines) susceptible to brown planthopper.

[0026] 2. Genomic DNA extraction: Genomic DNA was extracted from seedlings of each test material using the conventional CTAB method. The DNA concentration was adjusted to 50–100 ng / μL, and the 260 / 280 value was between 1.8 and 2.0.

[0027] 3. PCR amplification reaction Using genomic DNA as a template, PCR amplification was performed using the following primer pairs: Forward primer SEQ ID NO.1 (GAAGCCTCGACTGATCCAGAAAT); Reverse primer SEQ ID NO.2 (GTCCTCTTCTCCAACCCTAGC).

[0028] The PCR reaction system is shown in Table 1, and the PCR amplification procedure is shown in Table 2. The amplification products were then subjected to polyacrylamide gel electrophoresis (PAGE) for detection.

[0029] Table 1

[0030] Table 2

[0031] 5. Result Determination according to qBPH53 This specific primer pair was designed based on genomic sequence differences near the resistance site and its actual physical location. Figure 3 When determining the result, the positive control amplified by the primer pair (known to contain) is used. qBPH53 The band of the resistance donor at the site is the only reference.

[0032] The specific judgment criteria are as follows: (1) If the test material only amplifies a specific target band of 146 bp, it is determined to be a carrier. qBPH53 Homozygous resistance genotype material at the resistance site; if the test material simultaneously amplifies specific target bands of 146bp and 158bp, it is determined to be a carrier. qBPH53 Heterozygous resistant genotypes at resistance sites; if the tested material only shows a 158bp specific target band, it is determined to be a brown planthopper-susceptible rice material. Figure 2 ).

[0033] (2) If the amplification band of the sample to be tested is completely consistent with the positive control band corresponding to the primer (same size, no extra bands), it directly proves that the brown planthopper resistance of the material is due to qBPH53 Site contribution; if the amplified band is inconsistent with the positive control (e.g., different band size or only nonspecific bands appear), it indicates that the material contains other resistance mechanisms, rather than... qBPH53 This breaks through the bottleneck of traditional equivalence testing, enabling a rapid understanding of the resistance "details" of various quality resources.

[0034] Example 2: Validation of molecular marker primer pairs 1. Materials Negative varieties: The brown planthopper-susceptible varieties TKB, TN1, 9311, and Nipponbare are all rice materials preserved in our laboratory, totaling 30 samples.

[0035] Positive varieties: Insect-resistant families among the offspring of the brown planthopper-resistant rice materials Z964 and TKB × Z964 hybrid combinations, totaling 75.

[0036] 2. Method Genomic DNA was extracted from rice leaves using the CTAB extraction method, and the extracted sample DNA was amplified using the primer pair described in Example 1 (method as in Example 1).

[0037] The results showed that ( Figure 2In positive samples, the corresponding 146 bp fragments were amplified, while in negative samples, these fragments were not amplified. This indicates that the molecular marker method provided by this invention can accurately screen for major genes containing resistance to brown planthoppers, predict the resistance of rice plants to brown planthoppers, and greatly accelerate the selection process of brown planthopper-resistant rice materials.

[0038] Example 3: Molecular marker-assisted backcross breeding by qBPH53 The specific steps for marker-assisted backcross breeding of site donors and high-yielding, susceptible brown planthopper recipients are as follows: 1. Hybridization and backcrossing: using [materials]... qBPH53 The resistant material at the locus is used as a donor and crossed with a high-yielding but brown planthopper-susceptible recipient rice to obtain the F1 generation; the F1 generation is then self-crossed or backcrossed with the recipient parent to obtain backcross generations such as BC1F1 and BC2F1.

[0039] 2. DNA detection of individual plants in each generation: Genomic DNA was extracted from individual seedlings in each backcross generation, and PCR amplification and electrophoresis were performed using the primer pairs provided in this invention.

[0040] 3. Genotype Screening: Ignoring polymorphic bands produced by the recipient parent, this method uses only the specific target band as the tracking target to accurately screen for carriers. qBPH53 The superior individual plants can significantly shorten the breeding time.

[0041] 4. Heterozygous / homozygous determination: (1) If electrophoresis only shows a 146 bp target band (without a 158 bp band or non-specific bands), then the single plant is a dominant homozygous brown planthopper resistance genotype. qBPH53 / qBPH53 )Material; (2) If electrophoresis shows both 146bp and 158bp target bands, then the single plant is a heterozygous brown planthopper genotype. qBPH53 / qbph53 )Material; (3) If electrophoresis only shows the target band of 158 bp (without the 146 bp band and non-specific mixed bands), then the single plant is a recessive homozygous brown planthopper susceptible genotype ( qbph53 / qbph53 )Material.

[0042] 5. Backcrossing the target plant to the BC3F1 generation: The selected heterozygous target plants are backcrossed with the recipient parents. After 3-4 generations of backcrossing, they are self-crossed to obtain plants with a genetic background highly similar to the recipient and carrying the same genetic makeup. qBPH53 Improved rice varieties with resistance sites.

Claims

1. A molecular marker primer pair at the resistance site of the rice brown planthopper. qBPH53 Its application in detection is characterized by, The nucleotide sequence of the forward primer of the molecular marker primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer of the molecular marker primer pair is shown in SEQ ID NO.2; Specifically, when performing PCR amplification using the aforementioned molecular marker primer pair, if a specific target band of 146 bp is amplified without any non-specific interference, it is determined to be a carrier. qBPH53 Rice materials with resistance sites.

2. A method for identifying brown planthopper resistance sites in rice germplasm resources using the molecular marker primer pair described in claim 1. qBPH53 The method is characterized by, Includes the following steps: S1) Extract genomic DNA from the rice material to be tested; S2) Using the genomic DNA as a template, PCR amplification was performed using the molecular marker primer pair; S3) Electrophoretic detection of PCR amplification products; S4) Determine whether the test material carries the virus based on the consistency of the electrophoretic band size with the positive control. qBPH53 Resistance site.

3. The method according to claim 2, characterized in that, In step S4), if the test sample amplifies a specific target band of 146 bp that is completely consistent with the positive control, and there is no non-specific interference, then the test material is determined to be a carrier. qBPH53 Rice materials with resistance sites.

4. The method according to claim 3, characterized in that, In step S4), if the test material only amplifies a specific target band of 146 bp, it is determined to be carrying the target band. qBPH53 Homozygous resistance genotype material at the resistance site; if the test material simultaneously amplifies specific target bands of 146bp and 158bp, it is determined to be a carrier. qBPH53 Heterozygous resistance genotypes at resistance sites; If the test material shows only a 158bp specific target band, it is determined to be a rice material susceptible to brown planthopper.

5. The method according to claim 2, characterized in that, The electrophoretic detection in step S3) uses polyacrylamide gel electrophoresis.

6. A molecular marker-assisted backcross breeding method, characterized in that, Includes the following steps: A1) containing qBPH53 Rice materials with resistance sites were used as donors and hybridized and backcrossed with the rice varieties to be improved to obtain each backcross generation; A2) Extract genomic DNA from individual plants of each backcross generation; A3) PCR amplification and electrophoretic detection were performed using the molecular marker primer pair described in claim 1; A4) Screening for carriers based on electrophoresis results qBPH53 Target individual plants with resistance sites; If the test material only amplifies a specific target band of 146 bp, it is determined to be a carrier. qBPH53 Homozygous resistance genotype material at the resistance site; if the test material simultaneously amplifies specific target bands of 146bp and 158bp, it is determined to be a carrier. qBPH53 Heterozygous resistance genotypes at resistance sites.

7. A method for detecting resistance sites in rice brown planthoppers qBPH53 The reagent kit is characterized by, It includes the molecular marker primer pair as described in claim 1, and reaction reagents for PCR amplification.

Images