Use of abscisic acid in plant antiviral

Abstract

The present application relates to the field of biotechnology, and provides application of abscisic acid (ABA) in plant antiviral activity. The ABA provided by the present application can enhance the ability of plants to resist soybean mosaic virus, and can effectively and widely activate the plants to resist the infection of various plant viruses.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the abscisic acid pathway in regulating plant disease resistance. Background Technology

[0002] In my country's major soybean-producing areas, the phenomenon of "stay-green" soybeans is frequent. Typical symptoms include mature soybeans retaining green leaves and stems, empty pods, and missing seeds, resulting in an average yield loss of 20-40%, and in severe cases, complete crop failure. Numerous studies have shown that a novel recombinant plant geminivirus, soybean stay-green geminivirus (SoSGV), is the main cause of this disease. Currently, the pathogenic mechanism of this virus and the plant's resistance strategies remain unknown, necessitating the discovery of novel and effective resistance genes and strategies.

[0003] Plant hormones play a vital role in plant growth, development, and disease and pest resistance, responding to various environmental stresses by participating in complex signaling networks. For example, jasmonic acid (JA) can resist rice stripe virus infection by promoting RNA silencing mechanisms; salicylic acid (SA) can induce systemic resistance in plants and inhibit viral replication and systemic migration.

[0004] Other plant hormones, such as abscisic acid (ABA), have fewer reports on their antiviral effects, and their mechanisms are unclear. ABA plays an important role in plant resistance to abiotic stress, such as regulating drought resistance and senescence. ABA can regulate plant senescence through its receptor PYL and downstream transcription factor ABF; in addition, an important ABA-related transcription factor, ABI3, negatively regulates seed embryo maturation, and the absence of ABI3 leads to vegetative growth in seeds. Vegetative growth is generally considered a physiological phenotype caused by increased chlorophyll content during photosynthesis. In various plants such as Arabidopsis thaliana, barley, rice, and maize, vegetative growth is also considered a drought adaptation trait, revealing its strong relationship with the ABA pathway. Summary of the Invention

[0005] In view of this, the present invention provides an application of abscisic acid (ABA) in plant antiviral activity.

[0006] Furthermore, the virus is soybean scab virus.

[0007] Furthermore, the plant in question is either tobacco or soybean.

[0008] Furthermore, the virus is a Geminiviridae virus.

[0009] Furthermore, the Geminiviridae virus is Tomato Yellow Leaf Curl Virus.

[0010] Furthermore, the plant in question is tobacco.

[0011] Furthermore, the virus is a virus belonging to the Potato Virus Y genus.

[0012] Furthermore, the potato virus Y genus is turnip mosaic virus.

[0013] Furthermore, the potato virus Y genus virus is potato virus X.

[0014] Furthermore, the plant in question is tobacco.

[0015] The ABA provided by this invention can enhance the plant's resistance to soybean cyanosis virus and can activate the plant to effectively and broadly resist the infection of a variety of plant viruses. Attached Figure Description

[0016] Figure 1 A comparison of healthy soybeans and soybeans infected with SoSGV collected in Zhoukou, Henan Province.

[0017] Figure 2 To detect the protein expression levels of ABA receptors GmPYL4 and GmABI3 in healthy and diseased soybeans.

[0018] Figure 3 Detection of ABA content in healthy and diseased soybeans and tobacco.

[0019] The values ​​are the mean ± SEM (n=3) (*P<0.05).

[0020] Figure 4 The expression levels of genes related to the RNA silencing pathway in SoSGV-infected soybeans.

[0021] The values ​​are the mean ± SEM (n=4) (*P<0.05).

[0022] Figure 5 The expression levels of GmABI3 in soybeans were compared with those of vector control and GmABI3 silence.

[0023] The values ​​are the mean ± SEM (n=6) (*P<0.05).

[0024] Figure 6 The results of the editing test on tobacco ABI3 gene-edited materials.

[0025] Figure 7 To detect the toxicity of SoSGV in vector control and silent ABI3 plants after inoculation.

[0026] The values ​​are the mean ± SEM (n=6) (***P<0.001).

[0027] Figure 8 The symptoms of soybeans inoculated with SoSGV after GmABI3 silencing were compared with those of the vector control.

[0028] Figure 9 Tobacco symptoms after SoSGV inoculation following NbABI3 silencing and vector control.

[0029] Figure 10 The expression levels of genes related to the RNA silencing pathway in soybean plants after GmABI3 silencing were shown.

[0030] The values ​​are the mean ± SEM (n=4) (*P<0.05, **P<0.01).

[0031] Figure 11 Symptoms of soybeans inoculated with SoSGV after spraying with water and 200 μM ABA, respectively.

[0032] Figure 12 Tobacco symptoms after spraying with water and 200 μM ABA followed by inoculation with SoSGV.

[0033] Figure 13 The viral titer of SoSGV was detected after soybeans and tobacco were sprayed with water and 200 μM ABA, respectively, and then inoculated.

[0034] The values ​​are the mean ± SEM (n=6) (*P<0.05, **P<0.05, Student's t-test).

[0035] Figure 14 To detect the symptoms of tobacco and the corresponding GFP tag protein levels in patients who were sprayed with water and 200 μM ABA in vitro and then inoculated with PVX.

[0036] Figure 15 To detect the tobacco symptoms and corresponding GFP tag protein levels in patients who were inoculated with TuMV after being sprayed with water or 200 μM ABA in vitro.

[0037] Figure 16 The symptoms of tobacco infection were observed after in vitro spraying with water and 200 μM ABA followed by TYLCV inoculation.

[0038] Figure 17 The corresponding virus titers were detected in plants inoculated with different viruses after water and ABA treatment.

[0039] The values ​​are the mean ± SEM (n=6) (**P<0.01, ***P<0.001). Detailed Implementation

[0040] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0041] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0042] Unless otherwise specified, all materials, reagents, instruments, etc. used in the following examples are commercially available.

[0043] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA.

[0044] In the following examples, the pENTR-3C cloning vector, pBA-YFP plant expression vector, pBA-myc plant expression vector, pGWB435 LUC gene expression vector, pMAL prokaryotic expression vector, and pTRV1 and pTRV2 virus-induced gene silencing VIGS vectors are described in patent application CN201080035446.8 (publication number CN102803496 A).

[0045] The Escherichia coli DH5α, Agrobacterium EHA105, and K599 strains are all products of Biomed Biotechnology Co., Ltd.

[0046] The main reagents in the following examples are:

[0047] Reagents used in molecular cloning: EX Taq DNA polymerase and LA Taq DNA polymerase were products of Takara, restriction endonucleases and T4 DNA ligase were products of NEB, antibiotics used were products of Inolco, 1 Kb DNA marker and 2000bp DNA marker were products of Biomed Biotechnology, and SYBR qPCR Mix was a product of TOYOBO.

[0048] Reagents used in protein-related experiments: Cocktail protease inhibitor was from Roche, IPTG was from Inolco, 40% Acrylamide was from Sigma, soybean PYL4 and ABI3 primary antibodies were from PhytoAB, actin primary antibody was from Wuhan Aiboteke Biotechnology Co., Ltd., GFP primary and secondary antibodies were from Beijing TransGen Biotech Co., Ltd., and pre-stained protein molecular weight markers were from Bio-Easy Biotech Co., Ltd.

[0049] The following kits were used: Plasmid mini-extraction kit, agarose gel DNA recovery kit, and DNA purification and recovery kit were from AxyGen; Plant DNA mini-extraction kit and Plant RNA mini-extraction kit were from Qiagen; Reverse transcription kit was from Beijing TransGen Biotechnology Co., Ltd.; and ECL luminescence solution was from GE Healthcare.

[0050] Other reagents: Abscisic acid (ABA) was purchased from Shanghai Yisheng Biotechnology Co., Ltd., and the abscisic acid ELISA kit was purchased from Beijing Baoruyi Biotechnology Co., Ltd.

[0051] The primers used in the examples were synthesized by Qingke Company, and related sequencing work was performed.

[0052] The amino acid sequence of the GmABI3 protein in the following examples is shown in Sequence 1, and the coding region (CDS) sequence of the GmABI3 gene is shown in Sequence 2.

[0053] The amino acid sequence of the NbABI3 protein in the following examples is shown in Sequence 3, and the coding region (CDS) sequence of the NbABI3 gene is shown in Sequence 4.

[0054] Example 1

[0055] In infected soybeans, the ABA hormone signaling pathway and RNA silencing disease resistance pathway are suppressed.

[0056] I. Field collection of healthy and diseased soybean samples

[0057] Symptoms of bud break were found in soybean cultivar (Glycine max cv Zhoudou) in Zhoukou, Henan Province. Stems, pods, and seeds of both normally mature and bud-breaking soybeans were collected. Figure 1 As shown, place it in liquid nitrogen and bring it back to the laboratory, then store it in a freezer at -80°C.

[0058] II. Western blot detection of ABA signaling pathway receptor protein PYL4 and key transcription factor ABI3

[0059] Healthy and diseased soybean seeds collected from the field were ground into a light-colored powder using liquid nitrogen. Equal amounts of total protein were extracted from each sample, and proteins were separated by electrophoresis using a 10% SDS-PAGE gel. The contents of PYL4 and ABI3 in the healthy and diseased soybean seeds were then detected using antibodies with primary antibodies against Anti-PYL4 and Anti-ABI3, and a secondary antibody against rabbit antibodies. The results are as follows: Figure 2 As shown, the protein content of PYL4 and ABI3 was significantly reduced in infected soybeans. Anti-ACTIN was used as an internal control protein.

[0060] III. Construction of SoSGV Infectious Clones

[0061] 1. Obtaining the full-length viral genome

[0062] Genomic DNA was extracted from the infected soybeans and amplified by PCR using the first pair of upstream primers 1.8A-SoSGV-F1 and downstream primers 1.8A-SoSGV-R1 and the second pair of upstream primers 1.8A-SoSGV-F2 and downstream primers 1.8A-SoSGV-R2, yielding PCR amplification products of approximately 2762 bp and 1998 bp, respectively.

[0063] The primers used are as follows: 1.8A-SoSGV-F1: gagctcggtacccggGGATCCgtgaatgatgtatctattggt; 1.8A-SoSGV-R1: gatacatcattcacctgcagattggtcctg tttat; 1.8A-SoSGV-F2: caatctgcaggtgaatgatgtatctattggt; 1.8A-SoSGV-R2: gccaagcttgcatgcCTGCAGgtgcttatgcaattcgaagg.

[0064] 2. Construction of Infectious Cloning Expression Vectors

[0065] The two viral genome fragments, 2762 bp and 1998 bp, were constructed into the expression vector pCAMBIA1300 via homologous recombination. The specific method was as follows: the pCAMBIA1300 vector was digested with PstI and BamHI. After purification, the two amplified viral genome sequences were added to the homologous recombination reaction system for ligation, and then transformed into *E. coli* DH5α. Positive plasmids were selected based on sequencing results as the final constructed infectious cloning vector.

[0066] IV. SoSGV infection reduces ABA content in soybean and tobacco plants.

[0067] 1. The constructed SoSGV infectious clone was transformed into Agrobacterium EHA105 and K599, and used to infect tobacco and soybean, respectively.

[0068] The tobacco infection method is as follows: EHA105 Agrobacterium containing the SoSGV infectious clone was activated using MMA buffer (10 mM 2-morpholine ethanesulfonic acid hydrate; 10 mM magnesium chloride; 150 mM acetylsuccinone). OD... 600nm The pH was adjusted to 1.5, and the mixture was allowed to stand at room temperature for at least 2 hours. Two to three 3-week-old leaves of *Tobacco Bengal* seedlings were then immersed in the solution using a 1 mL syringe (without the needle). The seedlings were then placed in a 24 ℃ greenhouse for culture. The EHA105 strain, transformed with an empty vector, served as a negative control.

[0069] The soybean infection method is as follows: K599 Agrobacterium containing the SoSGV infectious clone is activated using MMA buffer (10 mM 2-morpholine ethanesulfonic acid hydrate; 10 mM magnesium chloride; 150 mM acetylsuccinone). OD... 600nm Adjust the pH to 1.5 and let it stand at room temperature for at least 2 hours. Cut the soybean hypocotyl at a 45° angle, remove all grown roots, smear the plate-activated Agrobacterium K599 onto the cut surface, place it in soil, and add 5 mL of MMA-buffered saline solution to the roots. Incubate under moist conditions for at least 2 weeks, then incubate at 26°C. Use the same method to inoculate the K599 strain transformed with the empty vector as a negative control.

[0070] 2. Take 200 mg of leaves from control plants and diseased plants, freeze-grind them into powder, add 1 mL of ABA hormone extraction solution (isopropanol:water:hydrochloric acid, 2:1:0.002), and incubate at 4°C for 1 h; add 2 mL of dichloromethane and incubate for 30 min; centrifuge at 18000 g for 15 min at 4°C, collect the lower organic phase, and evaporate it under nitrogen; reconstitute the powder with 200 μl of methanol, centrifuge at 13000 g for 5 min at 4°C, and use the supernatant to determine the ABA hormone content using an ELISA kit. The results are as follows. Figure 3 As shown, the content of ABA hormone in infected soybeans and tobacco was significantly reduced, indicating that viral infection inhibited the ABA signaling pathway in plants.

[0071] V. Soybean leukemia virus infection reduces the expression of RNA-silencing antiviral pathway genes.

[0072] Infected soybean leaves were collected from step four of Example 1. RNA was extracted from the samples using a plant RNA low-dose extraction kit, and cDNA was synthesized via reverse transcription. Subsequently, quantitative real-time PCR was used to detect genes related to the RNA silencing pathway. The primer sequences are shown in Table 1.

[0073] Table 1. Primer sequence listing for detection

[0074] GmAGO1-qF AGTGGCCTTGTCTGCAAGTT GmAGO1-qR TGATCCCAAATTCTTTGGCATA GmAGO2-qF ACAGTGGCAACCAAGGTCAA GmAGO2-qR ACGGAGATAGCACTTTCGCA GmAGO4-qF GCTCCGACCAGGGTCAA GmAGO4-qR GAGACTGGGTACGGACGCTA GmAGO5-qF CAAATATGCCACCCTCGGGA GmAGO5-qR GAAGGCAGCCAAATGTGCAT GmAGO7-qF ATCATCCTGGACCTAGGCGCAATG GmAGO7-qR AGGGAAACAACCTTGTGTGATGCC GmDCL1-qF CTTCTGAAATGCCAACTGTCAGAG GmDCL1-qR ACCTTGCCATCAGCCACA GmDCL2a-qF AAGCTCCATCCCATCCGAGA GmDCL2a-qR TATGAGCACCGCCATCCTTC GmDCL3-qF GGAACACTATAGCTGTGTTGG GmDCL3-qR GATTGACAAGATGAACTGTGGG GmDCL4-qF GGAAGATTGCAAGAAGGTATCAG GmDCL4-qR TAAAGCCACAGTGGGAGCAA GmACTIN11-qF ATCTTGACTGAGCGTGGTTATTCC GmACTIN11-qR GCTGGTCCTGGCTGTCTCC

[0075] The results are as follows Figure 4 As shown, compared with control plants, the expression of genes related to the RNA silencing pathway was significantly downregulated in plants infected with SoSGV, indicating that the virus inhibited the RNA silencing disease resistance pathway and promoted viral infection.

[0076] Example 2

[0077] Gene silencing in soybean (GmABI3) and gene knockout in tobacco (NbABI3) increase susceptibility to Soybean blast disease pathogen SoSGV.

[0078] I. Construction of gene silencing vectors for soybean GmABI3 and tobacco NbABI3

[0079] 1. Preparation of the target fragment

[0080] Using soybean leaf cDNA as a template, PCR amplification was performed using upstream and downstream primers, yielding a 639 bp band of the target fragment. Upstream primer sTRV2-GmABI3-F (XbaI): taaggttaccgaattctctagaATGGAAGATGAACACACTTTGGC; Downstream primer sTRV2-GmABI3-R (BamHI): gtgagctcggtaccggatccACCTTCTTCATCTCCTTGGATCT.

[0081] The amino acid sequence of soybean GmABI3 is shown in SEQ ID NO.1 in the sequence listing.

[0082] Using tobacco leaf cDNA as a template, PCR amplification was performed using upstream and downstream primers, yielding a 913 bp band of the target fragment. Upstream primer sTRV2-NbABI3-F (XbaI): taaggttaccgaattctctagaATGAAAAGAGGATTAGAGTATCATG; Downstream primer sTRV2-NbABI3-R (BamHI): gtgagctcggtaccggatccGCAGTTGGTATTGTTCAACCCA.

[0083] The amino acid sequence of tobacco NbABI3 is shown in SEQ ID NO.3 in the sequence listing.

[0084] 2. Construction of gene silencing vectors psTRV2-GmABI3 and psTRV2-NbABI3

[0085] The soybean GmABI3 DNA fragment and tobacco NbABI3 DNA fragment of the corresponding size obtained above were ligated into the psTRV2 backbone vector digested with XbaI and BamHI by homologous recombination, respectively. The vectors were transformed into E. coli, and single colonies were selected to extract plasmids. After sequencing, the fragments were inserted into the correct plasmid psTRV2-GmABI3 and transformed into Agrobacterium K599. The plasmid psTRV2-NbABI3 was transformed into Agrobacterium EHA105.

[0086] II. Silent soybean GmABI3 and tobacco NbABI3 promote infection of Soybean green scab pathogen SoSGV.

[0087] For soybean gene silencing and SoSGV inoculation, K599 Agrobacterium containing psTRV1, psTRV2-GmABI3, and SoSGV infectious clones was activated, and OD was removed using MMA buffer. 600nm The value was adjusted to 2.0. Using the Agrobacterium soybean infection method described in step four of Example 1, a mixture containing psTRV1, psTRV2-GmABI3, and SoSGV was inoculated at a ratio of 1:1:1.

[0088] For gene silencing in tobacco plants and SoSGV inoculation, activate EHA105 Agrobacterium containing psTRV1, psTRV2-NbABI3, and use MMA buffer to convert OD 600nm The pH was adjusted to 1.5, and tobacco was co-injected at a 1:1 ratio. The mixture was then incubated in a greenhouse for 5 days. After 5 days, *Agrobacterium tumefaciens* EHA105 containing the SoSGV infectious clone was activated, and the OD was adjusted using MMA buffer (10 mM MgCl2, 10 mM MES, 150 μM acetylsyleugenone). 600nm The value was adjusted to 1.5, and SoSGV was administered. Gene silencing efficiency results are as follows: Figure 5 , 6 As shown, ABI3 expression was significantly reduced in gene-silenced plants. The results are as follows... Figure 7 , 8 As shown in Figures 9 and 1, the SoSGV virus titer was significantly increased in gene-silenced plants, and the symptoms of viral infection were more obvious.

[0089] III. Reduced expression of genes related to RNA silencing disease resistance pathways in soybeans with silenced GmABI3.

[0090] Soybean leaves from step two of Example 2, in which GmABI3 was silenced, were collected. RNA was extracted using a plant RNA extraction kit, and cDNA was synthesized via reverse transcription. Subsequently, quantitative real-time PCR was used to detect gene expression in the RNA silencing pathway. The results are as follows: Figure 10 As shown, the expression of RNA silencing pathway genes was significantly reduced in soybean plants where GmABI3 was silenced, indicating that ABI3 positively regulates the RNA silencing antiviral pathway.

[0091] Example 3

[0092] External application of ABA can enhance the plant's resistance to soybean blue virus.

[0093] 1. In vitro treatment of ABA hormone

[0094] Healthy tobacco and soybean plants that have grown for 3 weeks were sprayed with water and 200 μM ABA hormone evenly to form a control group. They were then placed in a greenhouse for cultivation, and after 12 hours, they were inoculated with the virus.

[0095] 2. External application of ABA enhances plant disease resistance and reduces virus titers.

[0096] Following the method described in step four of Example 1, soybean and tobacco plants pretreated with ABA were inoculated with the virus. After the plants developed symptoms, systemic leaves were collected, and DNA was extracted from the samples using the CTAB method. Subsequently, real-time quantitative PCR was performed to detect the virus titer. The detection primer sequences are as follows: SoSGV-qF: ttggattggagacattcactaac; SoSGV-qR: gctagtattgcgatgtggac.

[0097] The results are as follows Figure 11 , 12 As shown in Figure 13: Compared with the negative control of water spraying, the disease symptoms of plants treated with ABA were significantly reduced, with taller plants, less obvious leaf curling due to virus infection, and significantly lower virus titer.

[0098] Example 4

[0099] ABA can activate the broad-spectrum antiviral ability of plants.

[0100] 1. Infectious clones carrying tomato yellow leaf curl virus (TYLCV) were transferred into Agrobacterium EHA105 competent cells by electroporation. The strain was stored in 50% glycerol at -80°C.

[0101] Infectious clones of potato virus X (PVX) labeled with GFP fluorescence were transferred into competent Agrobacterium EHA105 cells by electroporation. The strains were stored in 50% glycerol at -80°C.

[0102] Infectious clones of turnip mosaic virus (TuMV) labeled with GFP were transferred into competent Agrobacterium EHA105 cells by electroporation. The strains were stored in 50% glycerol at -80°C.

[0103] 2. Pretreat tobacco plants with 200 μM ABA hormone for 12 hours according to the method in step one of Example 3.

[0104] 3. Spread the strains containing PVX-GFP, TuMV-GFP, and TYLCV onto solid LB medium containing kanamycin and rifampin, suspend them in MMA buffer, and adjust the OD values ​​accordingly. 600nm Values ​​were adjusted to 1.5, 0.5, and 1.0. Two to three ABA-treated tobacco leaves were soaked in a 1 mL syringe with the needle removed.

[0105] After the plants developed symptoms, photographs were taken to record the data. Leaves infected with PVX and TuMV were collected for protein and RNA extraction, respectively. RNA was synthesized into cDNA using a reverse transcription kit. Leaves infected with TYLCV were collected for DNA extraction. Subsequently, Western blotting was used to detect protein expression levels, and quantitative real-time PCR was used to detect viral titers. The primer sequences used are as follows: PVX-qRT-F: TTGCATACACATGCAGCCGCTAA; PVX-qRT-R: CCTCGGTTCAATGGCAACATT; TuMV-qRT-F: CTATCCAACACACGTTCAAC; TuMV-qRT-R: ACGTCACTGAAATGGGCCAT.

[0106] The results are as follows Figure 14 , 15 As shown in Figures 16 and 17, compared with the control water-treated plants, the plants sprayed with ABA hormone showed significantly milder symptoms after viral infection, including less leaf curling, less viral infection area (less GFP fluorescence), taller plant height, reduced expression of GFP tag protein, and lower viral titer. This indicates that ABA hormone spraying can effectively and broadly resist the infection of various plant viruses.

Claims

1. Application of abscisic acid in plant antiviral activity.

2. The application of abscisic acid in plant antiviral activity according to claim 1, characterized in that, The virus in question is a Geminiviridae virus.

3. The application of abscisic acid in plant antiviral activity according to claim 2, characterized in that, The Geminiviridae virus mentioned is soybean cyanosis virus; The antiviral effect is achieved by increasing gene expression in the plant ABA signaling pathway.

4. The application of abscisic acid in plant antiviral activity according to claim 1, characterized in that, The plant in question is either tobacco or soybean.

5. The application of abscisic acid in plant antiviral activity according to claim 2, characterized in that, The Geminiviridae virus in question is Tomato Yellow Leaf Curl Virus.

6. The application of abscisic acid in plant antiviral activity according to claim 5, characterized in that, The plant in question is tobacco.

7. The application of abscisic acid in plant antiviral activity according to claim 1, characterized in that, The virus in question belongs to the Potato Virus Y genus.

8. The application of abscisic acid in plant antiviral activity according to claim 7, characterized in that, The virus in question belongs to the Potato Virus Y genus and is a turnip mosaic virus.

9. The application of abscisic acid in plant antiviral activity according to claim 7, characterized in that, The potato virus Y genus virus is potato virus X.

10. The application of abscisic acid in plant antiviral activity according to claim 7, characterized in that, The plant in question is tobacco.

Images