Use of phenylpropanoid compounds in the treatment of fever with thrombocytopenia syndrome virus infection

CN122786321APending Publication Date: 2026-09-22ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510330201.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2026-09-22

AI Technical Summary

Technical Problem

截至目前,临床上尚无批准的SFTSV疫苗或特异性抗病毒药物可用

Benefits of technology

[0043] 1) The compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and/or its hydrates can inhibit SFTSV replication at the cellular level, reduce viral nucleic acid load in cell cultures and the production of infective progeny viral particles, inhibit viral protein expression, reduce viremia and viral nucleic acid load in tissues of SFTSV-infected mice, and have a significant protective effect against SFTSV-infected mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122786321A_ABST
    Figure CN122786321A_ABST
Patent Text Reader

Abstract

The present application relates to the use of phenylpropanoid compounds of formula I, derivatives thereof, geometrical isomers thereof, pharmaceutically acceptable solvates thereof and / or hydrates thereof, for the preparation of a medicament for the prevention or treatment of a disease or infection caused by severe fever with thrombocytopenia syndrome virus (SFTSV) in a subject,
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the use of phenylpropanoid compounds of Formula I, their derivatives, their geometric isomers, their pharmaceutically acceptable solvates and / or their hydrates in the preparation of medicaments for the prevention or treatment of diseases or infections caused by febrile thrombocytopenic syndrome virus (SFTSV) in subjects. Background Technology

[0002] Severe fever with thrombocytopenia syndrome virus (SFTSV), also known as Dabie bandavirus (DBV), belongs to the genus Bandavirus of the family Phenuiviridae in the order Bunyavirales. It is a segmented, single-stranded, negative-sense RNA virus. Clinical infection with this virus can cause fever with thrombocytopenia syndrome (SFTS). Considering that this disease may pose a significant public health risk,

[0003] The main clinical manifestations of SFTS include fever accompanied by fatigue, muscle aches, headache, thrombocytopenia, and leukopenia. Severe cases can progress to respiratory failure, circulatory failure, disseminated intravascular coagulation (DIC), and multiple organ failure, leading to death, with a mortality rate as high as 30%. According to the "Diagnosis and Treatment Protocol for Fever with Thrombocytopenia Syndrome" (2023 edition), clinical treatment mainly involves symptomatic support and treatment of complications. Currently, there are no approved SFTSV vaccines or specific antiviral drugs available clinically. Therefore, there is an urgent need to develop safe, effective, and specific novel anti-SFTSV candidate compounds. Summary of the Invention

[0004] The purpose of this invention is to discover compounds with anti-SFTSV activity that can be used to treat diseases caused by SFTSV infection, such as acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and thrombocytopenia, multi-organ hemorrhage, disseminated intravascular coagulation (DIC), and viral encephalitis. Through inventive research, this invention has discovered that the compound represented by Formula I has the function of inhibiting SFTSV replication and exhibits good therapeutic effects in treating diseases and infections caused by SFTSV.

[0005] This invention provides the use of compounds of Formula I, their derivatives, their geometric isomers, their pharmaceutically acceptable solvates, and / or their hydrates in the preparation of medicaments for the prevention or treatment in subjects of diseases or infections caused by Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV).

[0006]

[0007] The present invention also provides the use of pharmaceutical compositions in the preparation of medicaments for the prevention or treatment of diseases or infections caused by fever with thrombocytopenia syndrome virus (SFTSV) in subjects, wherein the pharmaceutical composition comprises the compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates.

[0008] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is a solid dosage form, an injection, a topical dosage form, a spray, a liquid dosage form, or a combination dosage form.

[0009] In some embodiments, the disease or infection caused by the fever with thrombocytopenia syndrome virus is selected from acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and thrombocytopenia, multiple organ hemorrhage, disseminated intravascular coagulation (DIC), viral encephalitis, and any combination thereof.

[0010] The present invention also provides the use of the compounds represented by Formula I, their derivatives, their geometric isomers, their pharmaceutically acceptable solvates and / or their hydrates in the preparation of medicaments as inhibitors of fever with thrombocytopenic syndrome virus (SFTSV).

[0011] The present invention also provides the use of the pharmaceutical composition in the preparation of a medicament as an inhibitor of fever with thrombocytopenia syndrome virus (SFTSV).

[0012] The present invention also provides the use of compounds of Formula I, their derivatives, their geometric isomers, their pharmaceutically acceptable solvates, and / or their hydrates in the preparation of medicaments for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells). Preferably, the use is in the preparation of medicaments for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells) in vitro or in vivo.

[0013] The present invention also provides the use of the pharmaceutical composition in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells). Preferably, the use is in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells) in vitro or in vivo.

[0014] The present invention also provides a method for treating and / or preventing disease in subjects in need, or a method for inhibiting SFTSV replication or proliferation in subjects in need, the method comprising administering to the subject in need a therapeutic and / or preventative effective amount of the pharmaceutical composition or the compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates, wherein the disease includes diseases or infections caused by Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV) (e.g., acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and thrombocytopenia, multi-organ hemorrhage, disseminated intravascular coagulation (DIC), viral encephalitis, etc.).

[0015] The present invention also provides compounds of Formula I, derivatives thereof, geometric isomers thereof, pharmaceutically acceptable solvates thereof and / or hydrates thereof as SFTSV inhibitors.

[0016] The present invention also provides compounds of Formula I, derivatives thereof, geometric isomers thereof, pharmaceutically acceptable solvates thereof, and / or hydrates thereof for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells). Preferably, the inhibition of SFTSV replication or proliferation in cells (e.g., mammalian cells) is performed in vitro or in vivo.

[0017] The present invention also provides the pharmaceutical composition as an SFTSV inhibitor.

[0018] The present invention also includes a pharmaceutical composition for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells). Preferably, the inhibition of SFTSV replication or proliferation in cells (e.g., mammalian cells) is performed in vitro or in vivo.

[0019] The present invention also provides the pharmaceutical composition for the prevention or treatment of diseases or infections caused by Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV).

[0020] The present invention also provides compounds of Formula I, derivatives thereof, geometric isomers thereof, pharmaceutically acceptable solvates thereof and / or hydrates thereof for the prevention or treatment of diseases or infections caused by Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV).

[0021] In some implementations, the disease caused by the SFTSV is fever with thrombocytopenia syndrome (SFTS).

[0022] In some embodiments, the mammal or subject includes bovines, equines, sheep, suidae, canines, felines, rodents, primates, such as humans, cats, dogs, or pigs.

[0023] In some implementations, inhibition of SFTSV replication or proliferation in cells is achieved through at least one of the following pathways:

[0024] A. Inhibits CPE levels in SFTSV-infected cells.

[0025] B. Inhibits SFTSV RNA replication and the formation of infectious viral particles.

[0026] C. Inhibits death or viremia in mice caused by SFTSV infection.

[0027] In some implementations, the anti-SFTSV activity, or the enhancement or improvement of cell viability or cell survival rate of SFTSV-infected cells, is achieved through at least one of the following pathways:

[0028] A. Inhibit the CPE level in SFTSV-infected cells.

[0029] B. Inhibits SFTSV RNA replication and the formation of infectious viral particles.

[0030] C. Inhibits death in suckling mice or viremia in adult mice caused by SFTSV infection.

[0031] The pharmaceutical composition described in this invention can be prepared in various forms according to different routes of administration.

[0032] According to the present invention, the pharmaceutical composition can be administered in any of the following ways: orally, by spray inhalation, rectal administration, nasal administration, buccal administration, vaginal administration, topical administration, and parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, and intracranial injection or infusion, or via an external implantation device. Oral, intraperitoneal, or intravenous administration is preferred.

[0033] When taken orally, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates may be formulated into any orally acceptable dosage form, including but not limited to tablets, capsules, aqueous solutions, or aqueous suspensions. Tablets typically use lactose and corn starch as carriers, and lubricants such as magnesium stearate may also be added. Capsule formulations typically use lactose and dried corn starch as diluents. Aqueous suspension formulations typically involve mixing the active ingredient with suitable emulsifiers and suspending agents. If desired, sweeteners, flavorings, or colorings may also be added to the above oral dosage forms.

[0034] When used rectally, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates are generally formulated as suppositories, prepared by mixing the drug with a suitable non-irritating excipient. This excipient is solid at room temperature but melts at rectal temperatures to release the drug. Such excipients include cocoa butter, beeswax, and polyethylene glycol.

[0035] When used topically, especially for treating affected areas or organs easily accessible by topical application, such as the eyes, skin, or lower gastrointestinal neurological disorders, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates can be formulated into different topical formulations depending on the affected area or organ, as detailed below:

[0036] When applied topically to the eye, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates may be formulated as a micronized suspension or solution, using an isotonic sterile saline solution of a specific pH, with or without preservatives such as benzyl alkyl chloride. Furthermore, for ophthalmic use, the compound may also be formulated as an ointment, such as petrolatum.

[0037] When applied topically to the skin, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates may be formulated into suitable ointments, lotions, or creams, wherein the active ingredient is suspended or dissolved in one or more carriers. Carriers that may be used in ointments include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsified waxes, and water; carriers that may be used in lotions or creams include, but are not limited to, mineral oil, sorbitan monostearate, Tween 60, hexadecyl ester wax, hexadecene aromatic alcohol, 2-octyldodecyl alcohol, benzyl alcohol, and water.

[0038] When applied topically to the intestines, the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates may be formulated as rectal suppositories or suitable enema formulations as described above, or alternatively, as topical transdermal patches.

[0039] The compounds represented by Formula I, their derivatives, their geometric isomers, their pharmaceutically acceptable solvates, and / or their hydrates can also be administered in sterile injectable formulations, including sterile injectable water or oil suspensions, or sterile injectable solutions. Usable carriers and solvents include water, Ringer's solution, and isotonic sodium chloride solution. Additionally, sterile non-volatile oils, such as monoglycerides or diglycerides, can also be used as solvents or suspension media.

[0040] All of the above-mentioned dosage forms of drugs can be prepared according to conventional methods in the pharmaceutical field.

[0041] Beneficial technical effects of the present invention

[0042] This invention has one or more of the following advantages:

[0043] 1) The compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates can inhibit SFTSV replication at the cellular level, reduce viral nucleic acid load in cell cultures and the production of infective progeny viral particles, inhibit viral protein expression, reduce viremia and viral nucleic acid load in tissues of SFTSV-infected mice, and have a significant protective effect against SFTSV-infected mice.

[0044] 2) The compound shown in Formula I can reduce the viral nucleic acid load level of SFTSV-infected cells and the production of infectious progeny virus particles at microgram concentrations. Attached Figure Description

[0045] Figure 1 The diagram shows the inhibitory effect of elemol on the cytopathic effect (CPE) of SFTSV in Huh7 cells. A shows the structural formula of elemol; B shows the inhibitory effect of elemol on the CPE of SFTSV in Huh7 cells. The left vertical axis represents the inhibition rate of SFTSV, which is marked in red in the figure; the right vertical axis represents cytotoxicity, which is marked in black in the figure; and the horizontal axis represents the drug concentration.

[0046] Figure 2 The study showed the inhibitory effects of elemol on SFTSV RNA replication and infectious viral particle formation. A showed the cytotoxic effect of elemol on Huh7 cells at the working concentration. B and C showed the effects of SFTSV infection of Huh7 cells at a multiplicity of infection (MOI) of 0.01, the collection of supernatant 36 h after viral infection, and the extraction of total RNA from cells using the Trizol method. The inhibitory effects of elemol on SFTSV RNA and infectious viral particle levels were detected by qRT-PCR and PFU.

[0047] Figure 3 The study showed the inhibitory effect of elemol on SFTSV viral protein expression. In A, Huh7 cells were treated with serially diluted elemol or dimethyl sulfoxide (DMSO) at a SFTSV infection dose of 0.5 MOI. After 36 hours post-infection, cells were lysed, and the results of Western blot analysis using an anti-SFTSV protein NP antibody were obtained. In B, the results of quantitative analysis of the target protein were obtained using β-actin as an internal control protein.

[0048] Figure 4This study demonstrates that elemol exerts an antiviral effect in the later stages of the SFTSV infection cycle. In Figure A, a schematic diagram of the drug administration sequence is shown. The Virus group consists of virus-infected cells that do not receive drug treatment. Stages I-VI represent different stages of the viral life cycle, respectively. Figures B and C show that elemol can effectively reduce viral nucleic acid load and viral infectious particle formation in SFTSV-infected Huh7 cells in stages IV, V, and VI. T-705 serves as a positive control.

[0049] Figure 5 The experiment shows that elemol protects mice from lethal SFTSV infection, reduces viremia and viral load in tissues, and alleviates tissue lesions. A shows a schematic diagram of the therapeutic effect of elemol on neonatal mice infected with a lethal dose of SFTSV. B and C show the changes in body weight and survival curves of neonatal mice after infection with a lethal dose of SFTSV, under the conditions of elemol treatment or in the presence of phosphate-buffered saline.

[0050] Figure 6 The study showed that elemol reduced viral load in mouse tissues. Specifically, AF showed that 8 days after infection, the viral nucleic acid production in the mouse brain (A), heart (B), liver (C), spleen (D), lung (E), and kidney (F) was quantified by qRT-PCR, and elemol treatment reduced viral nucleic acid load in mouse tissues.

[0051] Figure 7 The results showed that elemol could reduce viremia in mice. Specifically, treatment with elemol three times—before, during, and after SFTSV infection—significantly reduced viremia in adult BALB / c mice.

[0052] In the above figures, * represents p < 0.05, indicating a significant difference; ** represents p < 0.01, indicating a highly significant difference; and *** represents p < 0.001, indicating an extremely significant difference. Detailed Implementation

[0053] The following specific embodiments of the present invention will further illustrate the substantive content of the invention. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the invention. Unless otherwise specified in the following embodiments, conditions are performed according to conventional conditions or the manufacturer's recommendations. Raw materials whose manufacturers are not specified are all commercially available conventional products.

[0054] While many of the materials and methods of operation used in the following embodiments are well known in the art, the present invention is still described in as much detail as possible herein. It will be apparent to those skilled in the art that, unless otherwise stated, the materials and methods of operation used in the following embodiments are well known in the art.

[0055] Example 1: In vitro anti-SFTSV activity evaluation experiment of elemol based on cytopathic effect

[0056] (1) Experimental materials

[0057] The human hepatocellular carcinoma cells (Huh7 cells) used in the experiment were purchased from the National Experimental Cell Resource Sharing Platform (catalog number: SCSP-526). The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strain was isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692). FBS (purchased from Gibco, catalog number: 16000044) and penicillin-streptomycin antibiotics (purchased from Gibco, catalog number: 2321152) were used. DMEM high-glucose medium (purchased from Gibco, catalog number: 2367374) was used. White-bottomed 96-well plates were purchased from Corning (catalog number: 165306). The microplate reader was a SpectraMax M5 Cell Titer from Molecular Devices. Luminescent Cell Viability Kit (purchased from Promega, catalog number: G7572).

[0058] (2) The experimental design is as follows:

[0059] Huh7 cells were planted at a density of 5.0 × 10⁶ cells per well. 3 The virus was seeded at a density of [insert density here] into white-bottomed 96-well plates and incubated at 37°C and 5% CO2 for 24 hours. The SFTSV virus solution was then diluted with cell maintenance medium and added to the 96-well plates to a final concentration of 100 × TCID50. 50 Simultaneously, the test compound was diluted with cell maintenance medium and added to 96-well plates to achieve final concentrations of 60.00 μg / mL, 20.00 μg / mL, 6.67 μg / mL, 2.22 μg / mL, and 0.74 μg / mL. After approximately 5 days, the supernatant was discarded, and the diluted Cell-Titer solution was added. Luminescent Cell Viability assay solution was lysed by shaking in the dark for 5 min, then allowed to stand for 3 min. Finally, the luminescence value of each well was measured using a microplate reader, and the half-maximal effective concentration (EC50) of the corresponding compound was calculated. 50 ).

[0060] The formula for calculating the virus inhibition rate of the test compound is:

[0061]

[0062] Cytotoxicity experiment of elemol on Huh7 cells

[0063] The experimental procedure is as follows:

[0064] Huh7 cells were planted at a density of 5.0 × 10⁶ cells per well. 3 Cell culture medium was seeded at a density in white-backed 96-well plates and cultured at 37°C and 5% CO2 for 24 hours. The test compound, elemol, was serially diluted with cell maintenance medium and added to the 96-well plates to achieve final concentrations of 60.00 μg / mL, 20.00 μg / mL, 6.67 μg / mL, 2.22 μg / mL, and 0.74 μg / mL. After 5 days, the supernatant was discarded, and diluted Cell-Titer was added. Luminescent Cell Viability assay solution was lysed by shaking in the dark for 5 min, then allowed to stand for 3 min. Finally, the luminescence value of each well was measured using a microplate reader, and the half-cytotoxic concentration (CC) of the corresponding compound was calculated. 50 ).

[0065] The formula for calculating the inhibition rate of the test compound at each dilution is as follows:

[0066]

[0067] (4) Data Analysis

[0068] The inhibition rate-concentration sigmoid curve was fitted using Origin 9.0 software to calculate the EC50 of the test compound. 50 The CC of the test compound was calculated using the same method. 50 and according to EC 50 and CC 50 Calculate the selection index (SI), where SI = CC 50 / EC 50 .

[0069] (5) Experimental Results

[0070] The experimental results are shown in Table 1 and Figure 1 This demonstrates that elemol inhibits the SFTSV-induced cytopathic effect in SFTSV-infected Huh7 cells in a dose-dependent manner. (Electrospray precipitate on Huh7 cells). 50 Value, CC 50 The values ​​and SI were 43.53±2.26 μg / mL, 99.55±7.54 μg / mL, and 2.29, respectively.

[0071] Table 1. Validation of the in vitro antiviral activity of elemol

[0072]

[0073]

[0074] Example 2: Experiment on the inhibition of SFTSV RNA replication and infectious virus particle formation by elemol

[0075] (1) Experimental materials

[0076] The human hepatocellular carcinoma cells (Huh7 cells) used in the experiment were purchased from the National Experimental Cell Resource Sharing Platform (catalog number: SCSP-526). The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strain was isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692). FBS (purchased from Gibco, catalog number: 16000044) and penicillin-streptomycin antibiotics (purchased from Gibco, catalog number: 2321152) were used. DMEM high-glucose medium (purchased from Gibco, catalog number: 2367374) was used. 12-well plates were purchased from Corning (catalog number: 3512). TRIzol reagent was purchased from Invitrogen (catalog number: 15596026). One Step PrimeScript was also used. TM The RT-PCR kit was purchased from Takara (catalog number: RR47Q). The SFTSV standard plasmid and qRT-PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Analytical-grade low-melting-point agarose was purchased from Promega (catalog number: V2111). Ammonium oxalate crystal violet staining solution (1%) was purchased from Meilun Biotechnology Co., Ltd. (catalog number: MA0149).

[0077] (2) Experimental methods:

[0078] ① Huh7 cells were spaced at 1.5 × 10⁶ cells per well. 5Cells were seeded at a density of [insert density here] in 12-well plates and cultured at 37°C and 5% CO2 for 24 hours. SFTSV virus solution was then diluted to 0.01 MOI with cell maintenance medium and added to the 12-well plates. Simultaneously, the test compound elemol was diluted to the appropriate concentration with cell maintenance medium and added to the 12-well plates, resulting in final elemol concentrations of 60.00 μg / mL, 20.00 μg / mL, 6.67 μg / mL, 2.22 μg / mL, and 0.74 μg / mL. Cells were incubated at 37°C and 5% CO2 for 36 hours. The supernatant was collected, centrifuged at 8000 rpm for 5 min, aliquoted, and stored at -80°C for later use. Total RNA was extracted from the remaining lower layer cells in each well using the TRIzol method. Total RNA was extracted according to the TRIzol reagent instructions. Viral RNA expression levels were detected by qRT-PCR, and absolute quantification of viral RNA levels was performed using a One Step RT-PCR kit. Primer and probe sequences are as follows:

[0079] Forward primer:GGGTCCCTGAAGGAGTTGTAAA

[0080] Reverse primer: TGCCTTCACCAAGACTATCAATGT

[0081] Probe:TTCTGTCTTGCTGGCTCCGCGC

[0082] 3) The reaction procedure is as follows:

[0083] Reverse transcription: 42℃ for 25 minutes;

[0084] Pre-denaturation: 95℃ for 3 minutes;

[0085] Signal acquisition: 95℃ for 20 seconds, 59℃ for 1 minute, for a total of 45 cycles.

[0086]

[0087] ② Plaque forming unit (PFU) experiment

[0088] Huh7 cells were processed at a rate of 2 × 10 5Cells / mL were seeded into 12-well plates and cultured overnight. The supernatant samples were removed from the -80°C freezer and serially diluted 10-fold with 2% DMEM medium, resulting in 6 different dilutions. The cells were then removed from the 12-well plates, the supernatant was discarded, and 500 μL of the different dilutions of the sample were added to each well. The plates were incubated at 37°C for 2 hours. After 2 hours, the supernatant was discarded, and each well was washed twice with 1 mL PBS. 1 mL agarose medium was added to each well, and the plates were incubated at 4°C for 5 minutes until the agarose medium solidified. The plates were then placed in a cell culture incubator and cultured for 3-4 days. When obvious viral plaques appeared, 1 mL of 4% formaldehyde was added to each well for fixation at room temperature for at least 4 hours. The upper agarose medium was washed away with running water, and 1% crystal violet was added for staining for 15 minutes. The staining solution was removed, and the plates were rinsed and air-dried. Plaque counts were performed, and PFU was calculated using the following formula:

[0089]

[0090] (3) Statistical analysis

[0091] Statistical significance was calculated using one-way ANOVA with GraphPad Prism 8 software. Data are presented as mean ± standard deviation. p < 0.05 indicates a statistically significant difference.

[0092] (4) Experimental Results

[0093] The results are shown in Table 2 and Figure 2 As shown: Elemisin inhibits the replication of SFTSV RNA in a dose-dependent manner (B), and also inhibits the production of infectious viral particles (C).

[0094] Table 2. In vitro antiviral experiments of elemol

[0095]

[0096] Example 3: Experiment on the inhibition of SFTFSV viral protein expression levels by elemol

[0097] (1) Experimental materials

[0098] The human hepatocellular carcinoma cells (Huh7 cells) used in the experiment were purchased from the National Experimental Cell Resource Sharing Platform (catalog number: SCSP-526). The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strains were isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692). FBS (purchased from Gibco, catalog number: 16000044) and penicillin-streptomycin antibiotics (purchased from Gibco, catalog number: 2321152), DMEM high-glucose medium (purchased from Gibco, catalog number: 2367374), 6-well plates were purchased from Corning (catalog number: 3516), Anti-SFTSV NP Antibody (purchased from Immune Technology Corp., catalog number: IT-017-006M11), and Mouse Anti-beta Actin were also used. Antibody (purchased from Abcam, catalog number: ab8226), RIPA lysis buffer (purchased from Prilele, catalog number: C1053), skim milk powder for blocking (purchased from Prilele, catalog number: P1622), BCA protein quantification kit (purchased from Prilele, catalog number: P1511), ECL luminescence detection solution (purchased from Prilele, catalog number: P1050), SDS-PAGE electrophoresis system (purchased from Bio-Rad), chemiluminescence imaging system (ProteinSample, model: FluorChem R).

[0099] (2) Experimental methods:

[0100] Immunoblotting assay

[0101] Huh7 cells were spaced at 5 × 10⁶ cells per well. 5Cells were seeded at a density of [insert density here] in 6-well plates and cultured at 37°C and 5% CO2 for 24 hours. SFTSV virus solution was then diluted to 0.01 MOI with cell maintenance medium and added to the 6-well plates. Simultaneously, the test compound elemol was diluted to the appropriate concentration with cell maintenance medium and added to the 6-well plates, resulting in final elemol concentrations of 60.00 μg / mL, 30.00 μg / mL, and 15.00 μg / mL. Thirty-six hours after viral infection, RIPA lysis buffer was added. After complete cell lysis, the cell lysate was collected, centrifuged at 8000 rpm for 15 min, and the protein was quantified using the BCA method before Western blotting. The quantified protein was then transferred to an SDS-PAGE gel. Subsequently, the protein was transferred to a PVDF membrane. Two hours after blocking with skim milk powder, the PVDF membrane was rinsed three times with TBST solution and incubated overnight at 4°C with SFTSV NP protein antibody or β-actin antibody as a control. After rinsing the PVDF membrane again, it was incubated at room temperature for 1 hour with an appropriate secondary antibody. The PVDF membrane was then rinsed again, and an ECL luminescence detection solution was prepared. Exposure detection was performed using an electrochemiluminescence detection system.

[0102] (3) Statistical analysis

[0103] Statistical significance was calculated using the t-test in GraphPad Prism 8 software. Data are presented as mean ± standard deviation. p < 0.05 indicates a statistically significant difference.

[0104] Experimental results

[0105] The experimental results are shown in Table 3 and Figure 3 As shown: In SFTSV-infected Huh7 cells, treatment with elemol can inhibit the expression of SFTSV viral proteins in a dose-dependent manner.

[0106] Table 3. Protein Expression

[0107]

[0108]

[0109] Example 4: Experimental Verification of the Mechanism of Action of Elemisin against SFTSV

[0110] (1) Test materials

[0111] The human hepatocellular carcinoma cells (Huh7 cells) used in the experiment were purchased from the National Experimental Cell Resource Sharing Platform (catalog number: SCSP-526). The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strain was isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692). FBS (purchased from Gibco, catalog number: 16000044) and penicillin-streptomycin antibiotics (purchased from Gibco, catalog number: 2321152) were used. DMEM high-glucose medium (purchased from Gibco, catalog number: 2367374) was used. 12-well plates were purchased from Corning (catalog number: 3512). TRIzol reagent was purchased from Invitrogen (catalog number: 15596026). One-Step PrimeScript was also used. TM RT-PCR kits were purchased from Takara (catalog number: RR47Q). SFTSV standard plasmids and qRT-PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Analytical-grade low-melting-point agarose was purchased from Promega (catalog number: V2111). Ammonium oxalate crystal violet staining solution (1%) was purchased from Meilun Biotechnology Co., Ltd. (catalog number: MA0149).

[0112] (2) Time-series experiment

[0113] The concentration of elemol used in the experiment was 60.00 μg / mL, the concentration of the positive compound T-705 was 50 μM, and the SFTSV infection dose was 0.01 MOI. The specific steps were as follows: Huh7 cells were cultured at 1.5 × 10⁶ cells per well. 5 The cells were seeded at a density of [missing information] into 12-well plates and cultured at 37°C and 5% CO2 for 24 hours. Subsequently, the test compound elemol, positive compound T-705, and SFTSV virus solution were diluted to the appropriate concentrations with cell maintenance medium, and then [missing information]. Figure 4 Pre-diluted compounds were added at the time points shown in A (Phase I: -2h-0h, Phase II: 0h-2h, Phase III: -2h-2h, Phase IV: -2h-24h, Phase V: 0h-24h, Phase VI: 2h-24h), and the virus was added at time point 0h. After culturing for 24 hours, the supernatant was collected, centrifuged at 8000 rpm for 5 min, aliquoted, and stored at -80℃ for later use. The remaining lower layer cells were washed three times with 1 mL PBS per well, and total RNA was extracted using the TRIzol method. Intracellular viral RNA load and viral particle formation were detected using qRT-PCR and PFU methods, with specific experimental conditions as described above.

[0114] (3) Statistical analysis

[0115] Statistical significance was calculated using one-way ANOVA with GraphPad Prism 8 software. Data are presented as mean ± standard deviation. p < 0.05 indicates a statistically significant difference.

[0116] (4) Experimental Results

[0117] The experimental results are shown in Table 4 and Figure 4 As shown: After adding elemol at different stages of SFTSV infection of Huh7 cells, the intracellular SFTSV RNA load and viral infectious particle formation were detected. The experimental results showed that elemol mainly played a role in the later stage of the viral infection life cycle, and had no significant inhibition on viral adsorption and entry.

[0118] Table 4. Experimental verification of the anti-SFTSV mechanism of elemol

[0119]

[0120] Example 5: Protective experiment of elemol against lethal SFTSV infection in 1-day-old ICR suckling rats.

[0121] (1) Experimental materials

[0122] The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strains used in the experiments were isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692).

[0123] (2) Laboratory animals

[0124] The 1-day-old ICR mother and offspring mice used in the experiment were SPF grade, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with a clear source and qualified after inspection.

[0125] (3) Experimental steps

[0126] like Figure 5 A. Four litters of one-day-old ICR female and pups were randomly divided into four groups: a virus control group and three treatment groups. The dosages of elemol administered were 80 mg / kg, 40 mg / kg, and 20 mg / kg, respectively. Each mouse was challenged intraperitoneally with 1.2 × 10⁻⁶ oz. 8 PFU was administered intraperitoneally 6 hours prior to the first administration. The virus control group was given the drug solvent. The drugs were then administered once daily for 7 consecutive days. The survival and weight changes of the mice were measured and recorded daily.

[0127] (4) Statistical analysis

[0128] The statistical significance of survival curves was calculated using the Log-Rank function of GraphPad Prism 8 software. p < 0.05 indicates a statistically significant difference.

[0129] (5) Experimental Results

[0130] The experimental results are shown in Table 5 and Figure 5 As shown: Elemisin exhibited a dose-dependent protective effect against lethal doses of SFTSV in newly inoculated ICR mice. Compared to the virus control group, a dose of 80 mg / kg significantly improved the survival rate of 1-day-old ICR mice. Figure 5 (B and C).

[0131] Table 5. Protective effect of elemol against lethal SFTSV infection in 1-day-old ICR suckling rats - body weight record

[0132]

[0133]

[0134]

[0135] Example 6: Experiment on the inhibition of viral nucleic acid load in tissues of 1-day-old ICR suckling mice by elemol infection.

[0136] (1) Experimental materials

[0137] The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strains used in the experiments were isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692).

[0138] (2) Laboratory animals

[0139] The 1-day-old ICR mother and offspring mice used in the experiment were SPF grade, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with a clear source and qualified after inspection.

[0140] (3) Experimental steps

[0141] ① Detection of SFTSV viral load in tissues of 1-day-old ICR suckling mice

[0142] Two litters of one-day-old ICR female mice were randomly divided into two groups: a virus control group and an 80 mg / kg elemol administration group. Mice were administered the drug and infected with the virus as described previously, and tissue samples were collected on day 8 of infection. 5 mm grinding steel balls were autoclaved, and two grinding steel balls were added to each EP tube. Then, 1 mL of TRIzol reagent was added to each tube and weighed. Tissue samples were then cut into pieces less than 8 mm in diameter, rinsed twice with PBS, and the surface liquid was blotted dry. The tissue pieces were immediately added to EP tubes containing TRIzol reagent, and the tissue pieces were pulverized using a high-throughput tissue homogenizer to obtain tissue lysate. Subsequent RNA extraction was performed as described previously, and then qRT-PCR was used to quantify viral RNA in each tissue.

[0143] (4) Statistical analysis

[0144] Statistical significance was analyzed using an unpaired t-test with GraphPad Prism 8 software. Data are presented as mean ± standard deviation. p < 0.05 indicates statistical significance.

[0145] (5) Experimental Results

[0146] As shown in Table 6 and Figure 6 As shown, elemol treatment significantly reduced viral load levels in the brain, heart, liver, spleen, lungs, and kidneys of mice. These results indicate that elemol possesses in vivo anti-SFTSV activity.

[0147] Table 6. Experimental results of elemol inhibiting viral load in tissues of 1-day-old ICR suckling mice infected with SFTSV.

[0148]

[0149]

[0150] Example 7: Experiment on the inhibition of viremia induced by SFTSV infection in BALB / c mice by elemol.

[0151] (1) Experimental materials

[0152] The compound elemol was purchased from TargetMol (catalog number: T3341). The SFTSV strains used in the experiments were isolated and preserved from clinical samples by our laboratory according to standard operating procedures (GenBank accession numbers: MZ561690, MZ561691, and MZ561692).

[0153] (2) Laboratory animals

[0154] The 6-week-old female BALB / c mice used in the experiment were SPF grade, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with a clear origin and qualified through inspection.

[0155] (3) Detection of SFTSV viral load in the blood of 6-week-old BALB / c mice

[0156] Forty 6-week-old BALB / c mice were randomly divided into four groups: a virus control group, and treatment groups (300 mg / kg, 150 mg / kg, and 75 mg / kg). Each mouse was challenged with approximately 1 × 10⁻⁶ viruses via intraperitoneal administration. 5 PFU was administered via gavage at 0 hours, with the challenge time set at -12 hours, 0 hours, and 12 hours. The virus control group and the blank control group were given the drug solvent. Blood was collected from the eyeballs 24 hours after challenge. Tissue RNA was extracted using TRIzol reagent, and then qRT-PCR was used to quantify the viral RNA in each tissue.

[0157] (4) Statistical analysis

[0158] Statistical significance was analyzed using an unpaired t-test with GraphPad Prism 8 software. p < 0.05 indicated a statistically significant difference.

[0159] (5) Experimental Results

[0160] like Figure 7 As shown, elemol treatment significantly reduced viral load in the blood of mice. These results indicate that elemol possesses in vivo anti-SFTSV activity.

[0161] Table 7. Experimental results of elemol inhibiting viremia induced by SFTSV infection in BALB / c mice.

[0162]

[0163] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and substitutions can be made to those details based on all the teachings disclosed, and all such changes are within the scope of protection of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. The use of the compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates in the preparation of a medicament for the prevention or treatment in subjects of a disease or infection caused by Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), 2. The use according to claim 1, wherein the disease or infection caused by the fever with thrombocytopenia syndrome virus is selected from acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and thrombocytopenia, multiple organ hemorrhage, disseminated intravascular coagulation (DIC), viral encephalitis and any combination thereof.

3. Use of the pharmaceutical composition in the preparation of a medicament for the prevention or treatment in subjects of illness or infection caused by febrile thrombocytopenic syndrome virus (SFTSV). The pharmaceutical composition comprises the compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. Specifically, the pharmaceutical composition is a solid dosage form, an injection, a topical preparation, a spray, a liquid preparation, or a compound preparation.

4. The use according to claim 3, wherein the disease or infection caused by the fever with thrombocytopenia syndrome virus is selected from acute fever, cough, fatigue, gastrointestinal symptoms, leukopenia and thrombocytopenia, multiple organ hemorrhage, disseminated intravascular coagulation (DIC), viral encephalitis and any combination thereof.

5. Use of the compound represented by Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates in the preparation of a medicament as an inhibitor of fever with thrombocytopenia syndrome virus (SFTSV), 6. Use of the pharmaceutical composition in the preparation of a medicament as an inhibitor of fever with thrombocytopenia syndrome virus (SFTSV), The pharmaceutical composition comprises a compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. Specifically, the pharmaceutical composition is a solid dosage form, an injection, a topical preparation, a spray, a liquid preparation, or a compound preparation.

7. Use of the compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates and / or its hydrates in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells), Preferably, it is used in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells) in vitro or in vivo.

8. Use of the pharmaceutical composition in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells), The pharmaceutical composition comprises a compound of Formula I, its derivatives, its geometric isomers, its pharmaceutically acceptable solvates, and / or its hydrates. Preferably, the use in the preparation of a medicament for inhibiting the replication or proliferation of SFTSV in cells (e.g., mammalian cells) in vitro or in vivo. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient. Specifically, the pharmaceutical composition is a solid dosage form, an injection, a topical preparation, a spray, a liquid preparation, or a compound preparation.

9. The use according to any one of claims 1-4, wherein the disease caused by the SFTSV is fever with thrombocytopenia syndrome (SFTS).

10. The use according to any one of claims 1-4, 7-8, wherein the mammal or subject includes bovines, equines, sheep, suidae, canines, felines, rodents, primates, such as humans, cats, dogs, or pigs.

11. The use as described in claim 7 or 8, wherein, Inhibition of SFTSV replication or proliferation in cells is achieved through at least one of the following pathways: A. Inhibits CPE levels in SFTSV-infected cells. B. Inhibits SFTSV RNA replication and the formation of infectious viral particles. C. Inhibits death or viremia in mice caused by SFTSV infection.