A method for increasing flavonoid and triglyceride content of embryogenic cultures of dimocarpus longan by overexpressing miR319a

Abstract

The application discloses a method for increasing flavonoid and triglyceride contents of embryonic culture of Dimocarpus longan by overexpressing miR319a. The sequence of a primary body (pri-miR319a) of miR319a is shown as SEQ ID NO:1, and the sequences of three mature bodies are shown as SEQ ID NO:2-4 respectively. The application obtains the transgenic embryonic callus of D. longan overexpressing miR319a by using an agrobacterium-mediated method, and the proliferation amount of the transgenic embryonic culture is increased by 49.1% compared with a control group after 30 days of culture, and the flavonoid and triglyceride contents are increased by 11.8% and 172.4% respectively. The application has a good application prospect in the fields of cultivating new germplasm of D. longan and producing functional metabolites by using plant tissue culture technology.

Description

Technical Field

[0001] This invention belongs to the field of plant tissue culture technology, specifically relating to a method for increasing the flavonoid and triglyceride content in longan embryogenic cultures by overexpressing miR319a. Background Technology

[0002] Longan ( Dimocarpus longan Longan (Dimocarpus longanus) is an important economic fruit tree in tropical and subtropical regions, belonging to the Sapindaceae family and the Dimocarpus genus. Its fruit is rich in flavonoids, carotenoids, lipids, and other active ingredients, possessing high edible and medicinal value. The embryonic development of the fruit is closely related to its quality and yield. Embryogenic callus is a type of callus with embryogenic characteristics, characterized by its round shape, prominent nucleus, high nucleocytoplasmic ratio, small vacuoles, vigorous cell division, and abundant nutrients. It is an important material for producing tissue culture seedlings and artificial seeds. At the end of the 20th century, a high-frequency somatic cell embryogenesis system for longan embryogenic callus was established by Lai Zhongxiong et al. (1997), who discovered that longan embryogenic cultures are rich in a large number of functional metabolites.

[0003] Flavonoids possess a variety of biological activities, such as anti-cancer, antioxidant, anti-inflammatory, and anti-atherosclerotic effects, and can also regulate blood pressure, blood sugar, and blood lipids. Currently, the chemical synthesis of flavonoids is developing rapidly, but it is still mainly extracted from natural plant materials. Triglycerides, as the most important energy storage lipids in plants, exhibit highly specific tissue distribution, dominating in seeds and participating in plant embryo development. Embryo cultures are similar to plant seeds, and triglycerides are one of the main lipids in longan embryo cultures.

[0004] MicroRNAs (miRNAs) are a class of endogenous non-coding small RNAs, approximately 18–24 nt in length, that play a crucial role in regulating plant growth and development. miR319a is one of the oldest and most conserved members of the plant miRNA family, participating in various developmental processes. In previous studies, we found that transient overexpression of miR319a using oligonucleotide mimics promoted somatic embryo differentiation in longan. However, these oligonucleotide mimics required the use of the nucleic acid transfection reagent Lipofectamine 2000, which was demanding and yielded limited results. Exogenous miPEP319a-2 significantly affected the expression levels of members of the longan miR319a family. Furthermore, longan embryogenic callus treated with exogenous miPEP319a-2 showed larger and more tightly packed cell clusters after 6 days of culture. However, these cell clusters remained in the embryogenic callus stage and did not exhibit typical somatic embryonic structures such as globular embryos or cotyledonous embryos, making it impossible to accurately determine whether miR319a participates in the regulation of longan somatic embryonic development.

[0005] Furthermore, there are currently no reports on miR319a regulating the synthesis and accumulation of flavonoids and triglycerides in longan embryonic cultures. Summary of the Invention

[0006] The purpose of this invention is to provide a method for increasing the flavonoid and triglyceride content in longan embryogenic cultures by overexpressing miR319a. Besides obtaining new longan germplasm with high flavonoid and triglyceride yields, this method also utilizes [other methods] while maintaining essentially the same culture cost. miR319a -OE embryogenic cultures produce high yields of plant flavonoids and triglycerides.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a miR319a that increases the content of flavonoids and triglycerides in longan embryonic cultures, wherein the primary form pri-miR319a sequence is shown in SEQ ID NO:1; and the mature form sequences are shown in SEQ ID NO:2~4 respectively.

[0008] In a second aspect, the present invention provides a recombinant expression vector comprising the primary sequence of miR319a described above.

[0009] Thirdly, the present invention provides a recombinant engineered bacterium, which is transferred into the above-mentioned recombinant expression vector by a freeze-thaw method.

[0010] Fourthly, the present invention provides a transgenic embryogenic callus containing the above-mentioned recombinant expression vector or the above-mentioned recombinant engineered bacteria.

[0011] Fifthly, the present invention provides the application of the above-mentioned miR319a in regulating flavonoids and triglycerides in longan embryogenic cultures.

[0012] Furthermore, overexpression of miR319a was used to increase the content of flavonoids and triglycerides in longan embryogenic cultures.

[0013] Furthermore, overexpression of miR319a can also increase the proliferation of longan embryogenic cultures.

[0014] Furthermore, by infecting longan embryonic callus with the aforementioned recombinant engineered bacteria, transgenic longan embryonic callus miR319a-OE expressing miR319a was obtained.

[0015] Furthermore, the culture period for the longan embryonic callus is 20 days.

[0016] In a sixth aspect, the present invention provides a method for overexpressing miR319a to increase the flavonoid and triglyceride content of longan embryonic cultures, wherein miR319a is overexpressed in longan embryonic callus to increase the flavonoid and triglyceride content of longan embryonic cultures; the primary form pri-miR319a sequence is shown in SEQ ID NO:1, and the mature form sequences are shown in SEQ ID NO:2~4 respectively.

[0017] The advantages of this invention are: This invention utilizes Agrobacterium-mediated transformation to obtain transgenic embryogenic callus of longan overexpressing miR319a. After 30 days of culture, the proliferation rate of this transgenic embryogenic culture was 49.1% higher than the control group, and the contents of flavonoids and triglycerides were increased by 11.8% and 172.4%, respectively, compared to the control. Therefore, this invention has promising applications in the cultivation of new longan germplasm and the large-scale production of functional metabolites using plant tissue culture technology. Attached Figure Description

[0018] Figure 1 Map of the p1301-35S-pri-miR319a overexpression recombinant vector.

[0019] Figure 2 : MiR319a - Identification of OE transgenic embryogenic callus; where (A) PCR identification results, lane 1 is the marker 5000 bp, lanes 2-4 are the results of 3 extractions. MiR319a (A) DNA from OE transgenic embryonic callus was identified by PCR; (B) GUS staining results; (C) MiR319a-OE The relative expression levels of pri-miR319a, miR319a-3p, miR319a-5p1 and miR319a-5p2 in the control group and the WT group.

[0020] Figure 3 : MiR319a Structural observation of embryogenic cultures during embryo induction in OE and its control group (WT); microstructures at 10 and 12 days, and growth morphology in culture medium at 30 days; red arrows point to the first observed spherical embryos in the cell line. Detailed Implementation

[0021] To make the above-mentioned features and advantages of the present invention more apparent and understandable, specific embodiments are described below in detail. However, the present invention can be implemented in many different ways and is not limited to the embodiments described herein. Rather, the purpose of providing these embodiments is to make the understanding of the present invention more thorough and comprehensive. Unless otherwise specified, the methods of the present invention are conventional methods in the art.

[0022] The nucleotide sequence of longan pri-miR319a in the following examples is shown in SEQ ID NO:1. The specific sequences of miR319a-5p1 (SEQ ID NO:2), miR319a-5p2 (SEQ ID NO:3), and miR319a-3p1 (SEQ ID NO:4) are as follows: miR319a-5p1:AGAGCTTTCTTCAGTCCACTT; miR319a-5p2: TAGCTGCCGACTCATTCATCCA; miR319a-3p1:TTGGACTGAAGGGAGCTCCCT.

[0023] Example 1: Construction of longan miR319a overexpression vector Full-length pri-miR319a was amplified using longan gDNA as a template, and the target fragment was recovered using the Thermo Scientific GeneJET gel extraction kit. The pri-miR319a fragment with homologous arms was then constructed into a gel using the Hieff Clone® Plus OneStep Cloning Kit from Shanghai Yisheng Biotechnology. BamH I and Sal I. The p1301 vector was digested with enzymes. 5 μL of the resulting ligation product was transformed into DH5α *E. coli* competent cells using the freeze-thaw method and plated on Kan-resistant LB agar plates for overnight culture. Single clones with correct sequencing were amplified, and the recombinant vector was extracted using the Thermo Scientific GeneJET plasmid miniprep kit, yielding the longan miR319a overexpression vector, named recombinant vector 1301-35S-pri-miR319a. The recombinant vector map is shown below. Figure 1 As shown.

[0024] Example 2: Preparation of recombinant engineered bacteria overexpressing longan miR319a The recombinant vector 1301-35S-pri-miR319a was transformed into competent Agrobacterium tumefaciens cells (EHA105) using a freeze-thaw method. The cells were then cultured for 48 h on LB agar plates containing 50 mg / L Kan and 25 mg / L Rif resistance. Single clones that were correctly identified by PCR were preserved. PCR identification of the 1301-35S-pri-miR319a overexpressing recombinant engineered bacteria was performed using primers 35S-F (5'-CATGGAGTCAAAGATTCAAATAG-3') and pri-miR319a-R (5'-cttgcatgcctgcaggtcgacGTAGCATAGTTTAGTAGTG-3'). Single clones that were correctly identified by PCR were preserved as the longan miR319a overexpressing recombinant engineered bacteria.

[0025] Example 3: Preparation of embryogenic callus overexpressing longan miR319a Agrobacterium tumefaciens-mediated infection was employed, using longan embryogenic callus subcultured for 15 days as the recipient material. Specifically, the recombinant engineered bacteria overexpressing longan miR319a were cultured in LB liquid medium containing 50 mg / L Kan and 25 mg / L Rif resistance, with LB liquid medium serving as a control, until OD (Organic Depression) was reached. 600 The optimal concentration (OD) was 1.0–1.2, and the culture conditions were 28°C and 180 rpm. After centrifugation, the precipitate was collected and resuspended in MS liquid medium (containing 30 g / L sucrose, 40 mg / L AS, and 1 M MgCl2, pH 5.8–6.0). The bacterial concentration was adjusted to OD using a spectrophotometer. 600 The concentration should be around 0.7. The adjusted bacterial solution was transferred to sterile 50 mL centrifuge tubes (bacterial solution not exceeding 35 mL), and activated at 28°C and 180 rpm in a shaker for 60 min. Then, approximately 5 mL of longan embryogenic callus was added to each tube, and the mixture was shaken to incubate for 30 min. The incubated longan embryogenic callus was filtered out, and the surface bacterial solution was blotted dry with sterile filter paper. The inoculated callus was then transferred to co-culture medium (MS solid medium, containing 30 g / L sucrose, 20 mg / L AS, and 7 g / L agar, pH 5.8–6.0). Three days later, the cells were transferred to MS resistance medium (containing 1.0 mg / L 2,4-D, 300 mg / L Cef, 20 g / L sucrose, and 7 g / L agar, pH 5.8) for culture. One week after inoculation, the cells were transferred to selection medium (MS resistance medium containing 20 mg / L hygromycin) for culture. After about 30 days, transgenic embryogenic callus overexpressing longan miR319a (denoted as ) was obtained. MiR319a -OE). The resulting transgenic cell lines can be subcultured long-term in subculture medium and remain in the embryogenic callus state. Extraction MiR319aTotal DNA from OE embryogenic callus was analyzed using primers 35S-F / pri-miR319a-R and GUS-F (5'-CGTCCTGTAGAAACCCCAAC-3') / GUS-R (5'-CACACTTTGCCGTAATGAGT-3'). MiR319a PCR identification of OE embryogenic callus tissue revealed that the obtained MiR319a -Targeted bands in OE transgenic embryogenic callus ( Figure 2 A) Further selection of parts MiR319a GUS staining of OE transgenic embryonic callus tissue revealed the selected... MiR319a -OE transgenic embryogenic callus tissue can all be stained dark blue. Figure 2 B). Therefore, both the PCR identification results and the GUS staining results indicate that the sample has been obtained. MiR319a -OE transgenic embryogenic callus. And... MiR319a-OE The relative expression levels of pri-miR319a, miR319a-3p, miR319a-5p1, and miR319a-5p2 in transgenic embryonic callus were significantly higher than those in the control group. Figure 2 C).

[0026] Example 4: MiR319a Determination of proliferation, triglyceride and flavonoid content in OE transgenic embryonic cultures Subcultured for 20 days MiR319a -OE transgenic embryogenic callus was inoculated into somatic embryo induction medium (MS medium containing 30 g / L sucrose, 7 g / L agar, pH 5.8), with ordinary embryogenic callus as the control group (WT). The initial inoculation amount in each culture dish was 0.15 g, divided into 4 clusters. The cultures were incubated in the dark at 25°C, and somatic embryo differentiation was observed under microscopic examination, and the proliferation rate, flavonoid and triglyceride contents were measured at 10, 12, and 30 days of culture. MiR319a -OE transgenic longan embryonic callus somatic embryonic development as follows: Figure 3 As shown, in the control group, after 12 days of culture, approximately 50% of the embryos were globulic embryos (GE), and they developed normally. MiR319a - After 10 days of culture, the proportion of GE (Genomic Absorption Regulator) in the OE (Oxygen Extract) strain was over 50%, and after 12 days of culture, the proportion of GE was over 90%. After 30 days of culture, MiR319a The -OE line had partially developed into a cotyledonous embryo, while the control group was still in the late GE stage. Therefore, overexpression of miR319a can significantly promote the development of longan somatic embryos.

[0027] MiR319aThe results of the proliferation of OE embryogenic cultures are shown in Table 1. Overexpression of miR319a can significantly promote the proliferation of longan embryogenic cultures. The proliferation at 10 d, 12 d and 30 d increased by 25.5%, 13.6% and 49.1% compared with the control group, respectively.

[0028] Table 1 MiR319a - Proliferation (g) of OE longan embryogenic culture and control group

[0029] MiR319a The results of the determination of triglyceride content in OE embryogenic cultures are shown in Table 2 (using the plant triglyceride detection kit from Suzhou Keming Biotechnology Co., Ltd.). Overexpression of miR319a can significantly promote the triglyceride content in longan embryogenic cultures. The triglyceride content at 10 d, 12 d and 30 d of culture increased by 16.3%, 11.4% and 172.4% compared with the control, respectively.

[0030] Table 2. Triglyceride content (mg / g) in MiR319a-OE longan embryonic culture and control group.

[0031] MiR319a The results of the determination of flavonoid content in OE embryonic cultures are shown in Table 3 (using the plant flavonoid detection kit of Suzhou Keming Biotechnology Co., Ltd.). Overexpression of miR319a can significantly promote the flavonoid content in longan embryonic cultures. After 30 days of culture, the flavonoid content increased by 11.8% compared with the control group.

[0032] Table 3 Flavonoid content (mg / g) in MiR319a-OE longan embryonic culture and control group

[0033] The above results indicate that MiR319a Overexpression of miR319a in the OE transgenic embryonic cell line can significantly accelerate the development of longan somatic embryos, promote the proliferation of embryonic cultures, and increase the content of functional metabolites such as triglycerides and flavonoids.

[0034] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A miR319a that increases the flavonoid and triglyceride content of longan embryogenic cultures, characterized in that: The primary form of miR319a, pri-miR319a, is shown in SEQ ID NO:1; the mature form sequences are shown in SEQ ID NO:2~4 respectively.

2. A recombinant expression vector, characterized in that: The primary body sequence comprising miR319a as described in claim 1.

3. A recombinant engineered bacterium, characterized in that: The recombinant expression vector of claim 2 is transferred into the vector via freeze-thaw conversion.

4. A transgenic embryogenic callus, characterized in that: It contains the recombinant expression vector of claim 2 or the recombinant engineered bacteria of claim 3.

5. The application of miR319a as described in claim 1 in regulating flavonoids and triglycerides in longan embryogenic cultures.

6. The application according to claim 5, characterized in that: Overexpression of miR319a was used to increase the content of flavonoids and triglycerides in longan embryogenic cultures.

7. The application according to claim 5, characterized in that: Overexpression of miR319a can also increase the proliferation of longan embryogenic cultures.

8. The application according to claim 5, characterized in that: By infecting longan embryonic callus with the recombinant engineered bacteria described in claim 3, transgenic longan embryonic callus overexpressing miR319a was obtained.

9. The application according to claim 8, characterized in that: The culture period for the longan embryonic callus is 10-20 days.

10. A method for increasing the flavonoid and triglyceride content in longan embryogenic cultures by overexpressing miR319a, characterized in that: Overexpression of miR319a in longan embryogenic callus was used to increase the content of flavonoids and triglycerides in longan embryogenic cultures. The sequence of the primary form pri-miR319a is shown in SEQ ID NO:1, and the sequences of the mature form are shown in SEQ ID NO:2~4, respectively.

Images