Northern root-knot nematode mhpfn1 gene and application thereof

Abstract

The application provides a northern root-knot nematode MhPFN1 gene and application thereof, and an amino acid sequence of a protein encoded by the MhPFN1 gene is shown as SEQ ID NO:2. The MhPFN1 gene of the northern root-knot nematode is identified for the first time, and the function thereof is verified, the expression amount of the MhPFN1 gene is significantly up-regulated in a nematode infection stage, the protein coded by the MhPFN1 gene is a secretion protein of the nematode, and the protein is located in the nucleus and cytoplasm of tobacco, can inhibit hypersensitive necrosis triggered by BAX, and the plant height of tobacco after overexpression of the MhPFN1 is significantly higher than that of a wild type; the parasitic amount of the nematode is significantly reduced after the MhPFN1 gene is silenced, which provides a research basis for developing new plants resistant to the northern root-knot nematode and provides a new idea for biological control of the northern root-knot nematode.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a MhPFN1 gene of the northern root-knot nematode and its application. Background Technology

[0002] Root-knot nematodes (Meloidogyne spp.) are among the most damaging obligate parasitic soil-borne nematodes in global agricultural production. Among them, the northern root-knot nematode (Meloidogyne hapla) has a wide host range and strong cold resistance. It has broken out in greenhouse vegetable and soybean production areas in northern my country for many years, causing the formation of a large number of root knots, disrupting water and nutrient absorption, and resulting in serious yield reduction and quality decline.

[0003] PFN1, short for Profilin 1, is a highly conserved actin-binding protein encoding gene in eukaryotes. It encodes a small, globular protein of approximately 15 kDa and is widely found in animals, nematodes, plants, and fungi. It is a core housekeeping gene regulating the dynamic assembly of the actin cytoskeleton. Three profilin subtypes (PFN1 / PFN2 / PFN3) are typically present in nematode genomes. MhPFN1 in the northern root-knot nematode is its species-specific homolog (named according to the species abbreviation Meloidogyne hapl + PFN1 → MhPFN1), but a complete functional analysis has not yet been reported. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a MhPFN1 gene of the northern root-knot nematode and its application, so as to provide a research basis for developing new plants resistant to the northern root-knot nematode and provide new ideas for the biological control of the northern root-knot nematode.

[0005] The technical solution adopted in this invention is as follows:

[0006] According to one aspect of this application, the present invention provides a MhPFN1 gene of the northern root-knot nematode, the amino acid sequence of the protein encoded by the MhPFN1 gene being shown in SEQ ID NO: 2.

[0007] In one specific embodiment, the coding region sequence of the MhPFN1 gene is shown in SEQ ID NO: 1.

[0008] In one specific embodiment, the MhPFN1 gene was expressed at the highest level in the second instar larvae of the northern root-knot nematode.

[0009] Through research, this invention found that the expression level of the MhPFN1 gene is significantly upregulated during the nematode infection stage, and the encoded protein is a secretory protein of the nematode, located in the nucleus and cytoplasm of tobacco cells.

[0010] According to another aspect of this application, the present invention also provides the application of the MhPFN1 gene of the northern root-knot nematode as described in any one of these claims in suppressing the allergic necrosis response in plants.

[0011] In one specific embodiment, the plant hypersensitive necrosis response is activated by the pro-apoptotic effector protein Bax.

[0012] In one specific embodiment, the plant is selected from tobacco, chili peppers, tomatoes, and cucumbers.

[0013] According to another aspect of this application, the present invention also provides a transgenic tobacco, wherein the genome of the transgenic tobacco is integrated with the MhPFN1 gene, and the amino acid sequence of the protein encoded by the MhPFN1 gene is shown in SEQ ID NO: 2.

[0014] In one specific embodiment, the coding region sequence of the MhPFN1 gene is shown in SEQ ID NO: 1.

[0015] According to another aspect of this application, the present invention also provides the application of the MhPFN1 gene of *Strombus stenoptera* as described in any one of these claims in the control of *Strombus stenoptera*.

[0016] According to another aspect of this application, the present invention also provides a method for controlling northern root-knot nematodes by silencing or knocking out the MhPFN1 gene in the genome of the northern root-knot nematode.

[0017] The beneficial effects of the present invention include, but are not limited to:

[0018] This invention identifies the MhPFN1 gene of the northern root-knot nematode for the first time and verifies its function. The expression level of the MhPFN1 gene is significantly upregulated during the nematode infection stage. The encoded protein is a secretory protein of the nematode, located in the nucleus and cytoplasm of tobacco cells. It can inhibit BAX-induced hypersensitive necrosis. After overexpression of MhPFN1, the plant height of tobacco is significantly higher than that of wild type. The parasitism of nematodes is significantly reduced after the MhPFN1 gene is silenced. This provides a research basis for developing new plants resistant to the northern root-knot nematode and provides a new idea for the biological control of the northern root-knot nematode. Attached Figure Description

[0019] Figure 1 Signal peptide sequence analysis of the protein encoded by the MhPFN1 gene;

[0020] Figure 2 Sequence analysis of the transmembrane domains of the protein encoded by the MhPFN1 gene;

[0021] Figure 3 The expression of the MhPFN1 gene at different infection stages of *Strombus heterophylla*.

[0022] Figure 4 Prokaryotic expression of the protein encoded by the MhPFN1 gene; A: SDS-PAGE verification; B: Western Blot verification

[0023] Figure 5 The results of MhPFN1 protein observation under a fluorescence microscope;

[0024] Figure 6 The localization of MhPFN1 protein in tobacco cells;

[0025] Figure 7 The inhibitory effect of MhPFN1 protein on allergic necrosis;

[0026] Figure 8 The results are from the PCR identification of genetically modified tobacco.

[0027] Figure 9 The growth status of genetically modified tobacco;

[0028] Figure 10 The expression level of the MhPFN1 gene in *Northern Root-Knot Nematode* after MhPFN1 gene silencing;

[0029] Figure 11 The number of root knots in tobacco plants after MhPFN1 gene silencing. Detailed Implementation

[0030] The present invention will be described in detail below with reference to specific embodiments. The following embodiments are only for the purpose of enabling those skilled in the art to understand the technical solutions of the present invention, implement or use the present invention, and are not intended to limit the scope of protection of the present invention.

[0031] In this invention, unless otherwise specified, all raw materials and equipment used can be purchased from the market or are commonly used in the field. Unless otherwise specified, the methods in the embodiments are conventional methods in the field.

[0032] Example 1: Cloning and Sequence Analysis of the MhPFN1 Gene

[0033] Total RNA was extracted from second-instar larvae (J2) of *Strombus haematobium* using the Trizol method. The RNA was then reverse transcribed into cDNA using the Revert Aid FirstStrand cDNA Synthesis Kit (Roche Diagnostics, Indianapolis, USA). Primers MhPFN1-fF and MhPFN1-fR were designed based on the full-length CDS sequence of the MhPFN1 gene from the *Strombus haematobium* genome (https: / / parasite.wormbase.org / Meloidogyne_hapla_prjna29083 / Info / Index / ).

[0034] MhPFN1-fF: ATGAGTGGCTGGTCTGCTTACAT (SEQ ID NO: 3)

[0035] MhPFN1-fR: TTAATACCCTGCTTCATCCAAGAA (SEQ ID NO: 4)

[0036] Then, PCR amplification was performed using J2 cDNA as a template. The amplification system consisted of: 1 μL cDNA template, 2.5 μL each of primers (10 μM), 30 μL ddH2O, 1 μL KOD plus-Neo, 5 μL 10× Buffer, 5 μL dNTPs, and 3 μL MgSO4. The PCR program was: 94℃ for 2 min, 35 × (94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s), 72℃ for 10 min, and stored at 4℃.

[0037] The full-length CDS sequence of the MhPFN1 gene was obtained by PCR amplification, as shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0038] Further analysis was conducted on the signal peptide and transmembrane domain of the MhPFN1 protein from the northern root-knot nematode. Specifically, the amino acid sequence of the MhPFN1 protein (SEQ ID NO: 2) was input into the online signal peptide prediction software SignalP 5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ) in FASTA format. The parameters were set as follows: the organism group was selected as Eukaryotes; the output format was selected as Standard output; and the splicing site determination was automatically performed using the software's default D-score cutoff (the default commonly used setting is 0.450). The prediction results are as follows. Figure 1 As shown, the D-value of this protein sequence is significantly lower than the system threshold, indicating that there is no signal peptide structure in the MhPFN1 protein sequence. The amino acid sequence of the MhPFN1 protein (SEQ ID NO: 2) was input in FASTA format into the online transmembrane domain prediction software TMHMM Server v.2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ). All parameters were set to the software's default settings, and the submission type was selected as peptide sequence. This software predicts transmembrane helical segments based on a Hidden Markov Model (HMM). The prediction results are as follows: Figure 2 As shown, the expected number of transmembrane amino acids (AAs in TMHs) of this protein is extremely low, failing to reach the threshold for transmembrane helix determination, indicating that the MhPFN1 protein lacks transmembrane domains.

[0039] Example 2 Expression pattern of the MhPFN1 gene

[0040] The swollen parts of pepper roots 45 days after nematode infection were directly picked up with tweezers and placed on wire mesh filter paper. Sterile water containing 0.1% streptomycin sulfate was added, and the larvae were incubated at room temperature to obtain second-instar larvae before infection. Root-knot nematode eggs were collected according to Liu Weizhi (2000). Approximately 150 root-knot nematodes were inoculated into each pepper plant, and the inoculated peppers were placed in a 28°C-30°C light incubator. Pepper plants were collected at different inoculation time points: 7 days, 14 days, and 21 days, with 5 plants collected from each time point. Finally, the root knots of the pepper roots were selected, placed in clean 1.5 mL centrifuge tubes, and stored at -80°C. RNA was extracted from the eggs, J2, and root tissues at different infection stages of *Streptomyces cerevisiae* using Trizol.

[0041] cDNA was synthesized according to the instructions of the reverse transcription kit (Revert Aid First Strand cDNA Synthesis Kit, Roche Diagnostics, Indianapolis, USA). The MhACT gene from the northern root-knot nematode was used as an internal control, with primer sequences MhActin-RT-F and MhActin-RT-R. The relative expression level of the MhPFN1 gene was analyzed according to the procedures and systems in the Taq Pro Universal SYBR Qpcr MasterMix (Vazyme, China) manual, with primer sequences MhPFN1-qF and MhPFN1-qR. The primer sequences are shown below:

[0042] MhActin-RT-F: ACACGCCAGCCATGTATGTTGCT (SEQ ID NO: 5)

[0043] MhActin-RT-R:AAATCACCGTCCAGCCAAGTC (SEQ ID NO: 6)

[0044] MhPFN1-qF:GGTCTGCTTACATCAAAACAT (SEQ ID NO: 7)

[0045] MhPFN1-qR: AGCAAAAAATCCAGTCTTATC (SEQ ID NO: 8)

[0046] The expression level of the MhPFN1 gene in eggs, second-instar larvae, and 7-21 days post-infection of *Strombus haematobium* was detected using quantitative qPCR. Figure 3 As shown, the results indicate that the gene is expressed at the highest level in second-instar larvae.

[0047] Example 3 Distribution of MhPFN1 protein in plant root tissues

[0048] pET28a was double-digested with Nde I / Xho I to construct the pET28a-MhPFN1 vector using a seamless cloning method. After sequencing verification, the vector was used for subsequent experiments. The constructed plasmid was further transformed into competent *E. coli* cells and cultured at 37°C in liquid medium containing 30 µg / ml kanamycin until the OD value reached 0.6. Then, 0.5 mMIPTG was added, and the cells were cultured overnight at 20°C and then for 6 h at 37°C. The cells were then collected by centrifugation at 4000 rpm for 10 min. After cell lysis, the recombinant MhPFN1 protein was obtained by affinity chromatography, following the instructions of the Merck Ni-NTAHis Bind kit. The results were validated by SDS-PAGE and Western blotting. Figure 4 As shown, 6 mg of recombinant protein with a purity >85% was obtained.

[0049] Using the prepared MhPFN1 recombinant protein as the antigen, it was emulsified with Freund's complete adjuvant and injected into New Zealand white rabbits in three doses. Small blood samples were collected from the ear veins of the rabbits, and antibody titers were detected by ELISA. Antibody titers ≥128K and positive bands were observed in the Western blotting experiment. After passing the tests, arterial blood was collected from the rabbits, and the antiserum was aliquoted and stored at -20℃.

[0050] Tomato root knots infected with *Strombus heterophyllum* (northern root-knot nematode) for 7 days were collected, treated with fixative (FAA), dehydrated, and then embedded in paraffin. The embedded paraffin blocks were sectioned (5 μm) on a paraffin microtome, placed on slides coated with adhesive, and dried in a 42°C developing stage. Subsequently, the tissue sections underwent dewaxing, antigen retrieval, blocking, antibody incubation, and staining, and were finally observed under a fluorescence microscope. Figure 5 As shown, fluorescence signals were observed in plant cells.

[0051] Example 4 Subcellular localization analysis

[0052] Using pYL322d1 / N-eGFP plasmid as a template, the coding region sequence of MhPFN1 was inserted into the Sma I restriction site using seamless cloning technology. The procedure and system followed the instructions of the ClonExpress-Entry One Step Cloning (Vazyme, China) kit. The pYL322d1-MhPFN1-eGFP vector was constructed. After correct sequencing, both the pYL322d1 and pYL322d1 / N-eGFP vectors were transformed into Agrobacterium strain GV3101 for transient transformation of tobacco. The localization of the fusion protein was observed under a confocal microscope after 2-3 days. Figure 6As shown, obvious fluorescent signals were observed in the nucleus and cytoplasm of tobacco cells, indicating that MhPFN1 is localized in the nucleus and cytoplasm of tobacco cells.

[0053] Example 5: Detection of Allergic Necrosis

[0054] The constructed plasmid vector pYL322d1-MhPFN1-eGFP was transformed into Agrobacterium GV3101 strain. After overnight activation with shaking, the bacterial cells were collected by centrifugation, resuspended in buffer, and the absorbance of the suspension was adjusted to OD600 = 0.5. The buffer formulation was: 10 mM MgCl2, 10 mM MES, and 200 µM acetylsylcholine. Tobacco plants cultured in a greenhouse for 6 weeks were selected. 200 µL of Agrobacterium suspension carrying the pYL322d1-MhPFN1-eGFP vector was injected into the lower epidermal cells of tobacco plants using a syringe without the needle. pYL322d1-eGFP and buffer were used as negative and blank controls, respectively. After 24 h of culture, Agrobacterium suspension carrying the Bax protein expression vector pGR107 was injected into tobacco leaves. Five days after injection treatment, the cell necrosis phenotype of leaves at each infection site was observed and statistically analyzed.

[0055] like Figure 7 As shown, simultaneous injection of both plasmids expressing MhPFN1 and Bax into tobacco plants did not result in necrosis, while injection of only the Bax-expressing plasmid resulted in cell necrosis. This indicates that MhPFN1 can inhibit Bax-induced necrosis.

[0056] Example 6 Phenotypic Identification of Transgenic Tobacco

[0057] Genetic transformation of the MhPFN1 gene was performed using the Agrobacterium-mediated leaf disc method. Through four stages—leaf disc co-culture, callus formation, resistant shoot and root induction—and hygromycin resistance screening, well-growing transgenic tobacco plants stably expressing MhPFN1 were obtained. Specifically, the bacteria were co-cultured with MhPFN1-positive Agrobacterium on a co-culture medium (MS + 30 g / L sucrose + 6 g / L agar + 1 mg / L 6-BA + 0.2 mg / L NAA + 100 μmol / L AS, pH 5.8) for 3 days, and then transferred to a selection medium (MS + 30 g / L sucrose + 6 g / L agar + 1 mg / L 6-BA + 0.2 mg / L NAA + 20 mg / L Hyg + 100 mg / L Tim, pH 5.8) to induce callus and resistant shoot formation. The resistant shoots were further screened for resistance on a rooting medium (1 / 2 MS + 20 g / L sucrose + 6 g / L agar + 0.1 mg / L IBA + 25 mg / L Hyg + 100 mg / L Tim, pH 5.8). RNA was further extracted from individual transgenic tobacco plants and amplified by PCR using MhPFN1 gene-specific primers (MhPFN1-qF and MhPFN1-qR) to identify transgenic tobacco plants overexpressing MhPFN1.

[0058] like Figure 8 and 9 As shown, transgenic tobacco plants overexpressing MhPFN1 are more robust than wild-type tobacco plants.

[0059] Example 7: Effects of MhPFN1 gene silencing on the parasitism and reproductive capacity of *Strombus hirsutus*.

[0060] Based on the coding region sequence of the MhPFN1 gene, three RNAi-specific interference targets were screened using online primer design software. The selected regions were free of signal peptides and transmembrane domains, and had low sequence mismatch rates. The lengths of the three target fragments were all controlled within 150–200 bp, and their corresponding nucleotide sequences are shown in SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. These three target fragments were obtained by PCR amplification and cloned into the virus-induced gene silencing vector pTRV2 using EcoRI and BamHI double restriction enzyme sites, respectively, to construct recombinant plasmids pTRV2:MhPFN1-1, pTRV2:MhPFN1-2, and pTRV2:MhPFN1-3. After sequencing verification, they were used for further testing. The empty vector pTRV2 was used as a negative control.

[0061] The recombinant plasmid and pTRV1 were transformed into Agrobacterium tumefaciens strain GV3101. Single colonies were picked and placed in LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampin, and cultured at 28°C and 200 rpm until the OD600 was approximately 1.0. The cells were collected by centrifugation at 12000 rpm for 10 min, resuspended in resuspending buffer (10 mM MgCl2, 10 mM MES, 200 μM AS), and the OD was adjusted. 600 To a concentration of 0.6-1. Mix equal volumes of Agrobacterium tumefaciens resuspension containing pTRV1 and resuspensions containing pTRV2:MhPFN1-1 / 2 / 3 or pTRV2 respectively at a 1:1 (v / v) ratio, and let stand at room temperature in the dark for 3 h. Select tobacco plants that have grown to the 4-5 leaf stage, and use a 1 mL needleless syringe to inject the mixed Agrobacterium tumefaciens solution from the underside of the leaves to infect the entire leaf mesophyll tissue.

[0062] After infection, tobacco leaves were injected and cultured in a greenhouse at 25℃ with a 16-hour light / 8-hour dark cycle. Ten days after infection, 500 newly hatched, viable second-instar larvae of the northern root-knot nematode were evenly inoculated around the rhizosphere of each tobacco plant. The soil was kept moderately moist after inoculation, and the plants continued to be cultured in the greenhouse to provide nematode parasitism. Fourteen days after nematode inoculation, tobacco roots from each group were randomly and completely excavated. After washing, nematodes parasitizing within the root knots were carefully picked out under a microscope. Total RNA was extracted from the nematodes using a micro-total RNA extraction kit and reverse transcribed into cDNA. The nematode Mh-actin gene was used as an endogenous internal reference gene, and real-time quantitative PCR (qRT-PCR) was performed using specific primer pairs for detection. -ΔΔCt The relative expression levels of the endogenous MhPFN1 gene in nematodes within different target fragment treatment groups were calculated to assess the silencing efficiency. Thirty-five days after nematode inoculation, tobacco roots from each group were completely harvested and the soil washed away. The number of root knots and oocysts on each tobacco rootstock were carefully counted under a stereomicroscope to evaluate the impact of MhPFN1 gene silencing on the parasitic and reproductive capacity of *Strombus heterophylla*.

[0063] qRT-PCR results showed that the expression level of the MhPFN1 gene was significantly decreased to varying degrees in tobacco plants inoculated with the northern root-knot nematode expressing the MhPFN1 interference fragment. Figure 10 As shown, compared with the control group injected with the empty vector, the expression level of endogenous MhPFN1 gene in nematodes infected with the pTRV2:MhPFN1-1, pTRV2:MhPFN1-2 and pTRV2:MhPFN1-3 interference vectors was significantly reduced by 68.5%, 72.1% and 58.4% respectively (P < 0.01), indicating that the three designed RNAi target regions can successfully and efficiently knock down the expression of target genes in nematodes.

[0064] Pathogenicity of tobacco roots was statistically analyzed 35 days after inoculation, and the results are as follows: Figure 11 As shown in the figure, compared with the control group, the number of root knots was significantly reduced in the treatment group where the MhPFN1 gene was silenced, indicating that the parasitic and reproductive capacity of nematodes was severely suppressed.

[0065] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

Claims

1. A MhPFN1 gene of the northern root-knot nematode, characterized in that, The amino acid sequence of the protein encoded by the MhPFN1 gene is shown in SEQ ID NO:

2.

2. The MhPFN1 gene of the northern root-knot nematode according to claim 1, characterized in that, The coding region sequence of the MhPFN1 gene is shown in SEQ ID NO:

1.

3. The MhPFN1 gene of the northern root-knot nematode according to claim 1, characterized in that, The MhPFN1 gene was expressed at the highest level in the second instar larvae of the northern root-knot nematode.

4. The application of the MhPFN1 gene of the northern root-knot nematode as described in any one of claims 1-3 in suppressing the allergic necrosis response in plants.

5. The application according to claim 4, characterized in that, The plant hypersensitive necrosis response is triggered by the pro-apoptotic effector protein Bax.

6. The application according to claim 4 or 5, characterized in that, The plants were selected from tobacco, chili peppers, tomatoes, and cucumbers.

7. A genetically modified tobacco, characterized in that, The genome of the transgenic tobacco contains the MhPFN1 gene, and the amino acid sequence of the protein encoded by the MhPFN1 gene is shown in SEQ ID NO:

2.

8. The genetically modified tobacco according to claim 7, characterized in that, The coding region sequence of the MhPFN1 gene is shown in SEQ ID NO:

1.

9. The application of the MhPFN1 gene of *Strombus chinensis* as described in any one of claims 1-3 in the control of *Strombus chinensis*.

10. A method for controlling root-knot nematodes in northern regions, characterized in that, Silencing or knocking out the MhPFN1 gene in the genome of the northern root-knot nematode.

Images