A high-yield d-pantothenic acid genetically engineered bacterium dynamically regulating panE expression, a construction method and application thereof

Abstract

This invention discloses a high-D-pantothenic acid-producing genetically engineered bacterium with dynamically regulated PanE expression, its construction method, and its applications. Using the EcPanE crystal structure from *E. coli* as a template, the spatial structures of CgPanE from *Corynebacterium glutamicum* and BsPanE2 from *Bacillus subtilis* were simulated. The size of the active pocket cavity of the proteins was tested and compared. Combined with fermentation data and HPLC / MS data, it was found that proteins with larger active pockets, BsPanE and EcPanE, exhibit bifunctional activity. Then, BsPanBC and EcPanE were constructed on plasmid pEC-XK99E and introduced into the engineered strain DPAj-2. The plasmid controlling EcpanE was stabilized by comparing strong and weak promoters. Finally, the precursor α-ketoisovalerate of the strain was completely transformed, and the D-pantothenic acid yield increased from 3.78 g / L to 4.39 g / L compared to the weak promoter.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and relates to a high-D-pantothenic acid-producing genetically engineered bacterium that dynamically regulates PanE expression, its construction method, and its applications. Background Technology

[0002] Ketopantoacid reductase (EC 1.1.1.169) is an enzyme that catalyzes the second step of the pantothenic acid synthesis pathway. Bacterial genome evolution and adaptation may originate from processes such as horizontal gene transfer (HGT) or gene modification. The function of ketopantoacids in bacteria can differentiate during strain evolution. For example, *Pseudomonas aeruginosa* contains two non-clustered paralogous genes of the *panE* gene. PanE2 has been shown to be inactive for ketopantoacids but can catalyze the conversion of α-keto acids to their corresponding α-hydroxy acids. *Bacillus subtilis* exhibits a similar phenomenon, also possessing two ketopantoacid homologs. However, most studies on D-pantothenic acid production use PanE1 from *Bacillus subtilis*, only speculating that PanE2 / PanG, like PanE1, participates in the pantothenic acid synthesis pathway and is therefore labeled as having ketopantoacid function. Furthermore, previous studies have shown that ketopantoacid in Corynebacterium glutamicum is encoded only by the gene ilvC, but the Corynebacterium glutamicum genome contains a gene annotated as panE (CGL_RS05435), which encodes a protein presumably 2-dehydropantoacid 2-reductase. Whether these proteins are related to the D-pantoacid biosynthesis pathway has not yet been experimentally verified.

[0003] Exponential growth promoters (or growth-dependent promoters) are an important tool for dynamic regulation. The activity of these promoters is tightly coupled to the cell's growth rate, typically peaking during the exponential growth phase and decreasing or shutting down during the stationary phase or in nutrient-deprived conditions. This natural coupling with cell growth rate allows for "delayed initiation" or "programmed activation" of target protein expression. The core mechanism is that during exponential growth, these promoters have low activity, allowing cells to concentrate most of their resources and energy on rapid proliferation, efficiently accumulating biomass and building a robust primary metabolic network, laying the material foundation for subsequent production. As the culture enters the late exponential growth phase and the stationary phase, promoter activity significantly increases due to growth rate drive, thereby initiating the synthesis of downstream target proteins (such as key enzymes in pathways) at the appropriate time. This "growth first, production later" time decoupling strategy effectively delays protein expression. Stationary promoters provide metabolic engineering with a dynamic regulatory tool that separates the cell growth phase from the product synthesis phase in time, particularly suitable for fermentation processes where high yields depend on high cell density, or for optimizing complex pathways that require avoiding premature accumulation of toxic intermediates.

[0004] Currently, there are no reports on the systematic construction of high-yield D-pantothenic acid genetically engineered bacteria by combining functional screening of homologs from different sources of the PanE family with dynamic regulation of stationary promoters. Summary of the Invention

[0005] To address the aforementioned issues, this invention presents a high-yield D-pantothenic acid genetically engineered bacterium that dynamically regulates PanE expression, its construction method, and its applications.

[0006] The technical solution adopted in this invention is:

[0007] The first objective of this invention is to provide a method for constructing a high-D-pantothenic acid-producing genetically engineered bacterium with dynamically regulated PanE expression, comprising the following steps:

[0008] Step 1: Select the EcPanE crystal structure (PDB: 1KS9) from Escherichia coli as a homology modeling template, and use the SWISS MODEL website to simulate the spatial structure of CgPanE in Corynebacterium glutamicum and BsPanE2 in Bacillus subtilis.

[0009] Step 2: Using the ProteinsPlus web server, predict and compare the active pocket cavity area of ​​five PanE proteins; the five PanE proteins are the predicted CgPanE and BsPanE2, PaPanE2 (PDB: 8IWG) from Pseudomonas aeruginosa, BsPanE (PDB: 3EGO) from Bacillus subtilis, and EcPanE from Escherichia coli.

[0010] Step 3: Using plasmid pECXK99E as a vector, connect the BspanE gene and BspanE2 gene from Bacillus subtilis, the EcpanE gene from Escherichia coli, and the CgpanE gene from Corynebacterium glutamicum to construct a series of recombinant plasmids, named pECXK99E-BspanE, pECXK99E-BspanE2, pECXK99E-EcpanE, and pECXK99E-CgpanE, respectively.

[0011] Step 4: Using plasmid pECXK99E as a vector, the four panE genes from Step 3 were ligated to the gene cluster BspanBC from Bacillus subtilis 168 to construct a series of recombinant expression plasmids, named pECXK99E-BspanBCBspanE1, pECXK99E-BspanBCBspanE2, pECXK99E-BspanBCEcpanE and pECXK99E-BspanBCCgpanE, respectively.

[0012] Step 5: Replace the promoter of the EcpanE gene in the recombinant expression plasmid described in Step 4 with the stationary phase promoter P. 4-N14 or weak promoter P dapB Recombinant expression plasmids with modified promoters were constructed and named pECXK99E-BspanBC+P 4-N14 -EcpanE、pECXK99E-BspanBC+P dapB -EcpanE;

[0013] Step 6: Transform the series of recombinant expression plasmids obtained in Step 4 and the recombinant expression plasmids with promoter modification obtained in Step 5 into strain DPAj-2 for fermentation. Use the synthesis yield of D-pantothenic acid and the accumulation level of the byproduct α-ketoisovalerate as dual screening indicators. The engineered strain obtained by screening is the high-yield D-pantothenic acid genetically engineered bacterium that dynamically regulates PanE expression.

[0014] As a preferred embodiment of this application, the recombinant plasmid constructed in step 3 and the recombinant expression plasmid constructed in step 4 need to be introduced into strain DPAj-2 for fermentation testing. The fermentation broth is analyzed by HPLC-MS to detect metabolites (such as KIV and D-pantothenic acid), and the obtained data is analyzed using Qualitative Analysis B.07.00 software to verify the functions of CgPanE and BsPanE2.

[0015] As a preferred embodiment of this application, the host bacteria in step 1 are Corynebacterium glutamicum ATCC 13032 and Bacillus subtilis 168.

[0016] As a preferred embodiment of this application, the amino acid sequence of EcPanE from E. coli is shown in SEQ ID NO.1.

[0017] As a preferred embodiment of this application, the amino acid sequences of BsPanE1 and BsPanE2 from B. subsills are shown in SEQ ID NO.2.

[0018] As a preferred embodiment of this application, the amino acid sequence of BsPanE2 from B. subsills is shown in SEQ ID NO.3.

[0019] As a preferred embodiment of this application, the amino acid sequence of CgPanE from C. glutamicum is shown in SEQ ID NO.4.

[0020] As a preferred embodiment of this application, the stable-period promoter is P. 4-N14 It is derived from C. glutamicum, and its nucleotide sequence is shown in SEQ ID NO.5.

[0021] As a preferred embodiment of this application, the weak promoter is P. dapB It is derived from C. glutamicum, and its nucleotide sequence is shown in SEQ ID NO.6.

[0022] A second objective of the present invention is to provide a genetically engineered bacterium obtained according to the construction method described above.

[0023] A third objective of this invention is to provide the application of the aforementioned genetically engineered bacteria in the microbial fermentation preparation of D-pantothenic acid.

[0024] As a preferred embodiment of this application, the application is as follows: the genetically engineered bacteria are inoculated into a fermentation medium and fermented at 30°C and 200 rpm for 48-60 h. After fermentation, the supernatant of the fermentation broth is separated and purified to obtain the D-pantothenic acid. The fermentation medium has the following composition: glucose: 10-30 g / L, corn steep liquor: 10-20 g / L, ammonium sulfate: 10-20 g / L, yeast extract: 1-5 g / L, KH2PO4: 0.2-1 g / L, MgSO4: 0.5-5 g / L, sodium acetate: 5-8 g / L, β-alanine: 0.5-2 g / L, CaCO3: 3-5 g / L, and a 0.5-2 mL / L trace element solution in deionized water with a natural pH. The trace element solution has the following composition: NiCl2·7H2O 0.02 g / L, CuCl2 10 g / L, FeSO4·7H2O 10 g / L. The concentrations of the following components were: g / L ZnSO4·7H2O 10 g / L, CuSO4 0.2 g / L, and the solvent was deionized water.

[0025] According to literature reports, PaPanE2 is inactive for KPL, but belongs to the same superfamily as PaPanE1 and has a similar tertiary structure. The key lysine residue (Lys176 in *E. coli*) involved in the structural conversion of KPL to pantothenic acid is completely conserved in PaPanE2. The most significant difference in PaPanE2 is that the substitution of several amino acid residues with more hydrophilic residues leads to a shrinkage of the active site and a reduction in cavity volume, indicating that a larger active pocket cavity is beneficial for the catalysis of the large substrate ketopantothenic acid. By comparing the active pocket volumes of several proteins, it was found that compared to proteins with large active pockets, EcPanE (Volume: 1613.31 ų) and BsPanE (Volume: 1486.94 ų), CgPanE (Volume: 1350.34 ų), BsPanE2 (Volume: 1281.02 ų), and PaPanE2 (Volume: 1078.78 ų) have smaller active pocket volumes. This suggests that the functions of CgPanE and BsPanE2 may be more similar to those of PaPanE2, namely α-hydroxy acid dehydrogenase, rather than ketopantoacid reductase. These panE genes were constructed into plasmid pECXK99E to obtain plasmids pECXK99E-BspanE, pECXK99E-BspanE2, pECXK99E-EcpanE, and pECXK99E-CgpanE. Alternatively, they were ligated with panBC genes from Bacillus subtilis and then constructed into plasmid pECXK99E to obtain plasmids pECXK99E-BspanBCBspanE1, pECXK99E-BspanBCBspanE2, pECXK99E-BspanBCEcpanE, and pECXK99E-BspanBCCgpanE. These plasmids were then transformed into DPAj-2 for testing. HPLC-MS revealed that EcPanE and BsPanE possess both ketopanolytic acid dehydrogenase and α-hydroxy acid dehydrogenase activities, while CgPanE and BsPanE2 only possess α-hydroxy acid dehydrogenase activity.

[0026] EcPanE possesses bifunctional activity, capable of converting both ketopantolytic acid and the precursor α-ketoisovalerate. This can lead to premature conversion of the precursor by strongly expressed EcPanE, resulting in carbon source waste and impacting the final yield of D-pantothenic acid. Previous studies designed a CPSPC system to delay EcPanE expression. While this system effectively reduced precursor consumption, it resulted in insufficient EcPanE expression, leading to incomplete precursor conversion. To both delay EcPanE expression and achieve a certain level of expression intensity, the stationary promoter P... 4-N14The expression of EcPanE was dynamically regulated. The results showed that compared with the strong promoter Ptrc, the precursor was completely consumed; compared with the weak promoter PdapB, the precursor was completely converted, and the production of D-pantothenic acid was increased.

[0027] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0028] (1) By comparing the size of the active pocket cavity of PanE from different sources, this invention found that the active pocket cavity of enzymes that can catalyze ketopantolytic acid has a larger area and can accommodate larger substrates.

[0029] (2) HPLC-MS confirmed that EcPanE and BsPanE have both ketopanolytic acid dehydrogenase activity and α-hydroxy acid dehydrogenase activity, while CgPanE and BsPanE2 only have α-hydroxy acid dehydrogenase activity.

[0030] (3) Using the stationary promoter P 4-N14 Dynamic regulation of EcPanE expression was achieved, both delaying and maintaining a certain level of expression. The precursor material in the strain was completely transformed, increasing D-pantothenic acid production to 4.39 g / L. Attached Figure Description

[0031] Figure 1 The three-dimensional structures of the predicted CgPanE and BsPanE2 are shown.

[0032] Figure 2 The active pocket size of PanE three-dimensional structures from different sources.

[0033] Figure 3 The image shows the liquid phase diagram of the DPAj-2 strain after several plasmids were transformed into the strain, including peaks A, B, and C.

[0034] Figure 4 The values ​​represent the relative molecular masses of peaks A, B, and C as detected by HPLC / MS.

[0035] Figure 5 For strong promoter Ptrc, weak promoter PdapB, and stable promoter P 4-N14 A diagram of fermentation products after regulating PanE expression. Detailed Implementation

[0036] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0037] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.

[0038] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.

[0039] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0040] Unless otherwise specified, the experimental materials used in the following examples are all conventional biochemical reagents.

[0041] In the following examples, the final concentration of kanamycin in the culture medium was 0.025 mg / L.

[0042] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent: deionized water, pH: natural.

[0043] LB solid medium: Add 2% (by mass / volume fraction) agar powder to LB liquid medium.

[0044] BHIS liquid culture medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, 10 g / L glucose, 10 g / L brain and heart extract powder, solvent: deionized water, pH: natural.

[0045] BHIS plates: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, 10 g / L glucose, 10 g / L brain and heart extract, solvent: deionized water, 2% (w / v) agar powder, pH: natural.

[0046] The strain Corynebacterium glutamicum ATCC13032 (C. glutamicum ATCC 13032, purchased from the ATCC Collection). Strain DPAj-2 is a laboratory-preserved strain (disclosed in patent CN121825841A). Strain Bacillus subtilis 168 is (Chinese Microbial Culture Collection No.: bio-82277, purchased).

[0047] Table 1: Genes involved in gene editing and corresponding pathways

[0048] Gene name Involved methods EcpanE panE gene from E. coli BspanE1 panE1 gene from B. subsills BspanE2 panE2 gene from B. subsills CgpanE panE gene from Corynebacterium glutamicum BspanB panB gene from B. subsills BspanC panC gene from B. subsills

[0049] The primer sequence information used in Examples 2-7 is shown in Table 2:

[0050] Table 2: Primer sequences

[0051] Primers Sequence (5'-3') PECXK99E-F GAATTCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTC PECXK99E-R CTATATCTCCTTCATGGTCCATGGTCTGTTTCCTGTGTGAAATTG RBS-BspanE-F GACCATGAAGGAGATATAGATGAAAATTGGAATTATCG pECXK99E-BspanE-R AACAGCCAAGCTGAATTCTCAAAAGACTTTGTTTGTATTTC pECXK99E-BspanE2-R AAACAGCCAAGCTGAATTCTTATTTTTCTGCTTCATACATTTG RBS-BspanE2-F GACCATGAAGGAGATATAGATGAAATTTTTGGTTGTCGG RBS-panE-F ACCATGAAGGAGATATAGATGAAAATTGCGATCGTTGGCGCTG pEC99E-panE-R AAACAGCCAAGCTGAATTCTAAAGTGAATTTTCCTCTTCTTTC RBS-EcpanE-F GACCATGAAGGAGATATAGATGAAAATTACCGTATTGG pECXK99E-EcpanE-R AACAGCCAAGCTGAATTCCTACCAGGGGCGAGGCAAACC RBS-BspanBCD-F GACCATGAAGGAGATATAGATGAAAACAAAACTGGATTTTC RBS-BspanC-R CTATATCTCCTTCATGGTCTTATATTTCCTCCATTTCTC pECXK99E-EcpanE-R AACAGCCAAGCTGAATTCCTACCAGGGGCGAGGCAAACC RBS-EcpanE-F GACCATGAAGGAGATATAGATGAAAATTACCGTATTGG T2terpEC-PdapB-F ATTTTTCTAAATACATTCAAGGGCAACTTAAGTCTC EcpanE-PdapB-R CATCCCAATACGGTAATTTTCATTTATGCTCCTTCATTTTC EcpanE-F ATGAAAATTACCGTATTGGGATG T2terpEC-EcpanE-R CATGAGCGGATACATATTTCTACCAGGGGCGAGGCAAACCAG P4-N14-T2ter-R CCCAGCTGGCAACGTCCATATCCTTAATGTTGATTTGGAATGTATTTAGAAAAATAAAC P4-N14RBS-F TGGACGTTGCCAGCTGGGATGGTTAGAGACCATGAAGGAGATATAGATGAAAATTAC

[0052] Example 1: Determination of the content of α-hydroxyvalerate (KIV), D-pantothenic acid (D-PA) and amino acids

[0053] The detection methods for KIV and D-pantothenic acid are as follows: Chromatographic conditions: C18 column (250×4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA); detection wavelength: 200 nm; column temperature: 30℃; flow rate: 1 mL / min; mobile phase: acetonitrile / water / phosphoric acid (volume ratio 80 / 919 / 1); data acquisition time: 20 min. Sample preparation: Dilute the sample with ultrapure water to maintain the D-pantothenic acid content between 0.2 g / L and 1 g / L.

[0054] Example 2: Comparison of active pocket cavity size of PanE from different sources

[0055] Pseudomonas aeruginosa contains two non-clustered paralogous genes, panE1 and panE2. PanE1 catalyzes the conversion of keto-pantoacids and belongs to the keto-pantoacid dehydrogenase family. PanE2 does not catalyze the conversion of keto-pantoacids but can catalyze the conversion of α-keto acids to their corresponding α-hydroxy acids and belongs to the α-hydroxy acid dehydrogenase family (Basu Choudhury, G. and Datta, S., 2024. Implication of molecular constraints facilitating the functional evolution of pseudomonas aeruginosa kpr2 into a versatile α-keto-acid reductase. Biochem. 63: 1808-1823.). Both are structurally similar, and the key lysine residue involved in the conversion of KPL to pantoacids (Lys176 in E. coli) is completely conserved in PaPanE2. The most significant difference in PaPanE2 is that the substitution of several amino acid residues with more hydrophilic residues leads to a shrinkage of the active site and a reduction in the cavity volume. This may indicate that catalyzing larger substrates, such as ketone pantothenic acids, requires a larger active pocket volume.

[0056] (1) Simulation of the spatial structure of CgPanE and BsPanE: Using the EcPanE crystal structure (PDB:1KS9) from Escherichia coli as a homology modeling template, the spatial structure of CgPanE from Corynebacterium glutamicum and BsPanE2 from Bacillus subtilis was simulated using the SWISS MODEL website.

[0057] (2) Calculation of active pocket cavity of PanE: The active pocket cavity area of ​​5 proteins was tested and compared using the ProteinsPlus web server website, including the predicted CgPanE and BsPanE2, PaPanE2 from Pseudomonas aeruginosa (PDB: 8IWG), BsPanE from Bacillus subtilis (PDB: 3EGO) and EcPanE from Escherichia coli (PDB: 1KS9);

[0058] Depend on Figure 1As can be seen, the structures of CgPanE and BsPanE2 were simulated using the EcPanE crystal structure (PDB: 1KS9) as a template. These two structures, along with PaPanE2 (PDB: 8IWG) from *Pseudomonas aeruginosa*, BsPanE (PDB: 3EGO) from *Bacillus subtilis*, and EcPanE (PDB: 1KS9) from *Escherichia coli*, were used to calculate the size of the active pocket cavity using the online ProteinsPlus web server. Figure 2 It is evident that, compared to EcPanE (Volume: 1613.31 ų) and BsPanE (Volume: 1486.94 ų), PaPanE2 (Volume: 1078.78 ų), CgPanE (Volume: 1350.34 ų), and BsPanE2 (Volume: 1281.02 ų) have smaller active pocket areas. According to literature reports, EcPanE and BsPanE, which catalyze ketopantoacid dehydrogenase, have larger and more open active pocket areas compared to PaPanE2, which lacks this activity. Therefore, it is speculated that CgPanE and BsPanE2, with their more compact active pockets, may function more similarly to PaPanE2, i.e., they are more inclined towards α-hydroxy acid dehydrogenase than ketopantoacid dehydrogenase.

[0059] Example 3: Fermentation test of the function of PanE from different sources

[0060] To verify the functions of four PanE sources and their correlation with D-pantothenic acid synthesis, they were constructed on the plasmid pECXK99E (purchased from NovoPro). Furthermore, they were combined with the BspanBC operon from Bacillus subtilis to form an artificial operon, which was then constructed on the pECXK99E plasmid. These plasmids were then introduced into the engineered strain DPAj-2, which accumulates the precursor α-ketoisovalerate, to test metabolite production.

[0061] (1) Construction of plasmid pECXK99E-CgpanE: Using pECXK99E plasmid as a template, amplification was performed using ECXK99E-F / pEXK99E-nolaq-R primers to obtain a linearized plasmid, which was named pEXK99E; using C. glutamicum ATCC 13032 strain as a template, amplification was performed using RBS-panE-F / pEC99E-panE-R primers to obtain a fragment named CgpanE; the two PCR products amplified above were purified by gel recovery to obtain the purified fragment pEXK99E. pEXK99E and CgpanE were ligated together according to the Clon Express® (One step clone kit, Vazyme Biotech, Nanjing, China) instructions, transformed into E. coli DH5α, screened by kanamycin plates, and sequenced to verify the correct pECXK99E-CgpanE plasmid;

[0062] (2) Construction of plasmids pECXK99E-panE from different sources: Using Bacillus subtilis 168 as a template, the fragment obtained by amplification with RBS-BspanE-F / pECXK99E-BspanE-R was named BspanE; using Bacillus subtilis 168 as a template, the fragment obtained by amplification with RBS-BspanE2-F / pECXK99E-BspanE2-R was named BspanE2; using E. coli as a template, the fragment obtained by amplification with RBS-EcpanE-F / pECXK99E-EcpanE-R was named EcpanE. The above fragments were respectively ligated with the fragment pEXK99E in Example 3(1), transformed into E. coli DH5α, screened by kanamycin plates, and sequenced to verify that the correct pECXK99E-BspanE, pECXK99E-BspanE2, and pECXK99E-EcpanE plasmids were obtained;

[0063] (3) Construct plasmids pECXK99E-BspanBC+panE from different sources: Using Bacillus subtilis168 strain as a template, and RBS-BspanBCD-F / RBS-BspanC-R as primers for amplification, the obtained fragment was named BspanBC; the fragment BspanBC and the linearized plasmid pEXK99E were ligated together with the four panE fragments obtained in steps (1) and (2) respectively and transformed into E. coli DH5α. After screening with kanamycin plates and sequencing verification, the correct pEC-XK99E-BspanBCBspanE1, pEC-XK99E-BspanBCBspanE2, pEC-XK99E-BspanBCEcpanE, and pEC-XK99E-BspanBCCgpanE plasmids were obtained.

[0064] (4) Preparation of competent cells of wild-type strain DPAj-2: A single colony of DPAj-2 was picked and placed in 10 mL of BHIS liquid medium and cultured at 30 °C and 100 r / min for about 10 h. 3 mL of the above culture solution was then inoculated into 100 mL of BHIS liquid medium and cultured at 30 °C and 200 rpm until OD. 600 ≈0.9 (approximately 5 h of culture); transfer the culture medium to sterile centrifuge tubes and incubate on ice for approximately 30 min, then centrifuge at 4°C, 4000 r / min for 10 min, discard the supernatant, and collect the bacterial cells; then add 30 mL of pre-chilled 10% glycerol solution to the bacterial cells, gently agitate in ice water to resuspend the cells, and centrifuge at 4°C, 4000 r / min for 10 min after complete resuscitation, discard the supernatant, and collect the bacterial cells. Wash the collected bacterial cells once more with pre-chilled 10% glycerol solution. Resuspend the collected bacterial cells in a certain amount of pre-chilled 10% glycerol solution, aliquot into 100 μL tubes, and store at -80°C. These are the electrocompetent cells, ready for use.

[0065] (5) Electroporate the plasmids constructed in Examples 3 (1) and (2) and the empty plasmid pEXK99E into the competent cells prepared in Example 3 (3): Take 2 μg of the plasmids prepared in steps (1) and (2) and 100 μL of the electroporation competent cells prepared in step (4), mix them, and transfer them into a 1 mm electroporation cuvette pre-cooled at 4 ℃. Incubate on ice for 1 min and perform electroporation transformation using an electroporator (Micro Pluser, BIO-RAD). After two consecutive electroporations, immediately add the mixture to 1 mL of BHIS liquid medium pre-cooled at 4 ℃ and immediately transfer it to a sterile 1.5 mL centrifuge tube. After recovery at 30 ℃ and 200 rpm for 2 h, spread it on a BHIS plate containing 25 μg / L kanamycin and incubate upside down at 30 ℃ for 48 h until single colonies appear.

[0066] (6) Shake-flask fermentation: The strains obtained in step (5), with the starting strain pEXK99E as the control group, were inoculated into 5 mL of BHIS medium and cultured at 30 ℃ and 200 rpm as pre-cultures. After 12 h-24 h, 2 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 4% inoculation rate. The flasks were then cultured in a constant temperature shaker at 30 ℃ and 200 rpm for 48 h for fermentation. After fermentation, 1 mL of the fermentation broth was taken to determine the OD. 600 Simultaneously, 1 mL of fermentation broth was pipetted and centrifuged at 12000 rpm for 3 min at room temperature. After removing impurities using an aqueous filter membrane, the sample was analyzed by HPLC according to Example 1. OD 600 and the formation of metabolites in the fermentation broth supernatant, such as Figure 3 As shown;

[0067] Depend on Figure 3 As can be seen, peak A appeared in the control group when no protein was expressed. The standard curve for this substance indicates the precursor α-ketoisovalerate. After expression of pECXK99E-CgpanE, pECXK99E-BspanE, pECXK99E-BspanE2, and pECXK99E-EcpanE plasmids, peak A was transformed, resulting in a very small peak B. Similarly, after expression of pEC-XK99E-BspanBCBspanE2 and pEC-XK99E-BspanBCCgpanE plasmids, peak A was also transformed, resulting in a very small peak B. After expression of pEC-XK99E-BspanBCBspanE1 and pEC-XK99E-BspanBCEcpanE plasmids, peak A was transformed, resulting in a very large peak C. According to the standard curve, this peak is D-pantothenic acid. A very small peak B also appeared.

[0068] Fermentation medium: glucose: 30 g / L, ammonium sulfate: 16 g / L, corn steep liquor: 10 g / L, yeast extract: 2 g / L, KH₂PO₄: 0.8 g / L, MgSO₄: 0.5 g / L, sodium acetate: 5 g / L, β-alanine: 2 g / L, CaCO₃: 3 g / L, 1 mL / L trace element solution, solvent: deionized water, pH: natural. The trace element solution composition is: NiCl₂·7H₂O 0.02 g / L, CuCl₂ 10 g / L, FeSO₄·7H₂O 10 g / L, ZnSO₄·7H₂O 10 g / L, CuSO₄ 0.2 g / L, solvent: deionized water.

[0069] Example 4: HPLC / MS verification of the function of PanE from different sources

[0070] The fermentation broths of the various samples obtained in Example 3 were processed and then subjected to liquid chromatography-mass spectrometry.

[0071] (1) Sample preparation: The fermentation broth was filtered through a 0.22 μM organic phase membrane and analyzed by high-resolution liquid chromatography-quadrupole-orbit trap mass spectrometry (HPLC Q Exactive-MS, Agilent 6460), i.e., liquid chromatography and mass spectrometry coupled.

[0072] (2) Liquid chromatography: C18 column (250×4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30 ℃, flow rate: 1 ml / min; mobile phase: acetonitrile / water / phosphoric acid: (80 / 919 / 1); data acquisition time: 20 min.

[0073] (3) Mass spectrometry conditions: the electrospray ionization source is a negative ion source; the ion source voltage is 3000 V; the curtain gas is 35 psi; the nebulizing gas and the auxiliary gas are each 60 psi, the gas temperature is 325 °C, and the gas flow rate is 7 L / min.

[0074] (4) Use Qualitative Analysis B.07.00 software to analyze the data and determine the functions of PanE from different sources;

[0075] Depend on Figure 4 As can be seen, peak A has a relative molecular mass of 116, corresponding to the precursor α-ketoisovalerate; peak B has a relative molecular mass of 118, corresponding to 2-hydroxyisovalerate; and peak C has a relative molecular mass of 219, corresponding to D-pantothenic acid. This indicates that all four PanEs—CgPanE, BsPanE, BsPanE2, and EcPanE—possess the activity of α-hydroxy acid dehydrogenase, which converts the precursor α-ketoisovalerate to 2-hydroxyisovalerate. BsPanE and EcPanE can participate in the D-pantothenic acid synthesis pathway, exhibiting ketopantoacid dehydrogenase activity, while CgPanE and BsPanE2 cannot participate in the D-pantothenic acid synthesis pathway and do not possess ketopantoacid dehydrogenase activity. In general, BsPanE and EcPanE possess bifunctional activity, exhibiting both ketopantolate dehydrogenase activity, participating in the D-pantothenic acid synthesis pathway, and α-hydroxy acid dehydrogenase activity, capable of prematurely reacting with the precursor α-ketoisovalerate. CgPanE and BsPanE2 only possess α-hydroxy acid dehydrogenase activity, reacting with the precursor α-ketoisovalerate, and cannot participate in the D-pantothenic acid synthesis pathway.

[0076] Example 5: Dynamic Regulation of PanE Expression by Stationary Promoters

[0077] EcPanE from *E. coli* was chosen because overexpression of this protein prematurely consumes most of the precursor, wasting carbon sources and affecting D-pantothenic acid production. Underexpression, on the other hand, may fail to completely transform the precursor, also affecting D-pantothenic acid production. To effectively control the expression intensity of EcPanE and delay its expression, the stationary promoter P... 4-N14 It is selected to dynamically regulate its expression.

[0078] (1) Construction of plasmid pEC-XK99E-BspanBC+PdapB-EcpanE: Using C. glutamicum ATCC13032 strain as template, and BsGR-T2terpEC-PdapB-F / EcpanE-PdapB-R as primers, the obtained fragment was named PdapB; after purification, the fragment was ligated together with pEXK99E, EcpanE and BspanBC in Example 3, transformed into E. coli DH5α, screened by kanamycin plate, and sequenced to verify that the correct pEC-XK99E-BspanBC+PdapB-EcpanE was obtained;

[0079] (2) Construct pEC-XK99E-BspanBC+P 4-N14 -EcpanE plasmid: Using C. glutamicum ATCC 13032 strain as a template, and P4-N14RBS-F / P4-N14-T2ter-R as primers for amplification, the obtained fragment was named P 4-N14 After purification, the fragment was ligated with pEXK99E, EcpanE, and BspanBC from Example 3, transformed into E. coli DH5α, screened using kanamycin plates, and sequenced to verify the correct pEC-XK99E-BspanBC+P. 4-N14 -EcpanE;

[0080] (3) Electroporation of DPAj-2 competent cells: The plasmids pEC-XK99E-BspanBC+PdapB-EcpanE and pEC-XK99E-BspanBC+P from steps (1) and (2) were electroporated. 4-N14 -EcpanE, and pEC-XK99E-BspanBCEcpanE (strong promoter Ptrc controls the expression of EcPanE) constructed in Example 3 were transformed into DPAj-2 competent cells prepared in Example 3, using the same method as step (5) in Example 3, to obtain engineered strains with the corresponding plasmids.

[0081] (4) Shake flask fermentation: The method is the same as step (6) in Example 3. Samples are taken and tested at 4 h, 8 h, 12 h, 15 h, 24 h, 4 h, 30 h, 36 h, and 48 h.

[0082] Depend on Figure 5 It is evident that the strong promoter Ptrc showed no residual precursor α-ketoisovalerate in either the exponential growth or stationary phases, but the D-pantothenic acid yield was only 2.74 g / L. This indicates that premature and excessive expression of ketopantolysinic acid prematurely consumed the precursor α-ketoisovalerate in other pathways instead of using it for D-pantothenic acid synthesis. In contrast, the weak promoter PdapB was insufficient to completely convert α-ketoisovalerate, although the D-pantothenic acid yield was slightly higher (3.78 g / L), leaving 0.83 g / L of α-ketoisovalerate unused. When using the stationary promoter P... 4-N14 When used to control gene expression, a distinct two-phase characteristic emerged: during the exponential growth phase (12–24 hours), α-ketoisovalerate remained; upon entering the stationary phase, α-ketoisovalerate was completely consumed, while D-pantothenic acid production reached its peak (4.39 g / L). This pattern perfectly matches the P... 4-N14 It exhibits weak activity during the exponential phase and is strongly induced during the stationary phase. In general, using a stationary-phase promoter to dynamically control the expression of ketopantolytic acid can effectively balance precursor transformation and product formation.

[0083] In summary, this invention, by comparing the size of the active pocket cavity of PanE from different sources, found that enzymes capable of catalyzing ketopantoacid catalysis have a larger active pocket cavity area, allowing them to accommodate larger substrates. For the first time, HPLC / MS confirmed that EcPanE from *Escherichia coli* and BsPanE from *Bacillus subtilis* possess bifunctionality, including ketopantoacid dehydrogenase activity and α-hydroxy acid dehydrogenase activity. Furthermore, CgPanE from *Corynebacterium glutamicum* and BsPanE2 from *Bacillus subtilis* are α-hydroxy acid dehydrogenases, not the annotated 2-dehydropantoacid 2-reductase. The stable-phase promoter P was used. 4-N14 Dynamic regulation of EcPanE expression can both delay and maintain a certain level of expression. The precursor α-ketoisovalerate was completely converted in the strain, increasing D-pantothenic acid production to 4.39 g / L.

[0084] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A method for constructing a high-D-pantothenic acid-producing genetically engineered bacterium with dynamically regulated PanE expression, characterized in that, Includes the following steps: Step 1: Select the EcPanE crystal structure from Escherichia coli as a homology modeling template, and use the SWISS MODEL website to simulate the spatial structure of CgPanE from Corynebacterium glutamicum and BsPanE2 from Bacillus subtilis. Step 2: Using the ProteinsPlus web server, predict and compare the active pocket cavity size of five PanE proteins; the five PanE proteins are the predicted CgPanE and BsPanE2, PaPanE2 from Pseudomonas aeruginosa, BsPanE from Bacillus subtilis, and EcPanE from Escherichia coli. Step 3: Using plasmid pECXK99E as a vector, connect the BspanE gene and BspanE2 gene from Bacillus subtilis, the EcpanE gene from Escherichia coli, and the CgpanE gene from Corynebacterium glutamicum to construct a series of recombinant plasmids. Step 4: Using plasmid pECXK99E as a vector, the four panE genes from Step 3 were ligated to the gene cluster BspanBC from Bacillus subtilis168 to construct a series of recombinant expression plasmids. Step 5: Replace the promoter of the EcpanE gene in the recombinant expression plasmid described in Step 4 with the stationary phase promoter P. 4-N14 or weak promoter P dapB Construct recombinant expression plasmids with modified promoters; Step 6: Transform the series of recombinant expression plasmids obtained in Step 4 and the recombinant expression plasmids with promoter modification obtained in Step 5 into strain DPAj-2 for fermentation. Use the synthesis yield of D-pantothenic acid and the accumulation level of the byproduct α-ketoisovalerate as dual screening indicators. The engineered strain obtained by screening is the high-yield D-pantothenic acid genetically engineered bacterium that dynamically regulates PanE expression.

2. The construction method according to claim 1, characterized in that, The recombinant plasmids constructed in step 3 and the recombinant expression plasmids constructed in step 4 need to be introduced into strain DPAj-2 for fermentation testing. The metabolites in the fermentation broth are detected by HPLC-MS, and the obtained data are analyzed using Qualitative Analysis B.07.00 software to verify the functions of CgPanE and BsPanE2.

3. The construction method according to claim 1, characterized in that, The amino acid sequence of EcPanE is shown in SEQ ID NO.

1.

4. The construction method according to claim 1, characterized in that, The amino acid sequence of BsPanE1 is shown in SEQ ID NO.2; the amino acid sequence of BsPanE2 is shown in SEQ ID NO.

3.

5. The construction method according to claim 1, characterized in that, The amino acid sequence of CgPanE is shown in SEQ ID NO.

4.

6. The construction method according to claim 1, characterized in that, The stable promoter is P. 4-N14 It is derived from C. glutamicum, and its nucleotide sequence is shown in SEQ ID NO.

5.

7. The construction method according to claim 1, characterized in that, The weak promoter is P. dapB It is derived from C. glutamicum, and its nucleotide sequence is shown in SEQ ID NO.

6.

8. The genetically engineered bacteria obtained by the construction method according to any one of claims 1-7.

9. The application of the genetically engineered bacteria according to claim 8 in the microbial fermentation preparation of D-pantothenic acid.

10. The application according to claim 9, characterized in that, The application method is as follows: the genetically engineered bacteria are inoculated into a fermentation medium and fermented at 30℃ and 200 rpm for 48-60 h. After fermentation, the supernatant of the fermentation broth is separated and purified to obtain D-pantothenic acid. The fermentation medium consists of the following components: glucose: 10-30 g / L, corn steep liquor: 10-20 g / L, ammonium sulfate: 10-20 g / L, yeast extract: 1-5 g / L, KH2PO4: 0.2-1 g / L, MgSO4: 0.5-5 g / L, sodium acetate: 5-8 g / L, β-alanine: 0.5-2 g / L, CaCO3: 3-5 g / L, and 0.5-2 mL / L trace element solution in deionized water with a natural pH. The trace element solution consists of: NiCl2·7H2O 0.02 g / L, CuCl2 10 g / L, and FeSO4·7H2O. 10 g / L ZnSO4·7H2O 10 g / L, CuSO4 0.2 g / L, solvent is deionized water.

Images